Home |
Help |
Advanced search
2024-04-20 03:34:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004007 13764 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp427l, mRNA.
ACCESSION NM_004007
VERSION NM_004007.2 GI:238018045
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 13764)
AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A.
TITLE Nested introns in an intron: evidence of multi-step splicing in a
large intron of the human dystrophin pre-mRNA
JOURNAL FEBS Lett. 587 (6), 555-561 (2013)
PUBMED 23395799
REMARK GeneRIF: The evidence obtained for multi-step splicing in a large
intron of the human dystrophin pre-mRNA.
REFERENCE 2 (bases 1 to 13764)
AUTHORS Singh,S.M. and Mallela,K.M.
TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain
of dystrophin is in a closed conformation in solution and when
bound to F-actin
JOURNAL Biophys. J. 103 (9), 1970-1978 (2012)
PUBMED 23199925
REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain
binds to F-actin in a closed conformation.
REFERENCE 3 (bases 1 to 13764)
AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C.,
Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P.,
Gualandi,F., Perini,G. and Ferlini,A.
TITLE The DMD locus harbours multiple long non-coding RNAs which
orchestrate and control transcription of muscle dystrophin mRNA
isoforms
JOURNAL PLoS ONE 7 (9), E45328 (2012)
PUBMED 23028937
REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the
orchestration and homeostasis of the muscle dystrophin expression
pattern by either selective targeting and down-modulating the
dystrophin promoter transcriptional activity.
REFERENCE 4 (bases 1 to 13764)
AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M.,
Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M.,
Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De
Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and
Ferlini,A.
TITLE Genetic characterization in symptomatic female DMD carriers: lack
of relationship between X-inactivation, transcriptional DMD allele
balancing and phenotype
JOURNAL BMC Med. Genet. 13, 73 (2012)
PUBMED 22894145
REMARK GeneRIF: No relationship between X-inactivation pattern and
transcriptional behaviour of DMD gene was observed in Duchenne
muscular dystrophies.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 13764)
AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V.,
Chandak,G.R. and Kumar,A.
TITLE Genetic analysis of an Indian family with members affected with
Waardenburg syndrome and Duchenne muscular dystrophy
JOURNAL Mol. Vis. 18, 2022-2032 (2012)
PUBMED 22876130
REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation
in DMD has been found in the same Indian family members affected
with Waardenburg syndrome and Duchenne muscular dystrophy.
REFERENCE 6 (bases 1 to 13764)
AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and
Puca,G.A.
TITLE Detection of a nonsense mutation in the dystrophin gene by multiple
SSCP
JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992)
PUBMED 1307253
REFERENCE 7 (bases 1 to 13764)
AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A.
and Barnard,P.J.
TITLE Expression of four alternative dystrophin transcripts in brain
regions regulated by different promoters
JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992)
PUBMED 1307251
REFERENCE 8 (bases 1 to 13764)
AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O.,
Yaffe,D. and Nudel,U.
TITLE A 71-kilodalton protein is a major product of the Duchenne muscular
dystrophy gene in brain and other nonmuscle tissues
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992)
PUBMED 1319059
REFERENCE 9 (bases 1 to 13764)
AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van
Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D.
TITLE Characterization and cell type distribution of a novel, major
transcript of the Duchenne muscular dystrophy gene
JOURNAL Differentiation 49 (3), 187-193 (1992)
PUBMED 1377655
REFERENCE 10 (bases 1 to 13764)
AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M.
TITLE The complete sequence of dystrophin predicts a rod-shaped
cytoskeletal protein
JOURNAL Cell 53 (2), 219-228 (1988)
PUBMED 3282674
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from D32048.1, AL451144.5,
AL096699.11, AC004468.1, AL031542.1, M18533.1, AL109609.5,
AL139278.12, AC096506.5, AC093193.11, AC079864.22, AC093167.11,
AC079175.24, AC079177.21, AC090632.13, AC078958.30, AC079143.17 and
AC006061.1.
On May 24, 2009 this sequence version replaced gi:5032284.
Summary: The dystrophin gene is the largest gene found in nature,
measuring 2.4 Mb. The gene was identified through a positional
cloning approach, targeted at the isolation of the gene responsible
for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a
recessive, fatal, X-linked disorder occurring at a frequency of
about 1 in 3,500 new-born males. BMD is a milder allelic form. In
general, DMD patients carry mutations which cause premature
translation termination (nonsense or frame shift mutations), while
in BMD patients dystrophin is reduced either in molecular weight
(derived from in-frame deletions) or in expression level. The
dystrophin gene is highly complex, containing at least eight
independent, tissue-specific promoters and two polyA-addition
sites. Furthermore, dystrophin RNA is differentially spliced,
producing a range of different transcripts, encoding a large set of
protein isoforms. Dystrophin (as encoded by the Dp427 transcripts)
is a large, rod-like cytoskeletal protein which is found at the
inner surface of muscle fibers. Dystrophin is part of the
dystrophin-glycoprotein complex (DGC), which bridges the inner
cytoskeleton (F-actin) and the extra-cellular matrix. [provided by
RefSeq, Jul 2008].
Transcript Variant: transcript Dp427l originates at a unique
promoter/exon 1 with splicing to exon 3 of the full length
dystrophin (Dp427m) transcript. Consequently, amino acids 1-31 are
replaced by a single methionine.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
[ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-46 D32048.1 1-46
47-108 AL451144.5 64345-64406 c
109-201 AL096699.11 183805-183897 c
202-279 AL096699.11 178860-178937 c
280-372 AL096699.11 157372-157464 c
373-545 AL096699.11 150545-150717 c
546-664 AL096699.11 143570-143688 c
665-846 AL096699.11 33189-33370 c
847-975 AL096699.11 31947-32075 c
976-1164 AC004468.1 33996-34184
1165-1346 AC004468.1 34835-35016
1347-1497 AC004468.1 64695-64845
1498-1617 AC004468.1 83272-83391
1618-1719 AC004468.1 105302-105403
1720-1827 AC004468.1 105511-105618
1828-2007 AC004468.1 113267-113446
2008-2183 AL031542.1 126054-126229 c
2184-2307 AL031542.1 98903-99026 c
2308-2395 AL031542.1 82650-82737 c
2396-2637 AL031542.1 72172-72413 c
2638-2657 AL031542.1 65975-65994 c
2658-2662 M18533.1 2851-2855
2663-2818 AL031542.1 65814-65969 c
2819-2964 AL031542.1 53059-53204 c
2965-3177 AL031542.1 49393-49605 c
3178-3291 AL031542.1 45481-45594 c
3292-3447 AL031542.1 44334-44489 c
3448-3618 AL031542.1 35557-35727 c
3619-3801 AL031542.1 29351-29533 c
3802-3936 AL031542.1 22075-22209 c
3937-4086 AL031542.1 19136-19285 c
4087-4248 AL109609.5 101645-101806 c
4249-4359 AL109609.5 79964-80074 c
4360-4533 AL109609.5 79394-79567 c
4534-4689 AL109609.5 76203-76358 c
4690-4860 AL109609.5 70403-70573 c
4861-5040 AL109609.5 54913-55092 c
5041-5169 AL109609.5 54475-54603 c
5170-5340 AL109609.5 52681-52851 c
5341-5463 AL109609.5 38299-38421 c
5464-5601 AL109609.5 35836-35973 c
5602-5754 AL109609.5 33027-33179 c
5755-5937 AL109609.5 31993-32175 c
5938-6006 AL109609.5 101-169 c
6007-6132 AL139278.12 95741-95866 c
6133-6305 AC096506.5 116719-116891 c
6306-6453 AC096506.5 46106-46253 c
6454-6629 AC093193.11 75522-75697 c
6630-6777 AC093193.11 39263-39410 c
6778-6927 AC093193.11 36779-36928 c
6928-7108 AC079864.22 141604-141784 c
7109-7113 M18533.1 7302-7306
7114-7215 AC079864.22 103129-103230 c
7216-7324 AC079864.22 86386-86494 c
7325-7557 AC079864.22 40371-40603 c
7558-7675 AC093167.11 69474-69591 c
7676-7887 AC093167.11 19218-19429 c
7888-8042 AC079175.24 4086-4240
8043-8232 AC079175.24 34368-34557
8233-8405 AC079175.24 154777-154949
8406-8562 AC079177.21 151290-151446 c
8563-8683 AC079177.21 133485-133605 c
8684-8822 AC079177.21 132738-132876 c
8823-8827 M18533.1 9016-9020
8828-8952 AC079177.21 132608-132732 c
8953-9099 AC079177.21 98983-99129 c
9100-9178 AC079177.21 3058-3136 c
9179-9239 AC090632.13 23849-23909
9240-9301 AC078958.30 133368-133429 c
9302-9376 AC078958.30 95460-95534 c
9377-9578 AC078958.30 81911-82112 c
9579-9664 AC078958.30 78995-79080 c
9665-9822 AC078958.30 76374-76531 c
9823-9989 AC078958.30 55151-55317 c
9990-10101 AC078958.30 52783-52894 c
10102-10238 AC078958.30 51082-51218 c
10239-10277 AC078958.30 50345-50383 c
10278-10343 AC078958.30 45952-46017 c
10344-10409 AC078958.30 44761-44826 c
10410-10568 AC078958.30 41856-42014 c
10569-10812 AC078958.30 19688-19931 c
10813-10936 AC078958.30 18704-18827 c
10937-11029 AC078958.30 6515-6607 c
11030-11061 AC079143.17 2357-2388 c
11062-13764 AC006061.1 91001-93703 c
FEATURES Location/Qualifiers
source 1..13764
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp21.2"
gene 1..13764
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="dystrophin"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
misc_feature 47..108
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Nishio et al. state that bases 47-108 (dystrophin
exon 2) are not in the transcript, while Muntoni et al.
state they are"
variation 105
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:3764764"
variation 105
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="t"
/db_xref="dbSNP:66800250"
CDS 385..11073
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Dp427l isoform is encoded by transcript variant
Dp427l"
/codon_start=1
/product="dystrophin Dp427l isoform"
/protein_id="NP_003998.1"
/db_xref="GI:5032285"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
/translation="
MKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
"
misc_feature 418..735
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(418..423,427..435,442..444,451..453,613..618,
625..627,637..639,643..645,691..696,703..708,712..717,
724..729)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1036..1689
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1357..1374
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 1474..2022
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1687..1704
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 2194..2814
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 2500..2517
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 3160..3804
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 3478..3495
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 3817..4437
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4117..4134
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 4414..5043
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4720..4737
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 5050..5343
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeat; Region: Spectrin; pfam00435"
/db_xref="CDD:201223"
misc_feature 5125..5952
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Uncharacterized archaeal coiled-coil protein
[Function unknown]; Region: COG1340"
/db_xref="CDD:31531"
misc_feature 5353..5919
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 5641..5658
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6013..6639
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 6319..6336
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6328..6975
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature order(6640..6648,6652..6660)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 7429..8079
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 7747..7764
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 8083..8814
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 8422..8439
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 8818..>9150
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 9136..9150
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 9190..9279
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Two conserved tryptophans domain; also known as the
WWP or rsp5 domain; around 40 amino acids; functions as an
interaction module in a diverse set of signalling
proteins; binds specific proline-rich sequences but at low
affinities compared to other...; Region: WW; cd00201"
/db_xref="CDD:29258"
misc_feature order(9229..9231,9262..9264)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="binding pocket"
/db_xref="CDD:29258"
misc_feature 9274..9636
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF hand; Region: efhand_1; pfam09068"
/db_xref="CDD:149945"
misc_feature 9646..9921
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF-hand; Region: efhand_2; pfam09069"
/db_xref="CDD:149946"
misc_feature 9946..10092
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc finger, ZZ type. Zinc finger present in
dystrophin and dystrobrevin. The ZZ motif coordinates two
zinc ions and most likely participates in ligand binding
or molecular scaffolding. Dystrophin attaches actin
filaments to an integral membrane...; Region:
ZZ_dystrophin; cd02334"
/db_xref="CDD:30238"
misc_feature order(9952..9954,9961..9963,9997..9999,10006..10008,
10024..10026,10033..10035,10063..10065,10075..10077)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc-binding sites [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(9952..9954,9961..9963,10024..10026,10033..10035)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 1 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(9955..9957,9988..9990,9994..9996,10012..10014,
10018..10020)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative charged binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(9991..9993,10036..10038,10081..10083,10090..10092)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative hydrophobic binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(9997..9999,10006..10008,10063..10065,10075..10077)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 2 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature 10288..10290
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
variation 413
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800256"
STS 553..661
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99269"
variation 817
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800264"
variation 852
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800265"
variation 1110
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800266"
variation 1113
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72470507"
STS 1293..1867
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84337-84338:1278013457:1"
/db_xref="UniSTS:532589"
variation 1352
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468699"
variation 1685
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800257"
variation 1689
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800258"
STS 1755..2341
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84339-84340:1278014518:1"
/db_xref="UniSTS:532590"
variation 1882
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800259"
variation 1884
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800267"
variation 1903
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468692"
variation 2366
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800260"
variation 2406
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468681"
variation 2472
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72468680"
variation 2505
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468679"
variation 2986
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468667"
variation 3036
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800268"
variation 3045
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468666"
variation 3135
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800261"
variation 3604
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800262"
STS 3622..3720
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99474"
variation 3749
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800269"
variation 3847
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800270"
variation 4146
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800263"
variation 4290
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468647"
variation 4421
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:1057872"
variation 4544
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468638"
STS 4547..4659
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99582"
variation 4892
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72468634"
variation 4992
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801185"
variation 5055
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468632"
variation 5178
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468630"
variation 5249
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801187"
STS 5426..5983
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84357-84358:1278016549:1"
/db_xref="UniSTS:532591"
variation 5474
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800271"
variation 5545
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1064325"
variation 5547
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1801186"
STS 5651..5745
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99541"
variation 5790
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800272"
variation 6043
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468613"
STS 6307..6431
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99225"
variation 6478
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800273"
STS 6681..6763
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99066"
variation 6843
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466595"
variation 7095
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800274"
variation 7111
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800275"
variation 7198
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466590"
STS 7379..7490
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS7499"
/db_xref="UniSTS:30753"
variation 7743
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801188"
variation 7835
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72466581"
STS 7900..8035
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99382"
variation 8070
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801189"
STS 8242..8341
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99545"
variation 8337
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72466575"
variation 8511
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466574"
variation 8586
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466570"
variation 8594
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466569"
variation 8825
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800280"
STS 8836..8938
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99400"
variation 8867
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466567"
variation 9108
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466563"
variation 9109
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466562"
STS 9587..9654
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99128"
variation 10635
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466538"
variation 10804
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800281"
variation 11033
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1795743"
STS 11155..11348
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC316713P2"
/db_xref="UniSTS:273040"
STS 11423..11611
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="G15848"
/db_xref="UniSTS:3168"
STS 11464..11596
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS1234"
/db_xref="UniSTS:146800"
variation 11553..11554
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acac"
/replace="taca"
/db_xref="dbSNP:3833413"
variation 11997
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acaa"
/db_xref="dbSNP:72466531"
variation 12041
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="t"
/db_xref="dbSNP:72466530"
STS 12079..12147
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS503"
/db_xref="UniSTS:99031"
variation 12121
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="gat"
/db_xref="dbSNP:72466529"
variation 12318
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="cttt"
/db_xref="dbSNP:72466527"
STS 12385..12535
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS6988E"
/db_xref="UniSTS:32060"
variation 12520
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:3361"
STS 12541..12641
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="A002S20"
/db_xref="UniSTS:57879"
variation 12638
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aaag"
/db_xref="dbSNP:72466526"
variation 12664
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="tgtt"
/db_xref="dbSNP:72466525"
variation 12804
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:3198427"
variation 12831
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="ttcat"
/db_xref="dbSNP:72466524"
variation 13112
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466523"
variation 13226
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="atgtgacgctggacctt"
/db_xref="dbSNP:72466522"
variation 13258
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:11550191"
variation 13310
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aagt"
/db_xref="dbSNP:72466521"
STS 13391..13582
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:506537"
variation 13500
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057915"
STS 13648..13732
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC108984P1"
/db_xref="UniSTS:270148"
variation 13654
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="actt"
/db_xref="dbSNP:72466520"
polyA_signal 13742..13747
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
polyA_site 13764
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
ORIGIN
tattacaaaagagtcaagaaattaaaaaagcaaaagtttataaataatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS
GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA
GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS
GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS
GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS
GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA
GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA
GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS
GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP
GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA
GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS
GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS
GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA
GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP
GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA
GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA
GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA
GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS
GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP
GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS
GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS
GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA
GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS
GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.