Home |
Help |
Advanced search
2024-04-19 19:55:10, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004006 13993 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA.
ACCESSION NM_004006
VERSION NM_004006.2 GI:238018044
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 13993)
AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A.
TITLE Nested introns in an intron: evidence of multi-step splicing in a
large intron of the human dystrophin pre-mRNA
JOURNAL FEBS Lett. 587 (6), 555-561 (2013)
PUBMED 23395799
REMARK GeneRIF: The evidence obtained for multi-step splicing in a large
intron of the human dystrophin pre-mRNA.
REFERENCE 2 (bases 1 to 13993)
AUTHORS Singh,S.M. and Mallela,K.M.
TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain
of dystrophin is in a closed conformation in solution and when
bound to F-actin
JOURNAL Biophys. J. 103 (9), 1970-1978 (2012)
PUBMED 23199925
REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain
binds to F-actin in a closed conformation.
REFERENCE 3 (bases 1 to 13993)
AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C.,
Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P.,
Gualandi,F., Perini,G. and Ferlini,A.
TITLE The DMD locus harbours multiple long non-coding RNAs which
orchestrate and control transcription of muscle dystrophin mRNA
isoforms
JOURNAL PLoS ONE 7 (9), E45328 (2012)
PUBMED 23028937
REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the
orchestration and homeostasis of the muscle dystrophin expression
pattern by either selective targeting and down-modulating the
dystrophin promoter transcriptional activity.
REFERENCE 4 (bases 1 to 13993)
AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M.,
Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M.,
Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De
Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and
Ferlini,A.
TITLE Genetic characterization in symptomatic female DMD carriers: lack
of relationship between X-inactivation, transcriptional DMD allele
balancing and phenotype
JOURNAL BMC Med. Genet. 13, 73 (2012)
PUBMED 22894145
REMARK GeneRIF: No relationship between X-inactivation pattern and
transcriptional behaviour of DMD gene was observed in Duchenne
muscular dystrophies.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 13993)
AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V.,
Chandak,G.R. and Kumar,A.
TITLE Genetic analysis of an Indian family with members affected with
Waardenburg syndrome and Duchenne muscular dystrophy
JOURNAL Mol. Vis. 18, 2022-2032 (2012)
PUBMED 22876130
REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation
in DMD has been found in the same Indian family members affected
with Waardenburg syndrome and Duchenne muscular dystrophy.
REFERENCE 6 (bases 1 to 13993)
AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and
Puca,G.A.
TITLE Detection of a nonsense mutation in the dystrophin gene by multiple
SSCP
JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992)
PUBMED 1307253
REFERENCE 7 (bases 1 to 13993)
AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A.
and Barnard,P.J.
TITLE Expression of four alternative dystrophin transcripts in brain
regions regulated by different promoters
JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992)
PUBMED 1307251
REFERENCE 8 (bases 1 to 13993)
AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O.,
Yaffe,D. and Nudel,U.
TITLE A 71-kilodalton protein is a major product of the Duchenne muscular
dystrophy gene in brain and other nonmuscle tissues
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992)
PUBMED 1319059
REFERENCE 9 (bases 1 to 13993)
AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van
Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D.
TITLE Characterization and cell type distribution of a novel, major
transcript of the Duchenne muscular dystrophy gene
JOURNAL Differentiation 49 (3), 187-193 (1992)
PUBMED 1377655
REFERENCE 10 (bases 1 to 13993)
AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M.
TITLE The complete sequence of dystrophin predicts a rod-shaped
cytoskeletal protein
JOURNAL Cell 53 (2), 219-228 (1988)
PUBMED 3282674
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL031643.1, M18533.1,
AL109609.5 and BC028720.1.
This sequence is a reference standard in the RefSeqGene project.
On May 24, 2009 this sequence version replaced gi:5032282.
Summary: The dystrophin gene is the largest gene found in nature,
measuring 2.4 Mb. The gene was identified through a positional
cloning approach, targeted at the isolation of the gene responsible
for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a
recessive, fatal, X-linked disorder occurring at a frequency of
about 1 in 3,500 new-born males. BMD is a milder allelic form. In
general, DMD patients carry mutations which cause premature
translation termination (nonsense or frame shift mutations), while
in BMD patients dystrophin is reduced either in molecular weight
(derived from in-frame deletions) or in expression level. The
dystrophin gene is highly complex, containing at least eight
independent, tissue-specific promoters and two polyA-addition
sites. Furthermore, dystrophin RNA is differentially spliced,
producing a range of different transcripts, encoding a large set of
protein isoforms. Dystrophin (as encoded by the Dp427 transcripts)
is a large, rod-like cytoskeletal protein which is found at the
inner surface of muscle fibers. Dystrophin is part of the
dystrophin-glycoprotein complex (DGC), which bridges the inner
cytoskeleton (F-actin) and the extra-cellular matrix. [provided by
RefSeq, Jul 2008].
Transcript Variant: transcript Dp427m encodes the main dystrophin
protein found in muscle. As a result of alternative promoter use,
exon 1 encodes a unique N-terminal MLWWEEVEDCY aa sequence.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: M18533.1, X14298.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-44 AL031643.1 20726-20769 c
45-4649 M18533.1 9-4613
4650-4650 AL109609.5 79506-79506 c
4651-5773 M18533.1 4615-5737
5774-5774 AL109609.5 35892-35892 c
5775-12748 M18533.1 5739-12712
12749-13993 BC028720.1 3398-4642
FEATURES Location/Qualifiers
source 1..13993
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp21.2"
gene 1..13993
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="dystrophin"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
STS 49..271
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99343"
variation 131
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="t"
/db_xref="dbSNP:72470542"
misc_feature 227..229
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="upstream in-frame stop codon"
CDS 245..11302
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Dp427m isoform is encoded by transcript variant
Dp427m"
/codon_start=1
/product="dystrophin Dp427m isoform"
/protein_id="NP_003997.1"
/db_xref="GI:5032283"
/db_xref="CCDS:CCDS14233.1"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
/translation="
MLWWEEVEDCYEREDVQKKTFTKWVNAQFSKFGKQHIENLFSDLQDGRRLLDLLEGLTGQKLPKEKGSTRVHALNNVNKALRVLQNNNVDLVNIGSTDIVDGNHKLTLGLIWNIILHWQVKNVMKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
"
misc_feature 245..277
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: dystrophin Dp427m unique N-terminus"
misc_feature 278..964
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Actin binding domain"
misc_feature 290..601
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(290..295,299..307,314..316,323..325,485..490,
497..499,506..508,512..514,557..562,569..574,578..583,
590..595)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 647..964
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(647..652,656..664,671..673,680..682,842..847,
854..856,866..868,872..874,920..925,932..937,941..946,
953..958)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1001..9364
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: central rod domain"
misc_feature 1001..1225
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 1"
misc_feature 1253..1585
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 1"
misc_feature 1265..1918
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1586..1912
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 2"
misc_feature 1586..1603
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 1703..2251
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1913..2245
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 3"
misc_feature 1916..1933
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 2246..2395
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 2"
misc_feature 2396..2728
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 4"
misc_feature 2423..3043
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 2729..3046
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 5"
misc_feature 2729..2746
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 3047..3379
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 6"
misc_feature 3380..3706
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 7"
misc_feature 3389..4033
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 3707..4033
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 8"
misc_feature 3707..3724
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 4034..4345
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 9"
misc_feature 4046..4666
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4346..4633
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 10"
misc_feature 4346..4363
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 4625..4948
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 11"
misc_feature 4643..5272
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4949..5272
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 12"
misc_feature 4949..4966
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 5273..5578
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 13"
misc_feature 5279..5572
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeat; Region: Spectrin; pfam00435"
/db_xref="CDD:201223"
misc_feature 5354..6181
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Uncharacterized archaeal coiled-coil protein
[Function unknown]; Region: COG1340"
/db_xref="CDD:31531"
misc_feature 5579..5866
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 14"
misc_feature 5582..6148
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 5867..6163
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 15"
misc_feature 5870..5887
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6218..6547
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 16"
misc_feature 6242..6868
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 6548..6868
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 17"
misc_feature 6548..6565
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6557..7204
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 6869..7198
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 18"
misc_feature order(6869..6877,6881..6889)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 7199..7513
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 19"
misc_feature 7514..7654
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 3"
misc_feature 7655..7975
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 20"
misc_feature 7658..8308
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 7976..8302
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 21"
misc_feature 7976..7993
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 8303..8650
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 22"
misc_feature 8312..9043
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 8651..9037
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 23"
misc_feature 8651..8668
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 9038..9364
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 24"
misc_feature 9047..>9379
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 9284..9580
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 4"
misc_feature 9365..9379
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 9410..9520
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: WW-domain"
misc_feature 9419..9508
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Two conserved tryptophans domain; also known as the
WWP or rsp5 domain; around 40 amino acids; functions as an
interaction module in a diverse set of signalling
proteins; binds specific proline-rich sequences but at low
affinities compared to other...; Region: WW; cd00201"
/db_xref="CDD:29258"
misc_feature order(9458..9460,9491..9493)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="binding pocket"
/db_xref="CDD:29258"
misc_feature 9482..10468
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="dystroglycan binding site"
misc_feature 9503..9865
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF hand; Region: efhand_1; pfam09068"
/db_xref="CDD:149945"
misc_feature 9542..10144
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Cysteine-rich domain"
misc_feature 9632..9715
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: EF-hand 1"
misc_feature 9776..9862
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: EF-hand 2"
misc_feature 9875..10150
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF-hand; Region: efhand_2; pfam09069"
/db_xref="CDD:149946"
misc_feature 10142..11299
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Carboxy-terminal region"
misc_feature 10163..10306
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: ZZ-domain"
misc_feature 10175..10321
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc finger, ZZ type. Zinc finger present in
dystrophin and dystrobrevin. The ZZ motif coordinates two
zinc ions and most likely participates in ligand binding
or molecular scaffolding. Dystrophin attaches actin
filaments to an integral membrane...; Region:
ZZ_dystrophin; cd02334"
/db_xref="CDD:30238"
misc_feature order(10181..10183,10190..10192,10226..10228,10235..10237,
10253..10255,10262..10264,10292..10294,10304..10306)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc-binding sites [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(10181..10183,10190..10192,10253..10255,10262..10264)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 1 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(10184..10186,10217..10219,10223..10225,10241..10243,
10247..10249)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative charged binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(10220..10222,10265..10267,10310..10312,10319..10321)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative hydrophobic binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(10226..10228,10235..10237,10292..10294,10304..10306)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 2 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature 10517..10519
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 10574..10726
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="alpha1-syntrophin binding site"
misc_feature 10727..10849
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="beta1-syntrophin binding site"
misc_feature 10916..11023
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: (Leu)6-heptad repeat"
variation 338..5269
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="minor alternatively spliced product of a genomic
deletion of exons 3-34 (joins exons 2 and 36, no
frameshift); determined on muscle RNA (M63074)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
variation 338..1204
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="minor alternatively spliced product of a genomic
deletion of exons 3-7 (joins exons 2 and 10, no
frameshift); determined on muscle mRNA (S60972)"
/phenotype="Becker Muscular Dystrophy (DMD"
variation 603..1847
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion of exons 6-13 (no frame shift); determined
on muscle RNA (M63075)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
variation 642
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800256"
variation 776..1847
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion of exons 7-13 causing a frame shift;
determined on lymphoblast and muscle mRNA (S60971)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
STS 782..890
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99269"
variation 1046
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800264"
variation 1081
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800265"
variation 1339
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800266"
variation 1342
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72470507"
STS 1522..2096
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84337-84338:1278013457:1"
/db_xref="UniSTS:532589"
variation 1581
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468699"
variation 1914
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800257"
variation 1918
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800258"
STS 1984..2570
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84339-84340:1278014518:1"
/db_xref="UniSTS:532590"
variation 2111
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800259"
variation 2113
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800267"
variation 2132
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468692"
variation 2595
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800260"
variation 2635
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468681"
variation 2701
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72468680"
variation 2734
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468679"
variation 2889
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="creates BglII restriction site; in protein
Gly/Asp882"
/frequency="~0.25"
/replace="a"
variation 3215
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468667"
variation 3265
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800268"
variation 3274
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468666"
variation 3364
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800261"
variation 3713
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="point mutation causing translational stop; Glu1157X
(S43366)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
/replace="t"
variation 3833
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800262"
STS 3851..3949
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99474"
variation 3978
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800269"
variation 4076
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800270"
variation 4375
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800263"
variation 4519
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468647"
variation 4650
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:1057872"
variation 4651
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="creates AluI restriction site; in protein
Gln/Leu1469 (M18533)"
/replace="t"
variation 4773
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468638"
STS 4776..4888
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99582"
variation 5121
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72468634"
variation 5221
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801185"
variation 5284
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468632"
variation 5407
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468630"
variation 5478
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="removes SacII restriction site; in protein
Arg/His1745 (X14298)"
/frequency="~0.40"
/replace="a"
variation 5478
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801187"
STS 5655..6212
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84357-84358:1278016549:1"
/db_xref="UniSTS:532591"
variation 5703
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800271"
variation 5774
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="in protein Arg/Arg1844 (M18533)"
/replace="a"
variation 5774
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1064325"
variation 5776
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1801186"
variation 5795
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="point mutation causing translational stop; Gln1851X
(S88367)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
/replace="t"
STS 5880..5974
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99541"
variation 6019
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800272"
variation 6272
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468613"
variation 6535..6682
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="insertion of a 5' truncated L1 element into the 3'
end of exon 44 resulting in skipping of the exon during
splicing and causing a frame shift; determined on RNA
(S60091)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
variation 6536..7157
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion of exons 44-47 causing a frame shift;
determined on lymphoblast mRNA (S60970)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
STS 6536..6660
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99225"
variation 6707
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800273"
STS 6910..6992
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99066"
variation 7007..7553
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion of exons 47-50 causing a frame shift;
determined on RNA of cultured myotubes (S54699)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
variation 7072
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466595"
variation 7324
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800274"
variation 7340
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="removes MseI restriction site; in protein
Lys/Gln2366 (X14298)"
/frequency="~0.20"
/replace="a"
variation 7340
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800275"
variation 7427
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466590"
variation 7445..7553
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion of exon 50 causing a frame shift;
determined on muscle RNA (M63072 and S60973)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
STS 7608..7719
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS7499"
/db_xref="UniSTS:30753"
variation 7972
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801188"
variation 8064
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72466581"
STS 8129..8264
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99382"
variation 8299
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801189"
STS 8471..8570
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99545"
variation 8566
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72466575"
variation 8740
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466574"
variation 8815
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466570"
variation 8823
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466569"
variation 9054
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800280"
STS 9065..9167
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99400"
variation 9096
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466567"
variation 9337
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466563"
variation 9338
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466562"
STS 9816..9883
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99128"
misc_feature 10468..10506
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="alternatively spliced exon 71 (see Dp71)"
variation 10698
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="deletion causes frame shift and premature
translation termination (S88396, S88398)"
/phenotype="Duchenne Muscular Dystrophy (DMD)"
variation 10864
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466538"
variation 11033
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800281"
misc_feature 11259..11290
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="alternatively spliced exon 78, encoding different
C-terminus (see Dp71)"
variation 11262
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1795743"
STS 11384..11577
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC316713P2"
/db_xref="UniSTS:273040"
STS 11652..11840
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="G15848"
/db_xref="UniSTS:3168"
STS 11693..11825
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS1234"
/db_xref="UniSTS:146800"
variation 11782..11783
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acac"
/replace="taca"
/db_xref="dbSNP:3833413"
variation 12226
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acaa"
/db_xref="dbSNP:72466531"
variation 12270
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="t"
/db_xref="dbSNP:72466530"
STS 12308..12376
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS503"
/db_xref="UniSTS:99031"
variation 12350
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="gat"
/db_xref="dbSNP:72466529"
variation 12547
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="cttt"
/db_xref="dbSNP:72466527"
STS 12614..12764
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS6988E"
/db_xref="UniSTS:32060"
variation 12749
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:3361"
STS 12770..12870
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="A002S20"
/db_xref="UniSTS:57879"
variation 12867
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aaag"
/db_xref="dbSNP:72466526"
variation 12893
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="tgtt"
/db_xref="dbSNP:72466525"
variation 13033
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:3198427"
variation 13060
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="ttcat"
/db_xref="dbSNP:72466524"
variation 13341
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466523"
variation 13455
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="atgtgacgctggacctt"
/db_xref="dbSNP:72466522"
variation 13487
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:11550191"
variation 13539
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aagt"
/db_xref="dbSNP:72466521"
STS 13620..13811
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:506537"
variation 13729
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057915"
STS 13877..13961
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC108984P1"
/db_xref="UniSTS:270148"
variation 13883
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="actt"
/db_xref="dbSNP:72466520"
polyA_signal 13971..13976
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
polyA_site 13993
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
ORIGIN
tcctggcatcagttactgtgttgactcactcagtgttgggatcactcactttccccctacaggactcagatctgggaggcaattaccttcggagaaaaacgaataggaaaaactgaagtgttactttttttaaagctgctgaagtttgttggtttctcattgtttttaagcctactggagcaataaagtttgaagaacttttaccaggttttttttatcgctgccttgatatacacttttcaaaatgctttggtgggaagaagtagaggactgttatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS
GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA
GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS
GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS
GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS
GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA
GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA
GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS
GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP
GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA
GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS
GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS
GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA
GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP
GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA
GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA
GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA
GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS
GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP
GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS
GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS
GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA
GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS
GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.