Home |
Help |
Advanced search
2024-04-19 21:07:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003882 5194 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1),
transcript variant 1, mRNA.
ACCESSION NM_003882
VERSION NM_003882.3 GI:325910840
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5194)
AUTHORS Liu,J.F., Hou,S.M., Tsai,C.H., Huang,C.Y., Hsu,C.J. and Tang,C.H.
TITLE CCN4 induces vascular cell adhesion molecule-1 expression in human
synovial fibroblasts and promotes monocyte adhesion
JOURNAL Biochim. Biophys. Acta 1833 (5), 966-975 (2013)
PUBMED 23313051
REMARK GeneRIF: The CCN4-induced VCAM-1 expression promoted monocyte
adhesion to human OASFs.
REFERENCE 2 (bases 1 to 5194)
AUTHORS Saxena,R., Saleheen,D., Been,L.F., Garavito,M.L., Braun,T.,
Bjonnes,A., Young,R., Ho,W.K., Rasheed,A., Frossard,P., Sim,X.,
Hassanali,N., Radha,V., Chidambaram,M., Liju,S., Rees,S.D.,
Ng,D.P., Wong,T.Y., Yamauchi,T., Hara,K., Tanaka,Y., Hirose,H.,
McCarthy,M.I., Morris,A.P., Basit,A., Barnett,A.H., Katulanda,P.,
Matthews,D., Mohan,V., Wander,G.S., Singh,J.R., Mehra,N.K.,
Ralhan,S., Kamboh,M.I., Mulvihill,J.J., Maegawa,H., Tobe,K.,
Maeda,S., Cho,Y.S., Tai,E.S., Kelly,M.A., Chambers,J.C.,
Kooner,J.S., Kadowaki,T., Deloukas,P., Rader,D.J., Danesh,J. and
Sanghera,D.K.
CONSRTM DIAGRAM; MuTHER; AGEN
TITLE Genome-wide association study identifies a novel locus contributing
to type 2 diabetes susceptibility in Sikhs of Punjabi origin from
India
JOURNAL Diabetes 62 (5), 1746-1755 (2013)
PUBMED 23300278
REFERENCE 3 (bases 1 to 5194)
AUTHORS Zemans,R.L., McClendon,J., Aschner,Y., Briones,N., Young,S.K.,
Lau,L.F., Kahn,M. and Downey,G.P.
TITLE Role of beta-catenin-regulated CCN matricellular proteins in
epithelial repair after inflammatory lung injury
JOURNAL Am. J. Physiol. Lung Cell Mol. Physiol. 304 (6), L415-L427 (2013)
PUBMED 23316072
REMARK GeneRIF: Beta-catenin-dependent expression of WISP1 and Cyr61 is
critical for epithelial repair.
REFERENCE 4 (bases 1 to 5194)
AUTHORS Hennemeier,I., Humpf,H.U., Gekle,M. and Schwerdt,G.
TITLE The food contaminant and nephrotoxin ochratoxin A enhances Wnt1
inducible signaling protein 1 and tumor necrosis factor-alpha
expression in human primary proximal tubule cells
JOURNAL Mol Nutr Food Res 56 (9), 1375-1384 (2012)
PUBMED 22778029
REMARK GeneRIF: Prolonged exposure of kidney cells to ochratoxin A,
expectable in human kidney due to a normal diet, leads to a marked
ERK1/2-dependent upregulation of WISP1 gene expression, which,
accompanied by increased ERK1/2- dependent TNF-alpha expression.
REFERENCE 5 (bases 1 to 5194)
AUTHORS Shao,H., Cai,L., Grichnik,J.M., Livingstone,A.S., Velazquez,O.C.
and Liu,Z.J.
TITLE Activation of Notch1 signaling in stromal fibroblasts inhibits
melanoma growth by upregulating WISP-1
JOURNAL Oncogene 30 (42), 4316-4326 (2011)
PUBMED 21516124
REMARK GeneRIF: This study shows that constitutive activation of the
Notch1 pathway confers fibroblasts with a suppressive phenotype to
melanoma growth, partially through WISP-1.
REFERENCE 6 (bases 1 to 5194)
AUTHORS Xie,D., Nakachi,K., Wang,H., Elashoff,R. and Koeffler,H.P.
TITLE Elevated levels of connective tissue growth factor, WISP-1, and
CYR61 in primary breast cancers associated with more advanced
features
JOURNAL Cancer Res. 61 (24), 8917-8923 (2001)
PUBMED 11751417
REMARK GeneRIF: Elevated levels of connective tissue growth factor,
WISP-1, and CYR61 in primary breast cancers associated with more
advanced features.
REFERENCE 7 (bases 1 to 5194)
AUTHORS Desnoyers,L., Arnott,D. and Pennica,D.
TITLE WISP-1 binds to decorin and biglycan
JOURNAL J. Biol. Chem. 276 (50), 47599-47607 (2001)
PUBMED 11598131
REFERENCE 8 (bases 1 to 5194)
AUTHORS Tanaka,S., Sugimachi,K., Saeki,H., Kinoshita,J., Ohga,T.,
Shimada,M., Maehara,Y. and Sugimachi,K.
TITLE A novel variant of WISP1 lacking a Von Willebrand type C module
overexpressed in scirrhous gastric carcinoma
JOURNAL Oncogene 20 (39), 5525-5532 (2001)
PUBMED 11571650
REFERENCE 9 (bases 1 to 5194)
AUTHORS Xu,L., Corcoran,R.B., Welsh,J.W., Pennica,D. and Levine,A.J.
TITLE WISP-1 is a Wnt-1- and beta-catenin-responsive oncogene
JOURNAL Genes Dev. 14 (5), 585-595 (2000)
PUBMED 10716946
REFERENCE 10 (bases 1 to 5194)
AUTHORS Pennica,D., Swanson,T.A., Welsh,J.W., Roy,M.A., Lawrence,D.A.,
Lee,J., Brush,J., Taneyhill,L.A., Deuel,B., Lew,M., Watanabe,C.,
Cohen,R.L., Melhem,M.F., Finley,G.G., Quirke,P., Goddard,A.D.,
Hillan,K.J., Gurney,A.L., Botstein,D. and Levine,A.J.
TITLE WISP genes are members of the connective tissue growth factor
family that are up-regulated in wnt-1-transformed cells and
aberrantly expressed in human colon tumors
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 95 (25), 14717-14722 (1998)
PUBMED 9843955
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK293031.1, AF192304.6 and
AI347990.1.
This sequence is a reference standard in the RefSeqGene project.
On Mar 11, 2011 this sequence version replaced gi:18490998.
Summary: This gene encodes a member of the WNT1 inducible signaling
pathway (WISP) protein subfamily, which belongs to the connective
tissue growth factor (CTGF) family. WNT1 is a member of a family of
cysteine-rich, glycosylated signaling proteins that mediate diverse
developmental processes. The CTGF family members are characterized
by four conserved cysteine-rich domains: insulin-like growth
factor-binding domain, von Willebrand factor type C module,
thrombospondin domain and C-terminal cystine knot-like domain. This
gene may be downstream in the WNT1 signaling pathway that is
relevant to malignant transformation. It is expressed at a high
level in fibroblast cells, and overexpressed in colon tumors. The
encoded protein binds to decorin and biglycan, two members of a
family of small leucine-rich proteoglycans present in the
extracellular matrix of connective tissue, and possibly prevents
the inhibitory activity of decorin and biglycan in tumor cell
proliferation. It also attenuates p53-mediated apoptosis in
response to DNA damage through activation of the Akt kinase. It is
83% identical to the mouse protein at the amino acid level.
Multiple alternatively spliced transcript variants have been
identified. [provided by RefSeq, Mar 2011].
Transcript Variant: This variant (1) encodes the full length
protein (isoform 1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK315822.1, AF100779.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025095 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1511 AK293031.1 1-1511
1512-4914 AF192304.6 66135-69537
4915-5194 AI347990.1 1-280 c
FEATURES Location/Qualifiers
source 1..5194
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q24.22"
gene 1..5194
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="WNT1 inducible signaling pathway protein 1"
/db_xref="GeneID:8840"
/db_xref="HGNC:12769"
/db_xref="HPRD:16019"
/db_xref="MIM:603398"
exon 1..175
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="alignment:Splign:1.39.8"
variation 22
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:35244636"
variation 55
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:116716037"
STS 57..1260
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/db_xref="UniSTS:481399"
variation 58
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:113859079"
variation 60
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:201515187"
variation 76
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:370168550"
variation 77
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:373840690"
STS 78..1231
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/db_xref="UniSTS:482064"
misc_feature 95..97
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="upstream in-frame stop codon"
CDS 107..1210
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="isoform 1 precursor is encoded by transcript
variant 1; Wnt-1 inducible signaling pathway protein 1;
WNT1 induced secreted protein 1; CCN family member 4"
/codon_start=1
/product="WNT1-inducible-signaling pathway protein 1
isoform 1 precursor"
/protein_id="NP_003873.1"
/db_xref="GI:4507921"
/db_xref="CCDS:CCDS6371.1"
/db_xref="GeneID:8840"
/db_xref="HGNC:12769"
/db_xref="HPRD:16019"
/db_xref="MIM:603398"
/translation="
MRWFLPWTLAAVTAAAASTVLATALSPAPTTMDFTPAPLEDTSSRPQFCKWPCECPPSPPRCPLGVSLITDGCECCKMCAQQLGDNCTEAAICDPHRGLYCDYSGDRPRYAIGVCAQVVGVGCVLDGVRYNNGQSFQPNCKYNCTCIDGAVGCTPLCLRVRPPRLWCPHPRRVSIPGHCCEQWVCEDDAKRPRKTAPRDTGAFDAVGEVEAWHRNCIAYTSPWSPCSTSCGLGVSTRISNVNAQCWPEQESRLCNLRPCDVDIHTLIKAGKKCLAVYQPEASMNFTLAGCISTRSYQPKYCGVCMDNRCCIPYKSKTIDVSFQCPDGLGFSRQVLWINACFCNLSCRNPNDIFADLESYPDFSEIAN
"
sig_peptide 107..172
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 173..1207
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/product="WNT1-inducible-signaling pathway protein 1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95388.1)"
misc_feature <299..409
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="Insulin-like growth factor binding protein; Region:
IGFBP; pfam00219"
/db_xref="CDD:201091"
misc_feature 479..652
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="von Willebrand factor type C domain; Region: VWC;
cl02515"
/db_xref="CDD:199384"
misc_feature 764..883
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/note="Thrombospondin type 1 domain; Region: TSP_1;
cl15278"
/db_xref="CDD:199489"
variation 128
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:145302227"
variation 130
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:147864416"
variation 134
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:141541463"
variation 135
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:147047617"
variation 140
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:145240649"
variation 144
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:149172980"
variation 155
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:375956639"
variation 174
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:370536589"
variation 175
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:374241755"
exon 176..455
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="alignment:Splign:1.39.8"
variation 190
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:201677592"
variation 195
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:148354420"
variation 200
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:371604351"
variation 229
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:73711808"
variation 247
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:200725711"
variation 285
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:145895971"
variation 286
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:138500919"
variation 292
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:61526601"
variation 344
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:150518640"
variation 359
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:202221836"
variation 397
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:73711810"
variation 403
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:114585111"
variation 436
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:367939319"
exon 456..716
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="alignment:Splign:1.39.8"
variation 476
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:201239472"
variation 484
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:202212133"
variation 490
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:199896562"
variation 491
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:199909788"
variation 495
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="t"
/db_xref="dbSNP:376351270"
variation 516
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:144526837"
variation 532
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:186791471"
variation 540
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:139669488"
variation 541
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:193249386"
variation 555
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:201971205"
variation 570
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:111239751"
variation 582
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:147638897"
variation 588
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:140648348"
variation 591
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:202007012"
variation 594
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:376645058"
variation 595
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:368562535"
variation 607
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:142776534"
variation 609
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:372583517"
variation 615
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:139058011"
variation 617
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:140971140"
variation 618
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:377237188"
variation 620
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:201917230"
variation 622
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:150221105"
variation 623
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:146832510"
variation 628
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:77577221"
variation 646
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="t"
/db_xref="dbSNP:201113527"
variation 656
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:72731540"
variation 670
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:145838471"
variation 671
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:73711822"
variation 691
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:202057063"
variation 692
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:143089011"
variation 699
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:34782842"
variation 707
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:200794072"
exon 717..910
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="alignment:Splign:1.39.8"
variation 719
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:35513885"
variation 720
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:369847225"
variation 733
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:141179228"
variation 739
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="t"
/db_xref="dbSNP:377427275"
variation 777
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:373574457"
variation 788
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:199564945"
variation 796
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:150744504"
variation 797
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:139602125"
variation 825
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:199672029"
variation 832
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:201767438"
variation 833
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:200522670"
variation 856
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:200030526"
variation 860
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:370235023"
variation 876
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:201197950"
variation 884
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:202087900"
variation 901
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:113292639"
exon 911..5190
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/inference="alignment:Splign:1.39.8"
variation 954
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:370616029"
variation 961
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:35938742"
variation 969
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:374293123"
variation 970
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:34279368"
variation 999
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:368398252"
variation 1003
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:150347257"
variation 1027
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:3739261"
variation 1042
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:369316693"
variation 1076
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:200845163"
variation 1101
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:371947572"
variation 1111
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:34665171"
variation 1162
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:146812236"
variation 1204
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:140629356"
variation 1212
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:192420341"
variation 1232
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:200836970"
variation 1237
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:374163879"
variation 1355
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:138013484"
variation 1465
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:57390041"
variation 1579
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace=""
/replace="a"
/db_xref="dbSNP:142394577"
variation 1661
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:113549310"
variation 1686
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:184580529"
variation 1803
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:190313906"
variation 1851
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:142461254"
variation 1954
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:2929969"
variation 2180
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:12164193"
variation 2189
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:145960909"
variation 2195
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:73362554"
variation 2264
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="c"
/db_xref="dbSNP:182003497"
variation 2343
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:4265166"
variation 2394
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:2929970"
variation 2463
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:374010309"
variation 2468
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:4577938"
variation 2559
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="t"
/db_xref="dbSNP:377032724"
variation 2673
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:146162433"
variation 2728
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:185849289"
variation 3024
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:188945068"
variation 3033
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:181057409"
variation 3036
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:148796937"
variation 3257
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:117072299"
variation 3290
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:2977549"
variation 3593
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:73362557"
variation 3595
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:76779268"
variation 3629
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:2929971"
variation 3636
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:373530385"
variation 3660
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:142427022"
variation 3712
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:2929972"
variation 3765
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:2929973"
variation 3789
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:151300566"
variation 3937
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:16904856"
variation 3968..3969
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace=""
/replace="c"
/db_xref="dbSNP:36017627"
variation 4024
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:370468302"
variation 4066
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:2977550"
variation 4181
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:9649971"
variation 4183
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:186406622"
variation 4213
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:16904857"
variation 4302
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:191533905"
variation 4336
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:200715437"
variation 4364
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:145461011"
variation 4505
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:16904858"
variation 4613
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:114925013"
variation 4623
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:16904859"
variation 4679
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="t"
/db_xref="dbSNP:73711826"
variation 4681..4682
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace=""
/replace="g"
/db_xref="dbSNP:35647766"
variation 4686
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:16904860"
variation 4699..4702
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace=""
/replace="ctga"
/db_xref="dbSNP:372155216"
variation 4701..4704
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace=""
/replace="gact"
/db_xref="dbSNP:367926394"
variation 4725
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:182511484"
variation 4742
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:186242527"
variation 4788
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="g"
/db_xref="dbSNP:74818902"
variation 4807
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="c"
/replace="t"
/db_xref="dbSNP:2977551"
STS 4872..5038
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/standard_name="RH102883"
/db_xref="UniSTS:97217"
STS 4886..5097
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/standard_name="RH76344"
/db_xref="UniSTS:92556"
variation 4919
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="g"
/replace="t"
/db_xref="dbSNP:147688784"
variation 4931
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:191950359"
variation 5096
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
/replace="a"
/replace="g"
/db_xref="dbSNP:77866098"
polyA_signal 5168..5173
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
polyA_site 5190
/gene="WISP1"
/gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc"
ORIGIN
atatctggtgctcctgatgggccggccagtctgggcccagctcccccgagaggtggtcggatcctctgggctgctcggtcgatgcctgtgccactgacgtccaggcatgaggtggttcctgccctggacgctggcagcagtgacagcagcagccgccagcaccgtcctggccacggccctctctccagcccctacgaccatggactttaccccagctccactggaggacacctcctcacgcccccaattctgcaagtggccatgtgagtgcccgccatccccaccccgctgcccgctgggggtcagcctcatcacagatggctgtgagtgctgtaagatgtgcgctcagcagcttggggacaactgcacggaggctgccatctgtgacccccaccggggcctctactgtgactacagcggggaccgcccgaggtacgcaataggagtgtgtgcacaggtggtcggtgtgggctgcgtcctggatggggtgcgctacaacaacggccagtccttccagcctaactgcaagtacaactgcacgtgcatcgacggcgcggtgggctgcacaccactgtgcctccgagtgcgccccccgcgtctctggtgcccccacccgcggcgcgtgagcatacctggccactgctgtgagcagtgggtatgtgaggacgacgccaagaggccacgcaagaccgcaccccgtgacacaggagccttcgatgctgtgggtgaggtggaggcatggcacaggaactgcatagcctacacaagcccctggagcccttgctccaccagctgcggcctgggggtctccactcggatctccaatgttaacgcccagtgctggcctgagcaagagagccgcctctgcaacttgcggccatgcgatgtggacatccatacactcattaaggcagggaagaagtgtctggctgtgtaccagccagaggcatccatgaacttcacacttgcgggctgcatcagcacacgctcctatcaacccaagtactgtggagtttgcatggacaataggtgctgcatcccctacaagtctaagactatcgacgtgtccttccagtgtcctgatgggcttggcttctcccgccaggtcctatggattaatgcctgcttctgtaacctgagctgtaggaatcccaatgacatctttgctgacttggaatcctaccctgacttctcagaaattgccaactaggcaggcacaaatcttgggtcttggggactaacccaatgcctgtgaagcagtcagcccttatggccaataacttttcaccaatgagccttagttaccctgatctggacccttggcctccatttctgtctctaaccattcaaatgacgcctgatggtgctgctcaggcccatgctatgagttttctccttgatatcattcagcatctactctaaagaaaaatgcctgtctctagctgttctggactacacccaagcctgatccagcctttccaagtcactagaagtcctgctggatcttgcctaaatcccaagaaatggaatcaggtagacttttaatatcactaatttcttctttagatgccaaaccacaagactctttgggtccattcagatgaatagatggaatttggaacaatagaataatctattatttggagcctgccaagaggtactgtaatgggtaattctgacgtcagcgcaccaaaactatcctgattccaaatatgtatgcacctcaaggtcatcaaacatttgccaagtgagttgaatagttgcttaattttgatttttaatggaaagttgtatccattaacctgggcattgttgaggttaagtttctcttcacccctacactgtgaagggtacagattaggtttgtcccagtcagaaataaaatttgataaacattcctgttgatgggaaaagcccccagttaatactccagagacagggaaaggtcagcccgtttcagaaggaccaattgactctcacactgaatcagctgctgactggcagggctttgggcagttggccaggctcttccttgaatcttctcccttgtcctgcttggggttcataggaattggtaaggcctctggactggcctgtctggcccctgagagtggtgccctggaacactcctctactcttacagagccttgagagacccagctgcagaccatgccagacccactgaaatgaccaagacaggttcaggtaggggtgtgggtcaaaccaagaagtgggtgcccttggtagcagcctggggtgacctctagagctggaggctgtgggactccaggggcccccgtgttcaggacacatctattgcagagactcatttcacagcctttcgttctgctgaccaaatggccagttttctggtaggaagatggaggtttaccggttgtttagaaacagaaatagacttaataaaggtttaaagctgaagaggttgaagctaaaaggaaaaggttgttgttaatgaatatcaggctattatttattgtattaggaaaatataatatttactgttagaattcttttatttagggccttttctgtgccagacattgctctcagtgctttgcatgtattagctcactgaatcttcacgacaatgttgagaagttcccattattatttctgttcttacaaatgtgaaacggaagctcatagaggtgagaaaactcaaccagagtcacccagttggtgactgggaaagttaggattcagatcgaaattggactgtctttataacccatattttccccctgtttttagagcttccaaatgtgtcagaataggaaaacattgcaataaatggcttgattttttaatgtcatttttccctcttatagtctttctagctccttttcaaaagacgagaatatctgattttctgataatttaggtgcttaagcatccaaaatacatgggacacacaaaaatccaggaatcccctgtagcttattccctctttcccatcggaaccagctctcatcacacatttaaaagatgattctgtttacccaatgctgcatattgaatgttgtgtagttattcacagggaattctgtgcagtgtgcagagagattcctaaacgggaaaaggactgggaatacatcctccttactgtgacctccccaaaacctagtccagtgcaaggtatacagtggtgctcattaaatacttgatgaatacaggaagctgtgcatgtgttcctacttttattcgaagctctcttcttccaaagctacatgaaaatagaattttaacagtcaaaattttatattaagtgccttagcaaaagagacatttaatatttcaaagaaatgcatatgtatgtatacatatatttgtgtatgcgtatgcaagaattcttgtataaagagaattcactccatgaatgatctcttctgtaagtcagtgtgaatcatgttagattttctgagagtgaaaacacctgccatctacaaattacaaggctggataacagctcactccatttgaaattcagtggaaacccaagagctaggttcttactgaatttgcatctcaatttgggaaactgaacttagctttcaaagatcataggaagtctggttggagaaactagggattattctggcaatgggtgcaggaaggtggtcagaataacccagtcgccattggttttgagaaacggaactatcttatgcagagcccggagggcaagtctcagacccatgggttgaagccatggagaaggaaatttggatccaatgtaatgaagcgctttctaagtcagaatttccctgcaatggtgtggcctgattcaataaaaattaagaataataaatataatggaaaaaaatctccactgattgagtgtttacttggtgccaagcactatgctaagttgttcattattttatttaattgttacagcaattttgagtatgcatctttcactattttataagtggaaaagagaagtgcccccaaaaagttagagctcaaacagcagcttattctaccagcccctgctcttgcggaggcctctggaaaagacctgaatgacacctattggagaattacatctacaaggggcttcaaacagaccaaatagatcatcacctctgtggtcccttgttaactatatgttctgagacaaaggaaagctaccctaagggttagttaacctttgctgaggaaatttacattcatacttagagtgaattactcaggtgtgcttaggtgtgcaaaagggaaggagacctgaattcaccaagttaaatcttgctaaaccttatcataagcattttttgagcgcttagcatacaccaagccttgtggaaggtgctttcctgccatatctcatttaatcctcacagcaaacctatagaatatggcattatcatctgagtctcacagaagtttagtcgtgtactcaaggtcttaccagctagtgaacagcagaccaagactggaaacccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctgtcccccaaatcaaaaggcatgacctttataagaggcgctttactgacaatagctgcaattttaactttgaaaatgattcagaattatcaaagatagtagattcgaatgacatgattgtctataatctcgctagccttgtactgtgtgtgcatagcaattacagggaagtaatctagctcctgactattatgttgaactatgtcgctgctttttacaaacttgtcttgatccaaagcagtcacaatgataaccctgcatatctgggaatcataagtcaactatgtatccctgtgtgtgtatatatatgtatgtatgtatctattttcaaactgtgatttaatatttaaatattcctactgccatttttgtgactgaaaaactacacatgaggaaacgtcttagaattttccaatagaggaaaaataacacttgggcaatctgtcatgtttcacaacagttctcatttttctcatgatttgtgtagcgtggaatgtgtttgctcaatgtgaagggttttcattgctcaatttctctgtgtaagtcttttccttaaggtaataaaccatcagcaaagtcacatactggagttggtggcttttcttgtacaggcagttgttatgagacaatgatggagcattgagcatgttcaataaatgtgcagatggtggaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8840 -> Molecular function: GO:0005520 [insulin-like growth factor binding] evidence: IEA
GeneID:8840 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEA
GeneID:8840 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
GeneID:8840 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:8840 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
GeneID:8840 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA
GeneID:8840 -> Cellular component: GO:0005615 [extracellular space] evidence: NAS
GeneID:8840 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.