Home |
Help |
Advanced search
2024-04-18 19:10:57, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003804 3864 bp mRNA linear PRI 12-MAY-2013
DEFINITION Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase
1 (RIPK1), mRNA.
ACCESSION NM_003804
VERSION NM_003804.3 GI:57242760
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3864)
AUTHORS Hou,X., Wang,L., Zhang,L., Pan,X. and Zhao,W.
TITLE Ubiquitin-specific protease 4 promotes TNF-alpha-induced apoptosis
by deubiquitination of RIP1 in head and neck squamous cell
carcinoma
JOURNAL FEBS Lett. 587 (4), 311-316 (2013)
PUBMED 23313255
REMARK GeneRIF: Data suggest that USP4 (ubiquitin specific peptidase 4)
down-regulates RIP1-mediated TNF-alpha (tumor necrosis
factor-alpha) activation and promotes TNF-alpha-induced apoptosis
via deubiquitination of RIP1 in head/neck squamous cell carcinoma.
REFERENCE 2 (bases 1 to 3864)
AUTHORS Park,Y.H., Jeong,M.S., Park,H.H. and Jang,S.B.
TITLE Formation of the death domain complex between FADD and RIP1
proteins in vitro
JOURNAL Biochim. Biophys. Acta 1834 (1), 292-300 (2013)
PUBMED 22922561
REMARK GeneRIF: Formation of the death domain complex between FADD and
RIP1 proteins in vitro
REFERENCE 3 (bases 1 to 3864)
AUTHORS He,W., Wang,Q., Xu,J., Xu,X., Padilla,M.T., Ren,G., Gou,X. and
Lin,Y.
TITLE Attenuation of TNFSF10/TRAIL-induced apoptosis by an autophagic
survival pathway involving TRAF2- and RIPK1/RIP1-mediated MAPK8/JNK
activation
JOURNAL Autophagy 8 (12), 1811-1821 (2012)
PUBMED 23051914
REMARK GeneRIF: These results reveal a critical role for the MAPK8
activation pathway through TRAF2 and RIPK1 for TNFSF10-induced
autophagy that blunts apoptosis in cancer cells.
REFERENCE 4 (bases 1 to 3864)
AUTHORS Kikuchi,M., Kuroki,S., Kayama,M., Sakaguchi,S., Lee,K.K. and
Yonehara,S.
TITLE Protease activity of procaspase-8 is essential for cell survival by
inhibiting both apoptotic and nonapoptotic cell death dependent on
receptor-interacting protein kinase 1 (RIP1) and RIP3
JOURNAL J. Biol. Chem. 287 (49), 41165-41173 (2012)
PUBMED 23071110
REMARK GeneRIF: procaspase-8 activity is essential for cell survival by
inhibiting both apoptotic and nonapoptotic cell death dependent on
receptor-interacting protein kinase 1 (RIP1) and RIP3
REFERENCE 5 (bases 1 to 3864)
AUTHORS Basit,F., Humphreys,R. and Fulda,S.
TITLE RIP1 protein-dependent assembly of a cytosolic cell death complex
is required for inhibitor of apoptosis (IAP) inhibitor-mediated
sensitization to lexatumumab-induced apoptosis
JOURNAL J. Biol. Chem. 287 (46), 38767-38777 (2012)
PUBMED 22927431
REMARK GeneRIF: IAP inhibitors and lexatumumab synergistically trigger
apoptosis in a RIP1-dependent but TNFalpha-independent manner in
RMS cells
REFERENCE 6 (bases 1 to 3864)
AUTHORS Duan,H. and Dixit,V.M.
TITLE RAIDD is a new 'death' adaptor molecule
JOURNAL Nature 385 (6611), 86-89 (1997)
PUBMED 8985253
REFERENCE 7 (bases 1 to 3864)
AUTHORS Takeuchi,M., Rothe,M. and Goeddel,D.V.
TITLE Anatomy of TRAF2. Distinct domains for nuclear factor-kappaB
activation and association with tumor necrosis factor signaling
proteins
JOURNAL J. Biol. Chem. 271 (33), 19935-19942 (1996)
PUBMED 8702708
REFERENCE 8 (bases 1 to 3864)
AUTHORS Hsu,H., Huang,J., Shu,H.B., Baichwal,V. and Goeddel,D.V.
TITLE TNF-dependent recruitment of the protein kinase RIP to the TNF
receptor-1 signaling complex
JOURNAL Immunity 4 (4), 387-396 (1996)
PUBMED 8612133
REFERENCE 9 (bases 1 to 3864)
AUTHORS Hsu,H., Xiong,J. and Goeddel,D.V.
TITLE The TNF receptor 1-associated protein TRADD signals cell death and
NF-kappa B activation
JOURNAL Cell 81 (4), 495-504 (1995)
PUBMED 7758105
REFERENCE 10 (bases 1 to 3864)
AUTHORS Stanger,B.Z., Leder,P., Lee,T.H., Kim,E. and Seed,B.
TITLE RIP: a novel protein containing a death domain that interacts with
Fas/APO-1 (CD95) in yeast and causes cell death
JOURNAL Cell 81 (4), 513-523 (1995)
PUBMED 7538908
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
U50062.1, BX348786.2 and AL031963.40.
On Jan 7, 2005 this sequence version replaced gi:24475887.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U50062.1, BC126254.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1312 U50062.1 1-1312
1313-1576 BX348786.2 396-659
1577-2058 U50062.1 1577-2058
2059-3864 AL031963.40 75776-77581
FEATURES Location/Qualifiers
source 1..3864
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6p25.2"
gene 1..3864
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="receptor (TNFRSF)-interacting serine-threonine
kinase 1"
/db_xref="GeneID:8737"
/db_xref="HGNC:10019"
/db_xref="MIM:603453"
CDS 1..2016
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/EC_number="2.7.11.1"
/note="receptor interacting protein;
serine/threonine-protein kinase RIP; cell death protein
RIP; RIP-1; receptor-interacting protein 1"
/codon_start=1
/product="receptor-interacting serine/threonine-protein
kinase 1"
/protein_id="NP_003795.2"
/db_xref="GI:57242761"
/db_xref="CCDS:CCDS4482.1"
/db_xref="GeneID:8737"
/db_xref="HGNC:10019"
/db_xref="MIM:603453"
/translation="
MQPDMSLNVIKMKSSDFLESAELDSGGFGKVSLCFHRTQGLMIMKTVYKGPNCIEHNEALLEEAKMMNRLRHSRVVKLLGVIIEEGKYSLVMEYMEKGNLMHVLKAEMSTPLSVKGRIILEIIEGMCYLHGKGVIHKDLKPENILVDNDFHIKIADLGLASFKMWSKLNNEEHNELREVDGTAKKNGGTLYYMAPEHLNDVNAKPTEKSDVYSFAVVLWAIFANKEPYENAICEQQLIMCIKSGNRPDVDDITEYCPREIISLMKLCWEANPEARPTFPGIEEKFRPFYLSQLEESVEEDVKSLKKEYSNENAVVKRMQSLQLDCVAVPSSRSNSATEQPGSLHSSQGLGMGPVEESWFAPSLEHPQEENEPSLQSKLQDEANYHLYGSRMDRQTKQQPRQNVAYNREEERRRRVSHDPFAQQRPYENFQNTEGKGTAYSSAASHGNAVHQPSGLTSQPQVLYQNNGLYSSHGFGTRPLDPGTAGPRVWYRPIPSHMPSLHNIPVPETNYLGNTPTMPFSSLPPTDESIKYTIYNSTGIQIGAYNYMEIGGTSSSLLDSTNTNFKEEPAAKYQAIFDNTTSLTDKHLDPIRENLGKHWKNCARKLGFTQSQIDEIDHDYERDGLKEKVYQMLQKWVMREGIKGATVGKLAQALHQCSRIDLLSSLIYVSQN
"
misc_feature 16..18
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13546.3); phosphorylation site"
misc_feature 64..858
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="Protein Kinases, catalytic domain; Region:
PKc_like; cl09925"
/db_xref="CDD:213116"
misc_feature 64..855
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="Protein kinase; unclassified specificity; Region:
STYKc; smart00221"
/db_xref="CDD:197583"
misc_feature order(67..81,91..93,127..129,133..135,226..228,274..285,
295..297,301..303,412..414,418..420,424..429,433..435,
466..468,475..477,568..573)
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(67..81,91..93,127..129,133..135,226..228,274..285,
295..297,412..414,418..420,424..429,433..435,466..468)
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature 73..75
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13546.3); phosphorylation site"
misc_feature order(79..81,295..297,301..303,412..414,418..420,424..426,
475..477,568..573)
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(463..480,529..531,568..573)
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 868..1746
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13546.3);
Region: Interaction with SQSTM1"
misc_feature 907..909
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13546.3); phosphorylation site"
misc_feature 958..960
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13546.3); phosphorylation site"
misc_feature 970..975
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Cleavage, by caspase-8; propagated from
UniProtKB/Swiss-Prot (Q13546.3); cleavage site"
misc_feature 970..972
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:03459"
misc_feature 997..999
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13546.3); phosphorylation site"
misc_feature 1150..1152
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q13546.3); phosphorylation site"
misc_feature 1150..1152
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1159..1161
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1165..1167
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1510..1650
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="RIP homotypic interaction motif; Region: RHIM;
pfam12721"
/db_xref="CDD:205042"
misc_feature 1591..1641
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13546.3);
Region: RIP homotypic interaction motif (RHIM)"
misc_feature 1747..2004
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/note="Death Domain of Receptor-Interacting Protein 1;
Region: Death_RIP1; cd08777"
/db_xref="CDD:176755"
exon 1..164
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 27
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:371348115"
variation 42
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139862401"
variation 62
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:143270556"
variation 71
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:375750553"
variation 82
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:146652253"
variation 84
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2272990"
variation 127
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:184897325"
variation 135
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:111393904"
variation 155
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149949748"
variation 161
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371940675"
exon 165..321
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 168
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145068560"
variation 189
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377207334"
variation 212
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:201373013"
variation 225
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372658949"
variation 226
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:376914574"
variation 240
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370515307"
variation 261
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:199833061"
variation 267
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:149116173"
variation 270
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:148872518"
variation 306
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143110637"
exon 322..459
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 332
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:181459394"
variation 333
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:55916999"
variation 352
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138832019"
variation 368
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:116603010"
variation 390..391
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="g"
/db_xref="dbSNP:35808929"
variation 396
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:199932915"
exon 460..688
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 463
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368353075"
variation 472
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141642283"
variation 478
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147072629"
variation 498
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138277932"
variation 540
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:150620171"
variation 541
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:115041708"
variation 555
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372342373"
variation 561
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377004988"
variation 562
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:369855897"
variation 564
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:55662281"
variation 582
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372626426"
variation 606
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138924769"
variation 607
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:149432620"
variation 632
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373377506"
variation 636
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144786197"
variation 646
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:184905276"
variation 654
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:200270764"
variation 658
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374972263"
variation 660
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:114794680"
exon 689..838
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 700
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17548383"
variation 709
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17548390"
variation 717
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139225203"
variation 720
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142492551"
variation 726
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150933841"
variation 798
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:139597659"
variation 816
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:114145894"
variation 833
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:369039534"
exon 839..915
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 839
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371950280"
variation 876
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201489236"
variation 888
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:113602774"
variation 900
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369238450"
exon 916..1006
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 931
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:184895368"
variation 942
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143730914"
variation 994
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370418004"
exon 1007..1576
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 1021
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200610530"
variation 1029
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141368248"
variation 1032
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367796517"
variation 1048
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371760083"
variation 1083
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:114175266"
variation 1106
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201908938"
variation 1111
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201010882"
variation 1145
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:374826907"
variation 1184
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:368085162"
variation 1194
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:34457341"
variation 1210
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:34872409"
variation 1238
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377098078"
variation 1255
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369548921"
variation 1270
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201429839"
variation 1278
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374657927"
variation 1288..1289
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="t"
/db_xref="dbSNP:72055493"
variation 1313
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3173519"
variation 1328
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35722193"
variation 1335
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:116696494"
variation 1354
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="c"
/db_xref="dbSNP:35955783"
variation 1406
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377213073"
variation 1414
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:78148286"
variation 1456
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202192603"
variation 1473
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:373127246"
variation 1501
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376022094"
variation 1528
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:114570616"
variation 1536
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:182050801"
variation 1541
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372833650"
exon 1577..1729
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 1585
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374613351"
variation 1602
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115907591"
variation 1609
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200093245"
variation 1640
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115193568"
variation 1656
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143215134"
variation 1671
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374356537"
variation 1685
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367576973"
variation 1691
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:372244053"
variation 1701
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:375261444"
variation 1702
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:148311977"
variation 1706
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:55861377"
variation 1707
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:55782213"
variation 1723
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200611747"
exon 1730..3864
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/inference="alignment:Splign:1.39.8"
variation 1782
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138400267"
variation 1818
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142928574"
variation 1824
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146128109"
variation 1826
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368981092"
variation 1835
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372917428"
variation 1872
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:116517470"
variation 1899
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139157077"
variation 1922
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375933886"
variation 1934
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:116040763"
variation 1935
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:114183703"
variation 1937
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:12194205"
variation 1955
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115355023"
variation 2001
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373199261"
variation 2031
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376644463"
variation 2047
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200498941"
variation 2058
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:200023655"
variation 2114
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:112918512"
variation 2122
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:17548601"
variation 2139
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:111679651"
variation 2240
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149708752"
variation 2306
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:186901867"
variation 2323
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:77736895"
variation 2360
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:145642382"
STS 2409..2566
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/standard_name="RH48319"
/db_xref="UniSTS:8024"
variation 2428
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371307110"
variation 2521
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199526711"
variation 2528
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="c"
/db_xref="dbSNP:71761106"
variation 2553
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:12478"
variation 2600
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115391592"
variation 2613
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:17548608"
variation 2614
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17548615"
variation 2631
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148895227"
variation 2638
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143591575"
variation 2639
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:116057912"
variation 2647
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:137942850"
variation 2711
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:116380813"
variation 2778
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="t"
/db_xref="dbSNP:141950968"
variation 2843
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17548622"
variation 2900
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17548629"
variation 2912
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:190644882"
variation 2933
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138696101"
variation 2955
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:17513574"
variation 3084
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17513581"
variation 3163..3164
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="tc"
/db_xref="dbSNP:138407817"
variation 3284
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:112560918"
variation 3347
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:116237824"
variation 3390
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17548315"
variation 3392
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138261259"
variation 3403
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1983606"
variation 3412..3413
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="tc"
/db_xref="dbSNP:143385010"
variation 3413..3414
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="ct"
/db_xref="dbSNP:374356710"
variation 3435
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:9503401"
variation 3501
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:114155161"
variation 3508
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:182321202"
variation 3511
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:114809298"
variation 3670
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="a"
/db_xref="dbSNP:377557256"
variation 3689
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:185640889"
STS 3721..3824
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/standard_name="D6S1199E"
/db_xref="UniSTS:34000"
variation 3724
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:17513595"
polyA_signal 3745..3750
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
variation 3745
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:188409221"
polyA_site 3763
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
variation 3796..3797
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
/replace=""
/replace="ct"
/db_xref="dbSNP:113615537"
polyA_signal 3845..3850
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
polyA_site 3864
/gene="RIPK1"
/gene_synonym="RIP; RIP1"
ORIGIN
atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggctttgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgaggccctcttggaggaggcgaagatgatgaacagactgagacacagccgggtggtgaagctcctgggcgtcatcatagaggaagggaagtactccctggtgatggagtacatggagaagggcaacctgatgcacgtgctgaaagccgagatgagtactccgctttctgtaaaaggaaggataattttggaaatcattgaaggaatgtgctacttacatggaaaaggcgtgatacacaaggacctgaagcctgaaaatatccttgttgataatgacttccacattaagatcgcagacctcggccttgcctcctttaagatgtggagcaaactgaataatgaagagcacaatgagctgagggaagtggacggcaccgctaagaagaatggcggcaccctctactacatggcgcccgagcacctgaatgacgtcaacgcaaagcccacagagaagtcggatgtgtacagctttgctgtagtactctgggcgatatttgcaaataaggagccatatgaaaatgctatctgtgagcagcagttgataatgtgcataaaatctgggaacaggccagatgtggatgacatcactgagtactgcccaagagaaattatcagtctcatgaagctctgctgggaagcgaatccggaagctcggccgacatttcctggcattgaagaaaaatttaggcctttttatttaagtcaattagaagaaagtgtagaagaggacgtgaagagtttaaagaaagagtattcaaacgaaaatgcagttgtgaagagaatgcagtctcttcaacttgattgtgtggcagtaccttcaagccggtcaaattcagccacagaacagcctggttcactgcacagttcccagggacttgggatgggtcctgtggaggagtcctggtttgctccttccctggagcacccacaagaagagaatgagcccagcctgcagagtaaactccaagacgaagccaactaccatctttatggcagccgcatggacaggcagacgaaacagcagcccagacagaatgtggcttacaacagagaggaggaaaggagacgcagggtctcccatgacccttttgcacagcaaagaccttacgagaattttcagaatacagagggaaaaggcactgcttattccagtgcagccagtcatggtaatgcagtgcaccagccctcagggctcaccagccaacctcaagtactgtatcagaacaatggattatatagctcacatggctttggaacaagaccactggatccaggaacagcaggtcccagagtttggtacaggccaattccaagtcatatgcctagtctgcataatatcccagtgcctgagaccaactatctaggaaatacacccaccatgccattcagctccttgccaccaacagatgaatctataaaatataccatatacaatagtactggcattcagattggagcctacaattatatggagattggtgggacgagttcatcactactagacagcacaaatacgaacttcaaagaagagccagctgctaagtaccaagctatctttgataataccactagtctgacggataaacacctggacccaatcagggaaaatctgggaaagcactggaaaaactgtgcccgtaaactgggcttcacacagtctcagattgatgaaattgaccatgactatgagcgagatggactgaaagaaaaggtttaccagatgctccaaaagtgggtgatgagggaaggcataaagggagccacggtggggaagctggcccaggcgctccaccagtgttccaggatcgaccttctgagcagcttgatttacgtcagccagaactaaccctggatgggctacggcagctgaagtggacgcctcacttagtggataaccccagaaagttggctgcctcagagcattcagaattctgtcctcactgataggggttctgtgtctgcagaaattttgtttcctgtacttcatagctggagaatggggaaagaaatctgcagcaaaggggtctcactctgttgccaggctggtctcaaacttctggactcaagtgatcctcccgcctcggccttccaaagtgctgggatatcaggcactgagccactgcgcccagccaacaatccgctctgaggaaagcgtaagcaggaagacctcttaatggcatagcaccaataaaaaaatgactcctagttgtgtttggaaagggagagaagagatgtctgaggaaggtcatgttctttcagcttatggcatttcctagagttttgttgaagcaagaagaaaaactcagagaatataaaatcaacttttaaaattgtgtgctctcttcttcacgtaggctcctgttaaaaacaaagtgcagtcagattctaagccctgttcagagacttcgtggatcacagctgcagctcaccgccacatcacaggatccgttaacgttaatacccaatactctgtcagccactgtaggctctaagaaccacgtgcagtcttcagcccattaaattatcgattattttttaatgaattgaatttatattgagtcttcaaattaactgaatggatttaaaggggtaccaaggaggggggaaacatcagaatttcccaggcagttgttgcaaggaattggtactaaccgtgactacaacaaaaattcttgattgacttttaaagttatttcctggcattctggtaccttcacccagcctgagtgccctggagagggaacaggaaatgctgatctctacccctgggtgagaccagaacctcagggctgatactgttgagtggcttcctcggtttactctgtgtactgtgaaagtattttcatattttttctgtgtgccagagtgaaaaaggacagcttctgagtgtggtaattgtgcctctagcacccagcctttcaaagcccacctgaaacctgggggtggatgaaagaactagaatagaagactgaagctgggtaggccgctcagtgtccactggcattttgctaaaccgacaaggaaggctgtgtgcttagctctccccagagggagggcgagaagggtgtggtgatggtcaatctggctgtcggaacagattctggtgtcttgggctgataacagtgttgttgattctgattgtgaatcccctcaactctagcagacacatacacacccctgaaatggggctgcagagcaggctgtctcagccttgccactgtcggcatctcggcctgggtaattctgttgtggggactgtcctgttccttgtaggatgtttagtagcatccctgcccccacctactagatgccaggggcactgttctccccagccccccgccccagttgtgacaatagtctctaaacattgtcaaatggtccaaggaaaggggaaaattgccccggttgagaagagcactgctgtaaagtaatgagcctcggctctcctgtctgcacctgtccggttactacttggccaccacgcagccttggctcctacagcccaaaagggagaatggagggaggctccaggctttgctggaggggcctgggtgagttctgtttgctccttgtaccaccatccaaatggtgttatcaaatctcttagattccaaagaggttgaataattaatgttcaaaggcaagagggcaaggcattttttaacactttttaaaataaaaatttataccacaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8737 -> Molecular function: GO:0004672 [protein kinase activity] evidence: IDA
GeneID:8737 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:8737 -> Molecular function: GO:0005123 [death receptor binding] evidence: IPI
GeneID:8737 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:8737 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:8737 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
GeneID:8737 -> Molecular function: GO:0070513 [death domain binding] evidence: IPI
GeneID:8737 -> Biological process: GO:0001934 [positive regulation of protein phosphorylation] evidence: IMP
GeneID:8737 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:8737 -> Biological process: GO:0006919 [activation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: TAS
GeneID:8737 -> Biological process: GO:0007257 [activation of JUN kinase activity] evidence: TAS
GeneID:8737 -> Biological process: GO:0010940 [positive regulation of necrotic cell death] evidence: IMP
GeneID:8737 -> Biological process: GO:0032481 [positive regulation of type I interferon production] evidence: TAS
GeneID:8737 -> Biological process: GO:0032757 [positive regulation of interleukin-8 production] evidence: IDA
GeneID:8737 -> Biological process: GO:0032760 [positive regulation of tumor necrosis factor production] evidence: IDA
GeneID:8737 -> Biological process: GO:0033209 [tumor necrosis factor-mediated signaling pathway] evidence: IC
GeneID:8737 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0034612 [response to tumor necrosis factor] evidence: IMP
GeneID:8737 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0036289 [peptidyl-serine autophosphorylation] evidence: IDA
GeneID:8737 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:8737 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IMP
GeneID:8737 -> Biological process: GO:0043068 [positive regulation of programmed cell death] evidence: IMP
GeneID:8737 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IDA
GeneID:8737 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IEP
GeneID:8737 -> Biological process: GO:0043124 [negative regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP
GeneID:8737 -> Biological process: GO:0044257 [cellular protein catabolic process] evidence: IDA
GeneID:8737 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:8737 -> Biological process: GO:0045651 [positive regulation of macrophage differentiation] evidence: IMP
GeneID:8737 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:8737 -> Biological process: GO:0046330 [positive regulation of JNK cascade] evidence: IDA
GeneID:8737 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:8737 -> Biological process: GO:0051092 [positive regulation of NF-kappaB transcription factor activity] evidence: IMP
GeneID:8737 -> Biological process: GO:0051260 [protein homooligomerization] evidence: IDA
GeneID:8737 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA
GeneID:8737 -> Biological process: GO:0060545 [positive regulation of necroptosis] evidence: IMP
GeneID:8737 -> Biological process: GO:0060555 [activation of necroptosis by extracellular signals] evidence: IMP
GeneID:8737 -> Biological process: GO:0070926 [regulation of ATP:ADP antiporter activity] evidence: IMP
GeneID:8737 -> Biological process: GO:0071356 [cellular response to tumor necrosis factor] evidence: IDA
GeneID:8737 -> Biological process: GO:0097190 [apoptotic signaling pathway] evidence: TAS
GeneID:8737 -> Biological process: GO:0097191 [extrinsic apoptotic signaling pathway] evidence: IDA
GeneID:8737 -> Biological process: GO:0097191 [extrinsic apoptotic signaling pathway] evidence: IMP
GeneID:8737 -> Biological process: GO:2000379 [positive regulation of reactive oxygen species metabolic process] evidence: TAS
GeneID:8737 -> Biological process: GO:2001237 [negative regulation of extrinsic apoptotic signaling pathway] evidence: IMP
GeneID:8737 -> Biological process: GO:2001238 [positive regulation of extrinsic apoptotic signaling pathway] evidence: IMP
GeneID:8737 -> Biological process: GO:2001239 [regulation of extrinsic apoptotic signaling pathway in absence of ligand] evidence: TAS
GeneID:8737 -> Biological process: GO:2001243 [negative regulation of intrinsic apoptotic signaling pathway] evidence: IEA
GeneID:8737 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:8737 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
GeneID:8737 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:8737 -> Cellular component: GO:0031264 [death-inducing signaling complex] evidence: IDA
GeneID:8737 -> Cellular component: GO:0043235 [receptor complex] evidence: IDA
GeneID:8737 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_003795 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.