GGRNA Home | Help | Advanced search

2024-03-28 17:39:43, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003585               2026 bp    mRNA    linear   PRI 20-JUN-2013
DEFINITION  Homo sapiens double C2-like domains, beta (DOC2B), mRNA.
ACCESSION   NM_003585
VERSION     NM_003585.4  GI:513788267
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2026)
  AUTHORS   Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R.
  TITLE     Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
            release
  JOURNAL   Cell 147 (3), 666-677 (2011)
   PUBMED   22036572
  REMARK    GeneRIF: Study analyzed Doc2alpha and Doc2beta and found that Doc2
            responds to changes in [Ca2+], with markedly slower kinetics as
            compared to the cytosolic domain of syt I (syt), and operates on a
            timescale consistent with asynchronous neurotransmitter release.
REFERENCE   2  (bases 1 to 2026)
  AUTHORS   Troyer,J.L., Nelson,G.W., Lautenberger,J.A., Chinn,L., McIntosh,C.,
            Johnson,R.C., Sezgin,E., Kessing,B., Malasky,M., Hendrickson,S.L.,
            Li,G., Pontius,J., Tang,M., An,P., Winkler,C.A., Limou,S., Le
            Clerc,S., Delaneau,O., Zagury,J.F., Schuitemaker,H., van Manen,D.,
            Bream,J.H., Gomperts,E.D., Buchbinder,S., Goedert,J.J., Kirk,G.D.
            and O'Brien,S.J.
  TITLE     Genome-wide association study implicates PARD3B-based AIDS
            restriction
  JOURNAL   J. Infect. Dis. 203 (10), 1491-1502 (2011)
   PUBMED   21502085
REFERENCE   3  (bases 1 to 2026)
  AUTHORS   Cardoso,C., Leventer,R.J., Ward,H.L., Toyo-Oka,K., Chung,J.,
            Gross,A., Martin,C.L., Allanson,J., Pilz,D.T., Olney,A.H.,
            Mutchinick,O.M., Hirotsune,S., Wynshaw-Boris,A., Dobyns,W.B. and
            Ledbetter,D.H.
  TITLE     Refinement of a 400-kb critical region allows genotypic
            differentiation between isolated lissencephaly, Miller-Dieker
            syndrome, and other phenotypes secondary to deletions of 17p13.3
  JOURNAL   Am. J. Hum. Genet. 72 (4), 918-930 (2003)
   PUBMED   12621583
REFERENCE   4  (bases 1 to 2026)
  AUTHORS   Duncan,R.R., Betz,A., Shipston,M.J., Brose,N. and Chow,R.H.
  TITLE     Transient, phorbol ester-induced DOC2-Munc13 interactions in vivo
  JOURNAL   J. Biol. Chem. 274 (39), 27347-27350 (1999)
   PUBMED   10488064
  REMARK    Erratum:[J Biol Chem 2000 Jan 21;275(3):2246]
REFERENCE   5  (bases 1 to 2026)
  AUTHORS   Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M.,
            Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y.
  TITLE     Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
            dynein. Implication in dynein-dependent vesicle transport
  JOURNAL   J. Biol. Chem. 273 (46), 30065-30068 (1998)
   PUBMED   9804756
REFERENCE   6  (bases 1 to 2026)
  AUTHORS   Orita,S., Naito,A., Sakaguchi,G., Maeda,M., Igarashi,H., Sasaki,T.
            and Takai,Y.
  TITLE     Physical and functional interactions of Doc2 and Munc13 in
            Ca2+-dependent exocytotic machinery
  JOURNAL   J. Biol. Chem. 272 (26), 16081-16084 (1997)
   PUBMED   9195900
REFERENCE   7  (bases 1 to 2026)
  AUTHORS   Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and
            Sudhof,T.C.
  TITLE     DOC2 proteins in rat brain: complementary distribution and proposed
            function as vesicular adapter proteins in early stages of secretion
  JOURNAL   Neuron 18 (3), 453-461 (1997)
   PUBMED   9115738
REFERENCE   8  (bases 1 to 2026)
  AUTHORS   Kojima,T., Fukuda,M., Aruga,J. and Mikoshiba,K.
  TITLE     Calcium-dependent phospholipid binding to the C2A domain of a
            ubiquitous form of double C2 protein (Doc2 beta)
  JOURNAL   J. Biochem. 120 (3), 671-676 (1996)
   PUBMED   8902635
REFERENCE   9  (bases 1 to 2026)
  AUTHORS   Sakaguchi,G., Orita,S., Maeda,M., Igarashi,H. and Takai,Y.
  TITLE     Molecular cloning of an isoform of Doc2 having two C2-like domains
  JOURNAL   Biochem. Biophys. Res. Commun. 217 (3), 1053-1061 (1995)
   PUBMED   8554557
REFERENCE   10 (bases 1 to 2026)
  AUTHORS   Orita,S., Sasaki,T., Naito,A., Komuro,R., Ohtsuka,T., Maeda,M.,
            Suzuki,H., Igarashi,H. and Takai,Y.
  TITLE     Doc2: a novel brain protein having two repeated C2-like domains
  JOURNAL   Biochem. Biophys. Res. Commun. 206 (2), 439-448 (1995)
   PUBMED   7826360
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from D70830.1 and AI478508.1.
            On Jun 20, 2013 this sequence version replaced gi:295054131.
            
            Summary: There are at least two protein isoforms of the Double C2
            protein,  namely alpha (DOC2A) and beta (DOC2B), which contain two
            C2-like domains.  DOC2A and DOC2B are encoded by different genes;
            these genes are at times confused with the unrelated DAB2 gene
            which was initially named DOC-2. DOC2B is expressed ubiquitously
            and is suggested to be involved in Ca(2+)-dependent intracellular
            vesicle trafficking in various types of cells. [provided by RefSeq,
            Jul 2008].
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-890               D70830.1           10-899
            891-896             AI478508.1         409-414
            897-1702            D70830.1           906-1711
            1703-2023           D70830.1           1713-2033
            2024-2026           D70830.1           2037-2039
FEATURES             Location/Qualifiers
     source          1..2026
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p13.3"
     gene            1..2026
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="double C2-like domains, beta"
                     /db_xref="GeneID:8447"
                     /db_xref="HGNC:2986"
                     /db_xref="MIM:604568"
     exon            1..524
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    86..88
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="upstream in-frame stop codon"
     STS             102..1440
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /db_xref="UniSTS:481194"
     CDS             152..1390
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="doc2-beta"
                     /codon_start=1
                     /product="double C2-like domain-containing protein beta"
                     /protein_id="NP_003576.2"
                     /db_xref="GI:295054132"
                     /db_xref="GeneID:8447"
                     /db_xref="HGNC:2986"
                     /db_xref="MIM:604568"
                     /translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPDAGPRAAAPPDAPARPAVAGAGRRSPSDGAREDDEDVDQLFGAYGSSPGPSPGPSPARPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTITKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPTWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKTEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLRPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKSLEVTVWDYDIGKSNDFIGGVVLGIHAKGERLKHWFDCLKNKDKRIERWHTLTSELPGAVLSD
"
     misc_feature    152..421
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
                     Region: Mediates interaction with DYNLT1"
     misc_feature    152..259
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
                     Region: Negatively regulates targeting to plasma membrane
                     (By similarity)"
     misc_feature    530..901
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(620..622,638..640,803..805,809..811,827..829)
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    920..1276
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
                     Region: Mediates interaction with STXBP3 (By similarity)"
     misc_feature    956..1354
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(1040..1042,1058..1060,1220..1222,1226..1228,
                     1244..1246)
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     exon            525..604
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            605..679
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            680..789
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            790..916
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            917..1074
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            1075..1156
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            1157..1253
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     exon            1254..2026
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /inference="alignment:Splign:1.39.8"
     STS             1401..1649
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /standard_name="RH80768"
                     /db_xref="UniSTS:87013"
     STS             1679..1873
                     /gene="DOC2B"
                     /gene_synonym="DOC2BL"
                     /standard_name="STS-D70830"
                     /db_xref="UniSTS:73663"
ORIGIN      
gcggagcgggcagcggccaagtcagggccgtccgggggcgcggccggcgatgcccgcagcccccgccgcgccccgccgggcctgctgagccgcccccgggccggggtcgcgccgggccgggccgcgcccggggcggggcggcgctgcctgcatgaccctccggcggcgcggggagaaggcgaccatcagcatccaggagcatatggccatcgacgtgtgccccggccccatccgtcccatcaagcagatctccgactacttcccccgcttcccgcggggcctgcccccggacgccgggccccgagccgctgcacccccggacgcccccgcgcgcccggctgtggccggtgccggccgccgcagcccctccgacggcgcccgcgaggacgacgaggatgtggaccagctcttcggagcctacggctccagcccgggccccagcccgggtcccagccccgcgcggccgccagccaagccgccggaggacgagccggacgccgacggctacgagtcggacgactgcactgccctgggcacgctggacttcagcctgctgtatgaccaggagaacaacgccctccactgcaccatcaccaaggccaagggcctgaagccaatggaccacaatgggctggcagacccctacgtcaagctgcacctgctgccaggagccagtaaggcaaataagctcagaacaaaaactctccgtaacactctgaaccccacatggaacgagaccctcacttactacgggatcacagatgaagacatgatccgcaagaccctgcggatctctgtgtgtgacgaggacaaattccggcacaatgagttcatcggggagacacgtgtgcccctgaagaagctgaaacccaaccacaccaagaccttcagcatctgcctggagaagcagctgccggtggacaagactgaagacaagtccctggaggagcggggccgcatcctcatctccctcaagtacagctcacagaagcaaggcctgctggtaggcatcgtgcggtgcgcccacctggccgccatggacgccaacggctactcggacccctacgtgaaaacatacctgaggccagatgtggacaagaaatccaaacataagacagcggtgaagaaaaaaaccctgaacccggagtttaatgaggagttctgttacgagatcaagcatggggacctggccaagaagtccctggaggtcaccgtttgggattacgacattggaaaatccaacgatttcattggtggtgtggttctgggcatccacgccaagggggagcgcctgaagcactggtttgactgcctgaagaacaaggacaagcgcatcgagcgctggcacacgctcaccagcgagctcccaggggctgtgctcagcgactgacgcccacccgccactgctacccctgccgccacctgcgcccagcacggccggccccgggcttccccagcagccaccaaggcctgtggcccccacactgggggagatccagaacccctgcttggacacagagccactgcagtccccgctcggaggatgtggagggctcagccactctgggacggggagggcaaggagctggggtggggggctctcagctctctggggcccaagaggccggtggtggaaagagacctcagcacctgcccaggggaaggggacacgcccatctgggagcaaagacccttctagaggccagccccggctgagaggacaggagtgtgggggcgccttggcggacagtgggaacagaggagggaggtggtgagcagacagacaggtggaggatgggaccttgaagactggctgctccagcccaagaaagcctaactgcatccctcatctccttcgctgctggacagatggaagaagcgggcctgccggccgaaagtctgccagagttcccggaggctcctgatgatgggtaaattggcacatgcttcactcaatgattccacaagccctgggggtgaatgagacacagggcctgccctcagggagttcccatctagtcaggaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:8447 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA
            GeneID:8447 -> Molecular function: GO:0005544 [calcium-dependent phospholipid binding] evidence: ISS
            GeneID:8447 -> Molecular function: GO:0019905 [syntaxin binding] evidence: IEA
            GeneID:8447 -> Biological process: GO:0008104 [protein localization] evidence: ISS
            GeneID:8447 -> Biological process: GO:0031340 [positive regulation of vesicle fusion] evidence: ISS
            GeneID:8447 -> Biological process: GO:0032024 [positive regulation of insulin secretion] evidence: ISS
            GeneID:8447 -> Biological process: GO:0045956 [positive regulation of calcium ion-dependent exocytosis] evidence: ISS
            GeneID:8447 -> Biological process: GO:0048791 [calcium ion-dependent exocytosis of neurotransmitter] evidence: ISS
            GeneID:8447 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
            GeneID:8447 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
            GeneID:8447 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA
            GeneID:8447 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA
            GeneID:8447 -> Cellular component: GO:0031201 [SNARE complex] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.