GGRNA Home | Help | Advanced search

2019-03-25 14:29:26, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003486               4543 bp    mRNA    linear   PRI 09-JUN-2013
DEFINITION  Homo sapiens solute carrier family 7 (amino acid transporter light
            chain, L system), member 5 (SLC7A5), mRNA.
ACCESSION   NM_003486 NM_015923
VERSION     NM_003486.5  GI:71979931
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4543)
  AUTHORS   Elorza,A., Soro-Arnaiz,I., Melendez-Rodriguez,F.,
            Rodriguez-Vaello,V., Marsboom,G., de Carcer,G., Acosta-Iborra,B.,
            Albacete-Albacete,L., Ordonez,A., Serrano-Oviedo,L.,
            Gimenez-Bachs,J.M., Vara-Vega,A., Salinas,A., Sanchez-Prieto,R.,
            Martin del Rio,R., Sanchez-Madrid,F., Malumbres,M., Landazuri,M.O.
            and Aragones,J.
  TITLE     HIF2alpha acts as an mTORC1 activator through the amino acid
            carrier SLC7A5
  JOURNAL   Mol. Cell 48 (5), 681-691 (2012)
   PUBMED   23103253
  REMARK    GeneRIF: HIF-2alpha/mTORC1/SLC7A5 pathway mediates proliferation
            and tumor promoting properties of HIF-2alpha.
REFERENCE   2  (bases 1 to 4543)
  AUTHORS   Yanagisawa,N., Ichinoe,M., Mikami,T., Nakada,N., Hana,K.,
            Koizumi,W., Endou,H. and Okayasu,I.
  TITLE     High expression of L-type amino acid transporter 1 (LAT1) predicts
            poor prognosis in pancreatic ductal adenocarcinomas
  JOURNAL   J. Clin. Pathol. 65 (11), 1019-1023 (2012)
   PUBMED   22813728
  REMARK    GeneRIF: LAT1 aberrant overexpression in pancreatic ductal
            adenocarcinomas predicts poor prognosis, independent of Ki-67 LI,
            and offers a potential target for future anticancer therapy with
            its inhibitors.
REFERENCE   3  (bases 1 to 4543)
  AUTHORS   Hayashi,K., Jutabha,P., Endou,H. and Anzai,N.
  TITLE     c-Myc is crucial for the expression of LAT1 in MIA Paca-2 human
            pancreatic cancer cells
  JOURNAL   Oncol. Rep. 28 (3), 862-866 (2012)
   PUBMED   22736142
  REMARK    GeneRIF: The LAT1 promoter has a canonical c-Myc binding sequence
            and overexpression of c-Myc increased LAT1 promoter activity.
REFERENCE   4  (bases 1 to 4543)
  AUTHORS   Yamamoto,S., Kimura,T., Tachiki,T., Anzai,N., Sakurai,T. and
            Ushimaru,M.
  TITLE     The involvement of L-type amino acid transporters in theanine
            transport
  JOURNAL   Biosci. Biotechnol. Biochem. 76 (12), 2230-2235 (2012)
   PUBMED   23221699
  REMARK    GeneRIF: L-theanine is transported mostly via the system L
            transport pathway and its isoforms
REFERENCE   5  (bases 1 to 4543)
  AUTHORS   Kaira,K., Oriuchi,N., Takahashi,T., Nakagawa,K., Ohde,Y.,
            Okumura,T., Murakami,H., Shukuya,T., Kenmotsu,H., Naito,T.,
            Kanai,Y., Endo,M., Kondo,H., Nakajima,T. and Yamamoto,N.
  TITLE     L-type amino acid transporter 1 (LAT1) expression in malignant
            pleural mesothelioma
  JOURNAL   Anticancer Res. 31 (12), 4075-4082 (2011)
   PUBMED   22199264
  REMARK    GeneRIF: analysis of L-type amino acid transporter 1 (LAT1)
            expression in malignant pleural mesothelioma
REFERENCE   6  (bases 1 to 4543)
  AUTHORS   Pfeiffer,R., Rossier,G., Spindler,B., Meier,C., Kuhn,L. and
            Verrey,F.
  TITLE     Amino acid transport of y+L-type by heterodimers of 4F2hc/CD98 and
            members of the glycoprotein-associated amino acid transporter
            family
  JOURNAL   EMBO J. 18 (1), 49-57 (1999)
   PUBMED   9878049
REFERENCE   7  (bases 1 to 4543)
  AUTHORS   Torrents,D., Estevez,R., Pineda,M., Fernandez,E., Lloberas,J.,
            Shi,Y.B., Zorzano,A. and Palacin,M.
  TITLE     Identification and characterization of a membrane protein (y+L
            amino acid transporter-1) that associates with 4F2hc to encode the
            amino acid transport activity y+L. A candidate gene for lysinuric
            protein intolerance
  JOURNAL   J. Biol. Chem. 273 (49), 32437-32445 (1998)
   PUBMED   9829974
REFERENCE   8  (bases 1 to 4543)
  AUTHORS   Mastroberardino,L., Spindler,B., Pfeiffer,R., Skelly,P.J.,
            Loffing,J., Shoemaker,C.B. and Verrey,F.
  TITLE     Amino-acid transport by heterodimers of 4F2hc/CD98 and members of a
            permease family
  JOURNAL   Nature 395 (6699), 288-291 (1998)
   PUBMED   9751058
REFERENCE   9  (bases 1 to 4543)
  AUTHORS   Maglott,D.R., Durkin,A.S., Lane,S.A., Callen,D.F., Feldblyum,T.V.
            and Nierman,W.C.
  TITLE     The gene for membrane protein E16 (D16S469E) maps to human
            chromosome 16q24.3 and is expressed in human brain, thymus, and
            retina
  JOURNAL   Genomics 23 (1), 303-304 (1994)
   PUBMED   7829099
REFERENCE   10 (bases 1 to 4543)
  AUTHORS   Gaugitsch,H.W., Prieschl,E.E., Kalthoff,F., Huber,N.E. and
            Baumruker,T.
  TITLE     A novel transiently expressed, integral membrane protein linked to
            cell activation. Molecular cloning via the rapid degradation signal
            AUUUA
  JOURNAL   J. Biol. Chem. 267 (16), 11267-11273 (1992)
   PUBMED   1597461
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC039692.2, BC042600.1 and AC126696.1.
            On Aug 9, 2005 this sequence version replaced gi:34222350.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC039692.2, BC042600.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-416               BC039692.2         26-441
            417-1826            BC042600.1         411-1820
            1827-4543           AC126696.1         64838-67554         c
FEATURES             Location/Qualifiers
     source          1..4543
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16q24.3"
     gene            1..4543
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /note="solute carrier family 7 (amino acid transporter
                     light chain, L system), member 5"
                     /db_xref="GeneID:8140"
                     /db_xref="HGNC:11063"
                     /db_xref="MIM:600182"
     exon            1..610
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       11
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33968272"
     variation       24
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33996472"
     CDS             73..1596
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /note="solute carrier family 7 (cationic amino acid
                     transporter, y+ system), member 5; 4F2 light chain; CD98
                     light chain; L-type amino acid transporter 1; integral
                     membrane protein E16; large neutral amino acids
                     transporter 1; sodium-independent neutral amino acid
                     transporter LAT1; 4F2 LC; solute carrier family 7 member
                     5; y+ system cationic amino acid transporter"
                     /codon_start=1
                     /product="large neutral amino acids transporter small
                     subunit 1"
                     /protein_id="NP_003477.4"
                     /db_xref="GI:71979932"
                     /db_xref="CCDS:CCDS10964.1"
                     /db_xref="GeneID:8140"
                     /db_xref="HGNC:11063"
                     /db_xref="MIM:600182"
                     /translation="
MAGAGPKRRALAAPAAEEKEEAREKMLAAKSADGSAPAGEGEGVTLQRNITLLNGVAIIVGTIIGSGIFVTPTGVLKEAGSPGLALVVWAACGVFSIVGALCYAELGTTISKSGGDYAYMLEVYGSLPAFLKLWIELLIIRPSSQYIVALVFATYLLKPLFPTCPVPEEAAKLVACLCVLLLTAVNCYSVKAATRVQDAFAAAKLLALALIILLGFVQIGKGDVSNLDPNFSFEGTKLDVGNIVLALYSGLFAYGGWNYLNFVTEEMINPYRNLPLAIIISLPIVTLVYVLTNLAYFTTLSTEQMLSSEAVAVDFGNYHLGVMSWIIPVFVGLSCFGSVNGSLFTSSRLFFVGSREGHLPSILSMIHPQLLTPVPSLVFTCVMTLLYAFSKDIFSVINFFSFFNWLCVALAIIGMIWLRHRKPELERPIKVNLALPVFFILACLFLIAVSFWKTPVECGIGFTIILSGLPVYFFGVWWKNKPKWLLQGIFSTTVLCQKLMQVVPQET
"
     misc_feature    163..165
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q01650.2); phosphorylation site"
     misc_feature    175..177
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    190..1590
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /note="L-type amino acid transporter; Region: 2A0308;
                     TIGR00911"
                     /db_xref="CDD:162101"
     misc_feature    205..207
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q01650.2); phosphorylation site"
     misc_feature    220..282
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    322..384
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    430..492
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    508..570
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    580..642
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    667..729
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    799..861
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    892..954
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    1027..1089
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    1258..1320
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    1363..1425
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     misc_feature    1444..1506
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01650.2);
                     transmembrane region"
     variation       89
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33983951"
     variation       459
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33913122"
     variation       579
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:33973691"
     variation       603
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1137356"
     exon            611..736
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       669
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33938662"
     exon            737..842
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       762
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1060250"
     exon            843..887
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     exon            888..1011
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       915
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33992288"
     exon            1012..1115
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       1056
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33936442"
     variation       1080
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1060251"
     exon            1116..1212
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       1203
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2230174"
     exon            1213..1362
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     exon            1363..1540
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       1419
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11541881"
     exon            1541..4543
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /inference="alignment:Splign:1.39.8"
     variation       1885
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11117304"
     variation       1905
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1060252"
     variation       2034
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1060253"
     variation       2036
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1060254"
     STS             2078..2422
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /standard_name="SHGC-154007"
                     /db_xref="UniSTS:182982"
     variation       2341
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11541879"
     variation       2480
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:730214"
     variation       2878
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1060257"
     variation       3150
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1060258"
     variation       3455
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11541880"
     variation       3697
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1060266"
     variation       3754
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11541884"
     variation       3823
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11541883"
     variation       3903
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16943300"
     variation       4098
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11117303"
     variation       4192
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1803523"
     STS             4253..4418
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /standard_name="RH69181"
                     /db_xref="UniSTS:1341"
     STS             4329..4481
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /standard_name="RH47455"
                     /db_xref="UniSTS:2977"
     STS             4411..4502
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /standard_name="D16S469E"
                     /db_xref="UniSTS:148427"
     STS             4455..4543
                     /gene="SLC7A5"
                     /gene_synonym="4F2LC; CD98; D16S469E; E16; hLAT1; LAT1;
                     MPE16"
                     /standard_name="2084"
                     /db_xref="UniSTS:62431"
ORIGIN      
cggcgggcggcgcgcacactgctcgctgggccgcggctcccgggtgtcccaggcccggccggtgcgcagagcatggcgggtgcgggcccgaagcggcgcgcgctagcggcgccggcggccgaggagaaggaagaggcgcgggagaagatgctggccgccaagagcgcggacggctcggcgccggcaggcgagggcgagggcgtgaccctgcagcggaacatcacgctgctcaacggcgtggccatcatcgtggggaccattatcggctcgggcatcttcgtgacgcccacgggcgtgctcaaggaggcaggctcgccggggctggcgctggtggtgtgggccgcgtgcggcgtcttctccatcgtgggcgcgctctgctacgcggagctcggcaccaccatctccaaatcgggcggcgactacgcctacatgctggaggtctacggctcgctgcccgccttcctcaagctctggatcgagctgctcatcatccggccttcatcgcagtacatcgtggccctggtcttcgccacctacctgctcaagccgctcttccccacctgcccggtgcccgaggaggcagccaagctcgtggcctgcctctgcgtgctgctgctcacggccgtgaactgctacagcgtgaaggccgccacccgggtccaggatgcctttgccgccgccaagctcctggccctggccctgatcatcctgctgggcttcgtccagatcgggaagggtgatgtgtccaatctagatcccaacttctcatttgaaggcaccaaactggatgtggggaacattgtgctggcattatacagcggcctctttgcctatggaggatggaattacttgaatttcgtcacagaggaaatgatcaacccctacagaaacctgcccctggccatcatcatctccctgcccatcgtgacgctggtgtacgtgctgaccaacctggcctacttcaccaccctgtccaccgagcagatgctgtcgtccgaggccgtggccgtggacttcgggaactatcacctgggcgtcatgtcctggatcatccccgtcttcgtgggcctgtcctgcttcggctccgtcaatgggtccctgttcacatcctccaggctcttcttcgtggggtcccgggaaggccacctgccctccatcctctccatgatccacccacagctcctcacccccgtgccgtccctcgtgttcacgtgtgtgatgacgctgctctacgccttctccaaggacatcttctccgtcatcaacttcttcagcttcttcaactggctctgcgtggccctggccatcatcggcatgatctggctgcgccacagaaagcctgagcttgagcggcccatcaaggtgaacctggccctgcctgtgttcttcatcctggcctgcctcttcctgatcgccgtctccttctggaagacacccgtggagtgtggcatcggcttcaccatcatcctcagcgggctgcccgtctacttcttcggggtctggtggaaaaacaagcccaagtggctcctccagggcatcttctccacgaccgtcctgtgtcagaagctcatgcaggtggtcccccaggagacatagccaggaggccgagtggctgccggaggagcatgcgcagaggccagttaaagtagatcacctcctcgaacccactccggttccccgcaacccacagctcagctgcccatcccagtccctcgccgtccctcccaggtcgggcagtggaggctgctgtgaaaactctggtacgaatctcatccctcaactgagggccagggacccaggtgtgcctgtgctcctgcccaggagcagcttttggtctccttgggccctttttcccttccctcctttgtttacttatatatatattttttttaaacttaaattttgggtcaacttgacaccactaagatgattttttaaggagctgggggaaggcaggagccttcctttctcctgccccaagggcccagaccctgggcaaacagagctactgagacttggaacctcattgctaccacagacttgcactgaagccggacagctgcccagacacatgggcttgtgacattcgtgaaaaccaaccctgtgggcttatgtctctgccttagggtttgcagagtggaaactcagccgtagggtggcactgggagggggtgggggatctgggcaaggtgggtgattcctcccaggaggtgcttgaggccccgatggactcctgaccataatcctagccccgagacaccatcctgagccagggaacagccccagggttggggggtgccggcatctcccctagctcaccaggcctggcctctgggcagtgtggcctcttggctatttctgtgtccagttttggaggctgagttctggttcatgcagacaaagccctgtccttcagtcttctagaaacagagacaagaaaggcagacacaccgcggccaggcacccatgtgggcgcccaccctgggctccacacagcagtgtcccctgccccagaggtcgcagctaccctcagcctccaatgcattggcctctgtaccgcccggcagccccttctggccggtgctgggttcccactcccggcctaggcacctccccgctctccctgtcacgctcatgtcctgtcctggtcctgatgcccgttgtctaggagacagagccaagcactgctcacgtctctgccgcctgcgtttggaggcccctgggctctcacccagtccccacccgcctgcagagagggaactagggcaccccttgtttctgttgttcccgtgaatttttttcgctatgggaggcagccgaggcctggccaatgcggcccactttcctgagctgtcgctgcctccatggcagcagccagggacccccagaacaagaagaccccgcaggatccctcctgagctcggggggctctgccttctcaggccccgggcttcccttctccccagccagaggtggagccaagtggtccagcgtcactccagtgctcagctgtggctggaggagctggcctgtggcacagccctgagtgtcccaagccgggagccaacgaagccggacacggcttcactgaccagcggctgctcaagccgcaagctctcagcaagtgcccagtggagcctgccgcccccgcctgggcaccgggaccccctcaccatccagtgggcccggagaaacctgatgaacagtttggggactcaggaccagatgtccgtctctcttgcttgaggaatgaagacctttattcacccctgccccgttgcttcccgctgcacatggacagacttcacagcgtctgctcataggacctgcatccttcctggggacgaattccactcgtccaagggacagcccacggtctggaggccgaggaccaccagcaggcaggtggactgactgtgttgggcaagacctcttccctctgggcctgttctcttggctgcaaataaggacagcagctggtgccccacctgcctggtgcattgctgtgtgaatccaggaggcagtggacatcgtaggcagccacggccccgggtccaggagaagtgctccctggaggcacgcaccactgcttcccactggggccggcggggcccacgcacgacgtcagcctcttaccttcccgcctcggctaggggtcctcgggatgccgttctgttccaacctcctgctctgggacgtggacatgcctcaaggatacagggagccggcggcctctcgacggcacgcacttgcctgttggctgctgcggctgtgggcgagcatgggggctgccagcgtctgttgtggaaagtagctgctagtgaaatggctggggccgctggggtccgtcttcacactgcgcaggtctcttctgggcgtctgagctggggtgggagctcctccgcagaaggttggtggggggtccagtctgtgatccttggtgctgtgtgccccactccagcctggggaccccacttcagaaggtaggggccgtgtcccgcggtgctgactgaggcctgcttccccctccccctcctgctgtgctggaattccacagggaccagggccaccgcaggggactgtctcagaagacttgatttttccgtccctttttctccacactccactgacaaacgtccccagcggtttccacttgtgggcttcaggtgttttcaagcacaacccaccacaacaagcaagtgcattttcagtcgttgtgcttttttgttttgtgctaacgtcttactaatttaaagatgctgtcggcaccatgtttatttatttccagtggtcatgctcagccttgctgctctgcgtggcgcaggtgccatgcctgctccctgtctgtgtcccagccacgcagggccatccactgtgacgtcggccgaccaggctggacaccctctgccgagtaatgacgtgtgtggctgggaccttctttattctgtgttaatggctaacctgttacactgggctgggttgggtagggtgttctggcttttttgtggggtttttatttttaaagaaacactcaatcatccta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:8140 -> Molecular function: GO:0015171 [amino acid transmembrane transporter activity] evidence: ISS
            GeneID:8140 -> Molecular function: GO:0015175 [neutral amino acid transmembrane transporter activity] evidence: TAS
            GeneID:8140 -> Molecular function: GO:0015179 [L-amino acid transmembrane transporter activity] evidence: IEA
            GeneID:8140 -> Molecular function: GO:0042605 [peptide antigen binding] evidence: ISS
            GeneID:8140 -> Biological process: GO:0006520 [cellular amino acid metabolic process] evidence: TAS
            GeneID:8140 -> Biological process: GO:0006810 [transport] evidence: TAS
            GeneID:8140 -> Biological process: GO:0006811 [ion transport] evidence: TAS
            GeneID:8140 -> Biological process: GO:0006865 [amino acid transport] evidence: TAS
            GeneID:8140 -> Biological process: GO:0007399 [nervous system development] evidence: IEA
            GeneID:8140 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:8140 -> Biological process: GO:0015804 [neutral amino acid transport] evidence: ISS
            GeneID:8140 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:8140 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
            GeneID:8140 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
            GeneID:8140 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
            GeneID:8140 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:8140 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
            GeneID:8140 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.