Home |
Help |
Advanced search
2024-04-20 19:58:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003460 2266 bp mRNA linear PRI 29-APR-2013
DEFINITION Homo sapiens zona pellucida glycoprotein 2 (sperm receptor) (ZP2),
mRNA.
ACCESSION NM_003460
VERSION NM_003460.1 GI:4508044
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2266)
AUTHORS Margalit,M., Paz,G., Yavetz,H., Yogev,L., Amit,A.,
Hevlin-Schwartz,T., Gupta,S.K. and Kleiman,S.E.
TITLE Genetic and physiological study of morphologically abnormal human
zona pellucida
JOURNAL Eur. J. Obstet. Gynecol. Reprod. Biol. 165 (1), 70-76 (2012)
PUBMED 22889493
REMARK GeneRIF: observed sequence variations in exons of ZP2 gene in women
with infertility of unknown origin who exhibit abnormal zona
pellucida; sperm-ovum interactions appear relatively normal in
these patients [CASE REPORTS]
REFERENCE 2 (bases 1 to 2266)
AUTHORS Gook,D.A., Edgar,D.H., Borg,J. and Martic,M.
TITLE Detection of zona pellucida proteins during human folliculogenesis
JOURNAL Hum. Reprod. 23 (2), 394-402 (2008)
PUBMED 18033806
REMARK GeneRIF: ZP proteins were detected in both the oocyte and the
granulosa cells as early as the primordial follicle stage in the
human. The detection of ZP proteins in the quiescent primordial
follicle suggests that these proteins have been present since
oogenesis.
REFERENCE 3 (bases 1 to 2266)
AUTHORS Wu,C., Ma,M.H., Brown,K.R., Geisler,M., Li,L., Tzeng,E., Jia,C.Y.,
Jurisica,I. and Li,S.S.
TITLE Systematic identification of SH3 domain-mediated human
protein-protein interactions by peptide array target screening
JOURNAL Proteomics 7 (11), 1775-1785 (2007)
PUBMED 17474147
REFERENCE 4 (bases 1 to 2266)
AUTHORS Caballero-Campo,P., Chirinos,M., Fan,X.J., Gonzalez-Gonzalez,M.E.,
Galicia-Chavarria,M., Larrea,F. and Gerton,G.L.
TITLE Biological effects of recombinant human zona pellucida proteins on
sperm function
JOURNAL Biol. Reprod. 74 (4), 760-768 (2006)
PUBMED 16407501
REMARK GeneRIF: Exposure of sperm to ZP proteins promoted acrosomal
exocytosis and changed motility patterns.
REFERENCE 5 (bases 1 to 2266)
AUTHORS Furlong,L.I., Harris,J.D. and Vazquez-Levin,M.H.
TITLE Binding of recombinant human proacrosin/acrosin to zona pellucida
(ZP) glycoproteins. I. Studies with recombinant human ZPA, ZPB, and
ZPC
JOURNAL Fertil. Steril. 83 (6), 1780-1790 (2005)
PUBMED 15950651
REMARK GeneRIF: Of all zona pellucida (ZP) proteins, recombinant human ZPA
demonstrates the highest binding activity toward acrosin
REFERENCE 6 (bases 1 to 2266)
AUTHORS Mori,T., Guo,M.W., Sato,E., Baba,T., Takasaki,S. and Mori,E.
TITLE Molecular and immunological approaches to mammalian fertilization
JOURNAL J. Reprod. Immunol. 47 (2), 139-158 (2000)
PUBMED 10924747
REMARK Review article
REFERENCE 7 (bases 1 to 2266)
AUTHORS Rankin,T. and Dean,J.
TITLE The zona pellucida: using molecular genetics to study the mammalian
egg coat
JOURNAL Rev. Reprod. 5 (2), 114-121 (2000)
PUBMED 10864856
REMARK Review article
REFERENCE 8 (bases 1 to 2266)
AUTHORS Tsubamoto,H., Hasegawa,A., Nakata,Y., Naito,S., Yamasaki,N. and
Koyama,K.
TITLE Expression of recombinant human zona pellucida protein 2 and its
binding capacity to spermatozoa
JOURNAL Biol. Reprod. 61 (6), 1649-1654 (1999)
PUBMED 10570015
REFERENCE 9 (bases 1 to 2266)
AUTHORS Loftus,B.J., Kim,U.J., Sneddon,V.P., Kalush,F., Brandon,R.,
Fuhrmann,J., Mason,T., Crosby,M.L., Barnstead,M., Cronin,L.,
Deslattes Mays,A., Cao,Y., Xu,R.X., Kang,H.L., Mitchell,S.,
Eichler,E.E., Harris,P.C., Venter,J.C. and Adams,M.D.
TITLE Genome duplications and other features in 12 Mb of DNA sequence
from human chromosome 16p and 16q
JOURNAL Genomics 60 (3), 295-308 (1999)
PUBMED 10493829
REFERENCE 10 (bases 1 to 2266)
AUTHORS Liang,L.F. and Dean,J.
TITLE Conservation of mammalian secondary sperm receptor genes enables
the promoter of the human gene to function in mouse oocytes
JOURNAL Dev. Biol. 156 (2), 399-408 (1993)
PUBMED 8385033
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from M90366.1.
Summary: The zona pellucida is an extracellular matrix that
surrounds the oocyte and early embryo. It is composed primarily of
three or four glycoproteins with various functions during
fertilization and preimplantation development. The protein encoded
by this gene is a structural component of the zona pellucida and
functions in secondary binding and penetration of acrosome-reacted
spermatozoa. The nascent protein contains a N-terminal signal
peptide sequence, a conserved ZP domain, a consensus furin cleavage
site, and a C-terminal transmembrane domain. It is hypothesized
that furin cleavage results in release of the mature protein from
the plasma membrane for subsequent incorporation into the zona
pellucida matrix. However, the requirement for furin cleavage in
this process remains controversial based on mouse studies.
[provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC096304.3, M90366.1 [ECO:0000332]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..2266
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="16"
/map="16p12"
gene 1..2266
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/note="zona pellucida glycoprotein 2 (sperm receptor)"
/db_xref="GeneID:7783"
/db_xref="HGNC:13188"
/db_xref="HPRD:01689"
/db_xref="MIM:182888"
CDS 1..2238
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/note="zona pellucida protein A; zona pellucida
sperm-binding protein 2; zona pellucida glycoprotein ZP2"
/codon_start=1
/product="zona pellucida sperm-binding protein 2
preproprotein"
/protein_id="NP_003451.1"
/db_xref="GI:4508045"
/db_xref="CCDS:CCDS10596.1"
/db_xref="GeneID:7783"
/db_xref="HGNC:13188"
/db_xref="HPRD:01689"
/db_xref="MIM:182888"
/translation="
MACRQRGGSWSPSGWFNAGWSTYRSISLFFALVTSGNSIDVSQLVNPAFPGTVTCDEREITVEFPSSPGTKKWHASVVDPLGLDMPNCTYILDPEKLTLRATYDNCTRRVHGGHQMTIRVMNNSAALRHGAVMYQFFCPAMQVEETQGLSASTICQKDFMSFSLPRVFSGLADDSKGTKVQMGWSIEVGDGARAKTLTLPEAMKEGFSLLIDNHRMTFHVPFNATGVTHYVQGNSHLYMVSLKLTFISPGQKVIFSSQAICAPDPVTCNATHMTLTIPEFPGKLKSVSFENQNIDVSQLHDNGIDLEATNGMKLHFSKTLLKTKLSEKCLLHQFYLASLKLTFLLRPETVSMVIYPECLCESPVSIVTGELCTQDGFMDVEVYSYQTQPALDLGTLRVGNSSCQPVFEAQSQGLVRFHIPLNGCGTRYKFEDDKVVYENEIHALWTDFPPSKISRDSEFRMTVKCSYSRNDMLLNINVESLTPPVASVKLGPFTLILQSYPDNSYQQPYGENEYPLVRFLRQPIYMEVRVLNRDDPNIKLVLDDCWATSTMDPDSFPQWNVVVDGCAYDLDNYQTTFHPVGSSVTHPDHYQRFDMKAFAFVSEAHVLSSLVYFHCSALICNRLSPDSPLCSVTCPVSSRHRRATGATEAEKMTVSLPGPILLLSDDSSFRGVGSSDLKASGSSGEKSRSETGEEVGSRGAMDTKGHKTAGDVGSKAVAAVAAFAGVVATLGFIYYLYEKRTVSNH
"
sig_peptide 1..114
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
proprotein 115..2235
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/product="zona pellucida sperm-binding protein 2
proprotein"
mat_peptide 115..1926
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/product="zona pellucida sperm-binding protein 2"
misc_feature 514..519
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="non-experimental evidence, no additional
details recorded"
/note="Cleavage (By similarity); propagated from
UniProtKB/Swiss-Prot (Q05996.1); cleavage site"
misc_feature 517..519
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 1114..1911
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/note="Zona pellucida (ZP) domain; Region: ZP; smart00241"
/db_xref="CDD:197598"
misc_feature 2149..2208
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q05996.1);
transmembrane region"
exon 1..62
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(6)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:147698708"
variation complement(8)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:377432051"
STS 11..102
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/standard_name="G67892"
/db_xref="UniSTS:225614"
variation complement(13)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/db_xref="dbSNP:202135737"
variation complement(26)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/db_xref="dbSNP:377677791"
variation complement(53)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:373646750"
exon 63..151
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(66)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:113112059"
variation complement(74)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:188803389"
variation complement(107)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:2075520"
misc_feature 115..2235
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/note="zona pellucida glycoprotein 2 proprotein"
variation complement(140)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="c"
/db_xref="dbSNP:199927753"
exon 152..235
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(165)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:200172756"
variation complement(209)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:370244702"
variation complement(218)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:76073950"
variation complement(221)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:367878569"
variation complement(222)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:145538948"
variation complement(231)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:139990782"
exon 236..330
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(250)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:369985819"
variation complement(258)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:150656642"
variation complement(288)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:141953642"
variation complement(300)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:137922116"
variation complement(313)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:376162002"
exon 331..483
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(397)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:200788515"
variation complement(437)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:202010660"
variation complement(452)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:376224677"
variation complement(460)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:145329860"
variation complement(474)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:190651334"
variation complement(476)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:141680915"
exon 484..528
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(495)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="c"
/db_xref="dbSNP:35162028"
variation complement(496)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:143028903"
variation complement(507)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:376332681"
variation complement(519)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:16971234"
exon 529..693
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(543)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/db_xref="dbSNP:369507532"
variation complement(557)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:375240682"
variation complement(632)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:369378515"
variation complement(652)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:145104390"
variation complement(656)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:150342177"
variation complement(668)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:141308223"
exon 694..790
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(704)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:372866511"
variation complement(712)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:200100492"
variation complement(747)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:2075526"
variation complement(775)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:145441777"
exon 791..972
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(845)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:369091148"
variation complement(921)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:113774442"
variation complement(929)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:200654965"
variation complement(942)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:373386450"
exon 973..1099
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1002)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:368441627"
variation complement(1037)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:202065210"
variation complement(1048)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:375882969"
variation complement(1089)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:140032829"
variation complement(1090)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:151236566"
variation complement(1097)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:142277591"
exon 1100..1287
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1122)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:200645879"
variation complement(1137)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:182866863"
variation complement(1140)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:148788115"
variation complement(1151)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:144403520"
variation complement(1224)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:143091073"
variation complement(1235)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:376331838"
variation complement(1243)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:139683036"
variation complement(1255)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:373653232"
exon 1288..1379
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1306)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:146378217"
variation complement(1317)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:141585544"
variation complement(1337)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:190038226"
variation complement(1338)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:143012218"
variation complement(1341)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:186370257"
variation complement(1342)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:149014575"
exon 1380..1504
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1385)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:374388107"
variation complement(1398)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:150078092"
variation complement(1407)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:368803645"
variation complement(1430)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:201054139"
variation complement(1462)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:141639876"
variation complement(1477)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:147988348"
exon 1505..1694
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1511)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:202104941"
variation complement(1529)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:80015211"
variation complement(1536)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:116035262"
variation complement(1546)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:141482461"
variation complement(1554)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:201385807"
variation complement(1555)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:147824024"
variation complement(1576)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:202174621"
variation complement(1586)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/db_xref="dbSNP:370008514"
variation complement(1588)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:142537047"
variation complement(1592)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:199896192"
variation complement(1593)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="t"
/db_xref="dbSNP:147707945"
variation complement(1641)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:141607027"
variation complement(1658)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:145769990"
variation complement(1680)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:367625701"
variation complement(1687)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:149764747"
exon 1695..1830
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1702)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:373582627"
variation complement(1741)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:140925075"
variation complement(1756)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="c"
/db_xref="dbSNP:149277141"
variation complement(1816)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:369511398"
exon 1831..1927
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(1865)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:369576343"
variation complement(1871)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="c"
/db_xref="dbSNP:144503112"
variation complement(1880)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="c"
/db_xref="dbSNP:376154774"
variation complement(1898)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="g"
/db_xref="dbSNP:371254101"
exon 1928..2011
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(2000)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:139759688"
exon 2012..2095
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(2016)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:376462791"
variation complement(2017)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:200912750"
variation complement(2027)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:199787774"
variation complement(2042)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:369785011"
STS 2060..2190
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/standard_name="RH71391"
/db_xref="UniSTS:56457"
variation complement(2077..2078)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace=""
/replace="g"
/db_xref="dbSNP:139710200"
variation complement(2083)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="g"
/replace="t"
/db_xref="dbSNP:375244239"
variation complement(2093)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:190164659"
exon 2096..2266
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/inference="alignment:Splign:1.39.8"
variation complement(2102)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:148629948"
variation complement(2104)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:199978300"
variation complement(2132)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:143939599"
variation complement(2146)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:34159042"
variation complement(2179)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="a"
/replace="g"
/db_xref="dbSNP:373110346"
variation complement(2183)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:369803855"
variation complement(2211)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:137896779"
variation complement(2228)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:111820849"
polyA_signal 2249..2255
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 2266
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/experiment="experimental evidence, no additional details
recorded"
variation complement(2266)
/gene="ZP2"
/gene_synonym="Zp-2; ZPA"
/replace="c"
/replace="t"
/db_xref="dbSNP:376654783"
ORIGIN
atggcgtgcaggcagagaggaggctcttggagtccctcaggctggttcaatgcaggctggagcacctacaggtcgatttctctcttcttcgcccttgtgacttcagggaactccatagatgtttctcagttggtaaatcctgcctttccaggcactgtcacttgcgatgaaagggaaataacagtggagttcccaagcagtcctggcaccaagaaatggcatgcatctgtggtggatcctcttggtctcgacatgccgaactgcacttacatcctggacccagaaaagctcaccctgagggctacctatgataactgtaccaggagagtgcatggtggacaccagatgaccatcagagtcatgaacaacagtgctgccttaagacacggagctgtcatgtatcagttcttctgtccagctatgcaagtagaagagacccaggggctttcagcatctacaatctgccagaaggatttcatgtctttttccttgccacgggtcttctctggcttggctgacgacagtaaggggaccaaagttcagatgggatggagcattgaggttggtgatggtgcaagagccaaaactctgaccctgccagaggccatgaaggaaggcttcagcctcttgattgacaaccacaggatgaccttccatgtgccattcaatgccactggagtgactcactatgtgcaaggtaacagtcatctctacatggtgtctctgaagcttacatttatatctcctggacagaaggtgatcttctcttcacaagctatttgtgcaccagatcctgtgacctgcaatgccacacacatgactctcaccataccagagtttcctgggaagcttaagtctgtgagctttgaaaaccagaacattgatgtgagccagctgcatgacaatggaattgatctagaagcaacaaatggcatgaaattgcatttcagcaaaactctgctcaaaacgaaattatctgaaaaatgcctactccatcagttctacttagcttcactcaagctgacctttctccttcggccagagacagtatccatggtgatctatcctgagtgtctctgtgagtcacccgtttctatagttacaggggagctgtgcacccaggatgggtttatggacgtcgaggtctacagctaccaaacacaaccagctcttgacctgggtactctgagggtgggaaactcatcctgccagcctgtctttgaggctcagtctcaggggctggtacggttccacatacccctgaatggatgtggaacgagatataagttcgaagatgataaagtcgtctatgaaaacgaaatacatgctctctggacggattttcctccaagcaaaatatctagagacagtgagttcagaatgacagtgaagtgttcttatagcaggaatgacatgctactaaacatcaacgttgaaagccttactcctccagtggcctcagtgaagttgggtccatttaccttgatcctgcaaagctacccagataattcctaccaacaaccttatggggaaaacgagtaccctctagtgagattcctccgccaaccaatttacatggaagtgagagtcctaaacagggatgaccccaacatcaagctggtcttagatgactgctgggcgacgtccaccatggatccagactctttcccccagtggaacgttgtcgtggatggctgtgcatatgacctggacaactaccagaccaccttccatccagtcggctcctctgtgacccatcctgatcactatcagaggtttgacatgaaggcttttgcctttgtatcagaagcccacgtgctctctagcctggtctacttccactgcagtgccttaatctgtaatcgactctcccctgactccccactgtgttctgtgacctgccctgtgtcctctaggcacaggcgagccacaggggccactgaagcagagaaaatgacagtcagcctcccaggacccattctcctgttgtcagatgactcctcattcagaggtgtcggctcatctgatctaaaagcaagtgggagcagtggggagaagagtaggagtgaaacaggggaggaggttggctcacgaggtgctatggacaccaaagggcacaagactgctggagatgttggttccaaagctgtggctgctgtggctgcctttgcaggtgtggtggcaactctaggcttcatctactacctgtacgagaaaaggactgtgtcaaatcactaaatgggcttctaaataaagcagtcaaaat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7783 -> Molecular function: GO:0015026 [coreceptor activity] evidence: TAS
GeneID:7783 -> Molecular function: GO:0032190 [acrosin binding] evidence: IPI
GeneID:7783 -> Biological process: GO:0006828 [manganese ion transport] evidence: ISS
GeneID:7783 -> Biological process: GO:0006886 [intracellular protein transport] evidence: ISS
GeneID:7783 -> Biological process: GO:0007338 [single fertilization] evidence: TAS
GeneID:7783 -> Biological process: GO:0007339 [binding of sperm to zona pellucida] evidence: ISS
GeneID:7783 -> Biological process: GO:0007339 [binding of sperm to zona pellucida] evidence: TAS
GeneID:7783 -> Biological process: GO:0032504 [multicellular organism reproduction] evidence: TAS
GeneID:7783 -> Biological process: GO:0060046 [regulation of acrosome reaction] evidence: IDA
GeneID:7783 -> Biological process: GO:0060468 [prevention of polyspermy] evidence: ISS
GeneID:7783 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:7783 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: IEA
GeneID:7783 -> Cellular component: GO:0005771 [multivesicular body] evidence: ISS
GeneID:7783 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: ISS
GeneID:7783 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: ISS
GeneID:7783 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
GeneID:7783 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:7783 -> Cellular component: GO:0030141 [secretory granule] evidence: ISS
GeneID:7783 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.