Home |
Help |
Advanced search
2024-04-25 09:59:51, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003374 1993 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens voltage-dependent anion channel 1 (VDAC1), transcript
variant 1, mRNA.
ACCESSION NM_003374
VERSION NM_003374.2 GI:307133764
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1993)
AUTHORS Gonzalez-Gronow,M., Ray,R., Wang,F. and Pizzo,S.V.
TITLE The voltage-dependent anion channel (VDAC) binds tissue-type
plasminogen activator and promotes activation of plasminogen on the
cell surface
JOURNAL J. Biol. Chem. 288 (1), 498-509 (2013)
PUBMED 23161549
REMARK GeneRIF: VDAC binds tissue-type plasminogen activator (t-PA) on
human neuroblastoma SK-N-SH cells
REFERENCE 2 (bases 1 to 1993)
AUTHORS Manczak,M. and Reddy,P.H.
TITLE Abnormal interaction of VDAC1 with amyloid beta and phosphorylated
tau causes mitochondrial dysfunction in Alzheimer's disease
JOURNAL Hum. Mol. Genet. 21 (23), 5131-5146 (2012)
PUBMED 22926141
REMARK GeneRIF: Abnormal interaction of VDAC1 with amyloid beta and
phosphorylated tau causes mitochondrial dysfunction in Alzheimer's
disease.
REFERENCE 3 (bases 1 to 1993)
AUTHORS Sun,Y., Vashisht,A.A., Tchieu,J., Wohlschlegel,J.A. and Dreier,L.
TITLE Voltage-dependent anion channels (VDACs) recruit Parkin to
defective mitochondria to promote mitochondrial autophagy
JOURNAL J. Biol. Chem. 287 (48), 40652-40660 (2012)
PUBMED 23060438
REMARK GeneRIF: VDAC 1, 2, and 3 recruit Parkin to defective mitochondria
to promote mitochondrial autophagy.
REFERENCE 4 (bases 1 to 1993)
AUTHORS Zachariae,U., Schneider,R., Briones,R., Gattin,Z., Demers,J.P.,
Giller,K., Maier,E., Zweckstetter,M., Griesinger,C., Becker,S.,
Benz,R., de Groot,B.L. and Lange,A.
TITLE beta-Barrel mobility underlies closure of the voltage-dependent
anion channel
JOURNAL Structure 20 (9), 1540-1549 (2012)
PUBMED 22841291
REMARK GeneRIF: The N-terminal helix of VDAC1 controls entry into elliptic
beta-barrel states which underlie VDAC closure.
REFERENCE 5 (bases 1 to 1993)
AUTHORS Joo,H.K., Lee,Y.R., Lim,S.Y., Lee,E.J., Choi,S., Cho,E.J.,
Park,M.S., Ryoo,S., Park,J.B. and Jeon,B.H.
TITLE Peripheral benzodiazepine receptor regulates vascular endothelial
activations via suppression of the voltage-dependent anion
channel-1
JOURNAL FEBS Lett. 586 (9), 1349-1355 (2012)
PUBMED 22616995
REMARK GeneRIF: PBR can inhibit endothelial activation through inhibition
of mitochondrial ROS and/or VDAC-1 expression in endothelial cells
REFERENCE 6 (bases 1 to 1993)
AUTHORS Blachly-Dyson,E., Baldini,A., Litt,M., McCabe,E.R. and Forte,M.
TITLE Human genes encoding the voltage-dependent anion channel (VDAC) of
the outer mitochondrial membrane: mapping and identification of two
new isoforms
JOURNAL Genomics 20 (1), 62-67 (1994)
PUBMED 7517385
REFERENCE 7 (bases 1 to 1993)
AUTHORS Blachly-Dyson,E., Zambronicz,E.B., Yu,W.H., Adams,V., McCabe,E.R.,
Adelman,J., Colombini,M. and Forte,M.
TITLE Cloning and functional expression in yeast of two human isoforms of
the outer mitochondrial membrane channel, the voltage-dependent
anion channel
JOURNAL J. Biol. Chem. 268 (3), 1835-1841 (1993)
PUBMED 8420959
REFERENCE 8 (bases 1 to 1993)
AUTHORS McEnery,M.W., Snowman,A.M., Trifiletti,R.R. and Snyder,S.H.
TITLE Isolation of the mitochondrial benzodiazepine receptor: association
with the voltage-dependent anion channel and the adenine nucleotide
carrier
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (8), 3170-3174 (1992)
PUBMED 1373486
REFERENCE 9 (bases 1 to 1993)
AUTHORS Jurgens,L., Ilsemann,P., Kratzin,H.D., Hesse,D., Eckart,K.,
Thinnes,F.P. and Hilschmann,N.
TITLE Studies on human porin. IV. The primary structures of 'Porin 31HM'
purified from human skeletal muscle membranes and of 'Porin 31HL'
derived from human B lymphocyte membranes are identical
JOURNAL Biol. Chem. Hoppe-Seyler 372 (7), 455-463 (1991)
PUBMED 1657034
REFERENCE 10 (bases 1 to 1993)
AUTHORS Kayser,H., Kratzin,H.D., Thinnes,F.P., Gotz,H., Schmidt,W.E.,
Eckart,K. and Hilschmann,N.
TITLE [Identification of human porins. II. Characterization and primary
structure of a 31-lDa porin from human B lymphocytes (Porin 31HL)]
JOURNAL Biol. Chem. Hoppe-Seyler 370 (12), 1265-1278 (1989)
PUBMED 2559745
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK095989.1, AC008608.7,
L06132.1 and BC008482.1.
This sequence is a reference standard in the RefSeqGene project.
On Sep 17, 2010 this sequence version replaced gi:4507878.
Summary: This gene encodes a voltage-dependent anion channel
protein that is a major component of the outer mitochondrial
membrane. The encoded protein facilitates the exchange of
metabolites and ions across the outer mitochondrial membrane and
may regulate mitochondrial functions. This protein also forms
channels in the plasma membrane and may be involved in
transmembrane electron transport. Alternate splicing results in
multiple transcript variants. Multiple pseudogenes of this gene are
found on chromosomes 1, 2 3, 6, 9, 12, X and Y.[provided by RefSeq,
Sep 2010].
Transcript Variant: This variant (1) encodes the functional
protein.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK095989.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
gene product(s) localized to mito. :: reported by MitoCarta
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-563 AK095989.1 1-563
564-564 AC008608.7 18741-18741 c
565-725 AK095989.1 565-725
726-726 AC008608.7 8681-8681 c
727-1610 AK095989.1 727-1610
1611-1952 L06132.1 1465-1806
1953-1993 BC008482.1 1738-1778
FEATURES Location/Qualifiers
source 1..1993
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q31"
gene 1..1993
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="voltage-dependent anion channel 1"
/db_xref="GeneID:7416"
/db_xref="HGNC:12669"
/db_xref="HPRD:05137"
/db_xref="MIM:604492"
exon 1..239
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
misc_feature 3..5
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="upstream in-frame stop codon"
exon 240..312
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
CDS 246..1097
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="porin 31HL; porin 31HM; plasmalemmal porin; outer
mitochondrial membrane protein porin 1"
/codon_start=1
/product="voltage-dependent anion-selective channel
protein 1"
/protein_id="NP_003365.1"
/db_xref="GI:4507879"
/db_xref="CCDS:CCDS4168.1"
/db_xref="GeneID:7416"
/db_xref="HGNC:12669"
/db_xref="HPRD:05137"
/db_xref="MIM:604492"
/translation="
MAVPPTYADLGKSARDVFTKGYGFGLIKLDLKTKSENGLEFTSSGSANTETTKVTGSLETKYRWTEYGLTFTEKWNTDNTLGTEITVEDQLARGLKLTFDSSFSPNTGKKNAKIKTGYKREHINLGCDMDFDIAGPSIRGALVLGYEGWLAGYQMNFETAKSRVTQSNFAVGYKTDEFQLHTNVNDGTEFGGSIYQKVNKKLETAVNLAWTAGNSNTRFGIAAKYQIDPDACFSAKVNNSSLIGLGYTQTLKPGIKLTLSALLDGKNVNAGGHKLGLGLEFQA
"
misc_feature 249..251
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylalanine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 255..1091
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="Voltage-dependent anion channel of the outer
mitochondrial membrane; Region: Porin3_VDAC; cd07306"
/db_xref="CDD:132767"
misc_feature order(291..293,303..305,381..383,426..428,495..497,
705..707,1089..1091)
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="putative determinants of voltage gating; other
site"
/db_xref="CDD:132767"
misc_feature 303..305
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 321..350
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature order(324..326,330..332,1014..1016,1020..1022,1074..1076)
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="putative dimerization interface [polypeptide
binding]; other site"
/db_xref="CDD:132767"
misc_feature 327..329
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 360..386
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 405..437
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 426..428
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 444..446
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 450..473
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 462..464
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Involved in hexokinase binding (By similarity);
propagated from UniProtKB/Swiss-Prot (P21796.2); other
site"
misc_feature 483..512
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 528..557
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 546..548
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P21796.2); phosphorylation site"
misc_feature 546..548
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 549..551
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 555..557
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P21796.2); phosphorylation site"
misc_feature 555..557
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 564..566
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 576..605
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 612..635
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 654..680
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 693..719
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 732..770
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 777..800
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 810..839
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 828..830
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 849..878
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 897..926
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 915..917
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 936..959
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 969..998
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 1005..1034
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
misc_feature 1041..1043
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P21796.2); acetylation site"
misc_feature 1062..1091
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P21796.2);
transmembrane region"
STS 250..401
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/standard_name="DXS1261"
/db_xref="UniSTS:99547"
STS 278..1151
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/standard_name="MARC_23885-23886:1031761371:1"
/db_xref="UniSTS:268790"
exon 313..362
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 363..515
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 516..568
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 569..796
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 797..947
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 948..1005
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
exon 1006..1993
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/inference="alignment:Splign:1.39.8"
STS 1181..1376
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/standard_name="VDAC1"
/db_xref="UniSTS:279253"
STS 1466..1720
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/standard_name="RH38718"
/db_xref="UniSTS:87598"
STS 1496..1827
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/standard_name="WI-7287"
/db_xref="UniSTS:75528"
variation 1698
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/replace="g"
/replace="t"
/db_xref="dbSNP:7404"
variation 1796
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056722"
polyA_signal 1934..1939
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
polyA_site 1953
/gene="VDAC1"
/gene_synonym="PORIN; VDAC-1"
/note="The 3'-most polyA site has not been determined.
This is an internal polyA site."
ORIGIN
attagcgcagggacctccgggccacagctcagagaatcggaaggcctcctcccccttcccgagcgctgccactggggccgaggtttccagcaagaacccgcgtgtccctgcgcacgcacacacggtgcacacgtcagtccggcgcctccccgtgccccgactcacgcaggtcctcccgcgcgcccgcaacacgcccgcaggctcctgtgtctgctgccggggcagcggggcccggaaggcagaagatggctgtgccacccacgtatgccgatcttggcaaatctgccagggatgtcttcaccaagggctatggatttggcttaataaagcttgatttgaaaacaaaatctgagaatggattggaatttacaagctcaggctcagccaacactgagaccaccaaagtgacgggcagtctggaaaccaagtacagatggactgagtacggcctgacgtttacagagaaatggaataccgacaatacactaggcaccgagattactgtggaagatcagcttgcacgtggactgaagctgaccttcgattcatccttctcacctaacactgggaaaaaaaatgctaaaatcaagacagggtacaagcgggagcacattaacctgggctgcgacatggatttcgacattgctgggccttccatccggggtgctctggtgctaggttacgagggctggctggccggctaccagatgaattttgagactgcaaaatcccgagtgacccagagcaactttgcagttggctacaagactgatgaattccagcttcacactaatgtgaatgacgggacagagtttggcggctccatttaccagaaagtgaacaagaagttggagaccgctgtcaatcttgcctggacagcaggaaacagtaacacgcgcttcggaatagcagccaagtatcagattgaccctgacgcctgcttctcggctaaagtgaacaactccagcctgataggtttaggatacactcagactctaaagccaggtattaaactgacactgtcagctcttctggatggcaagaacgtcaatgctggtggccacaagcttggtctaggactggaatttcaagcataaatgaatactgtacaattgtttaattttaaactattttgcagcatagctaccttcagaatttagtgtatcttttaatgttgtatgtctgggatgcaagtattgctaaatatgttagccctccaggttaaagttgattcagctttaagatgttacccttccagaggtacagaagaaacctatttccaaaaaaggtcctttcagtggtagactcggggagaacttggtggcccctttgagatgccaggtttcttttttatctagaaatggctgcaagtggaagcggataatatgtaggcactttgtaaattcatattgagtaaatgaatgaaattgtgatttcctgagaatcgaaccttggttccctaaccctaattgatgagaggctcgctgcttgatggtgtgtacaaactcacctgaatgggacttttttagacagatcttcatgacctgttcccaccccagttcatcatcatctcttttacaccaaaaggtctgcagggtgtggtaactgtttcttttgtgccattttggggtggagaaggtggatgtgatgaagccaataattcaggacttattccttcttgtgttgtgtttttttttggcccttgcaccagagtatgaaatagcttccaggagctccagctataagcttggaagtgtctgtgtgattgtaatcacatggtgacaacactcagaatctaaattggacttctgttgtattctcaccactcaatttgttttttagcagtttaatgggtacattttagagtcttccattttgttggaattagatcctccccttcaaatgctgtaattaacaacacttaaaaaacttgaataaaatattgaaacctcatccttcttctgttgtctttattaataaaatataaataaac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7416 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:7416 -> Molecular function: GO:0008308 [voltage-gated anion channel activity] evidence: ISS
GeneID:7416 -> Molecular function: GO:0008308 [voltage-gated anion channel activity] evidence: TAS
GeneID:7416 -> Molecular function: GO:0015288 [porin activity] evidence: IEA
GeneID:7416 -> Biological process: GO:0001662 [behavioral fear response] evidence: IEA
GeneID:7416 -> Biological process: GO:0006820 [anion transport] evidence: TAS
GeneID:7416 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:7416 -> Biological process: GO:0007270 [neuron-neuron synaptic transmission] evidence: IEA
GeneID:7416 -> Biological process: GO:0007612 [learning] evidence: IEA
GeneID:7416 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:7416 -> Cellular component: GO:0005739 [mitochondrion] evidence: TAS
GeneID:7416 -> Cellular component: GO:0005741 [mitochondrial outer membrane] evidence: IEA
GeneID:7416 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: IEA
GeneID:7416 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:7416 -> Cellular component: GO:0016020 [membrane] evidence: ISS
GeneID:7416 -> Cellular component: GO:0042645 [mitochondrial nucleoid] evidence: IDA
GeneID:7416 -> Cellular component: GO:0046930 [pore complex] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.