GGRNA Home | Help | Advanced search

2020-10-26 19:52:39, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003319              82029 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens titin (TTN), transcript variant N2-B, mRNA.
ACCESSION   NM_003319
VERSION     NM_003319.4  GI:291045222
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 82029)
  AUTHORS   LeWinter,M.M. and Granzier,H.L.
  TITLE     Titin is a major human disease gene
  JOURNAL   Circulation 127 (8), 938-944 (2013)
   PUBMED   23439446
  REMARK    GeneRIF: [review] Signal pathways of titin isoforms are described
            in a major human cardiovascular disease.
            Review article
REFERENCE   2  (bases 1 to 82029)
  AUTHORS   Hamdani,N., Krysiak,J., Kreusser,M.M., Neef,S., Dos Remedios,C.G.,
            Maier,L.S., Kruger,M., Backs,J. and Linke,W.A.
  TITLE     Crucial role for Ca2(+)/calmodulin-dependent protein kinase-II in
            regulating diastolic stress of normal and failing hearts via titin
            phosphorylation
  JOURNAL   Circ. Res. 112 (4), 664-674 (2013)
   PUBMED   23283722
  REMARK    GeneRIF: Human end-stage failing hearts revealed higher CaMKII
            expression/activity & phosphorylation at PEVK/titin N2B-unique
            sequence sites than donor hearts. Deranged CaMKII-dependent titin
            phosphorylation contributes to altered diastolic stress.
REFERENCE   3  (bases 1 to 82029)
  AUTHORS   Somkuti,J., Martonfalvi,Z., Kellermayer,M.S. and Smeller,L.
  TITLE     Different pressure-temperature behavior of the structured and
            unstructured regions of titin
  JOURNAL   Biochim. Biophys. Acta 1834 (1), 112-118 (2013)
   PUBMED   23063534
  REMARK    GeneRIF: Different pressure-temperature behavior of the structured
            and unstructured regions of titin.
REFERENCE   4  (bases 1 to 82029)
  AUTHORS   Tskhovrebova,L. and Trinick,J.
  TITLE     Roles of titin in the structure and elasticity of the sarcomere
  JOURNAL   J. Biomed. Biotechnol. 2010, 612482 (2010)
   PUBMED   20625501
  REMARK    GeneRIF: Recent titin data is reviewed and its implications for
            sarcomere architecture and elasticity, are discussed.
            Review article
REFERENCE   5  (bases 1 to 82029)
  AUTHORS   Labeit,S., Lahmers,S., Burkart,C., Fong,C., McNabb,M., Witt,S.,
            Witt,C., Labeit,D. and Granzier,H.
  TITLE     Expression of distinct classes of titin isoforms in striated and
            smooth muscles by alternative splicing, and their conserved
            interaction with filamins
  JOURNAL   J. Mol. Biol. 362 (4), 664-681 (2006)
   PUBMED   16949617
  REMARK    GeneRIF: This suggests that the titin Z2-Zis1 domain can link
            filamins and alpha-actinin together in the periphery of the
            Z-line/dense bodies in a fashion that is conserved in smooth and
            striated muscles.
REFERENCE   6  (bases 1 to 82029)
  AUTHORS   Bang,M.L., Centner,T., Fornoff,F., Geach,A.J., Gotthardt,M.,
            McNabb,M., Witt,C.C., Labeit,D., Gregorio,C.C., Granzier,H. and
            Labeit,S.
  TITLE     The complete gene sequence of titin, expression of an unusual
            approximately 700-kDa titin isoform, and its interaction with
            obscurin identify a novel Z-line to I-band linking system
  JOURNAL   Circ. Res. 89 (11), 1065-1072 (2001)
   PUBMED   11717165
REFERENCE   7  (bases 1 to 82029)
  AUTHORS   Freiburg,A., Trombitas,K., Hell,W., Cazorla,O., Fougerousse,F.,
            Centner,T., Kolmerer,B., Witt,C., Beckmann,J.S., Gregorio,C.C.,
            Granzier,H. and Labeit,S.
  TITLE     Series of exon-skipping events in the elastic spring region of
            titin as the structural basis for myofibrillar elastic diversity
  JOURNAL   Circ. Res. 86 (11), 1114-1121 (2000)
   PUBMED   10850961
REFERENCE   8  (bases 1 to 82029)
  AUTHORS   Labeit,S. and Kolmerer,B.
  TITLE     Titins: giant proteins in charge of muscle ultrastructure and
            elasticity
  JOURNAL   Science 270 (5234), 293-296 (1995)
   PUBMED   7569978
REFERENCE   9  (bases 1 to 82029)
  AUTHORS   Furst,D.O., Vinkemeier,U. and Weber,K.
  TITLE     Mammalian skeletal muscle C-protein: purification from bovine
            muscle, binding to titin and the characterization of a full-length
            human cDNA
  JOURNAL   J. Cell. Sci. 102 (PT 4), 769-778 (1992)
   PUBMED   1429890
REFERENCE   10 (bases 1 to 82029)
  AUTHORS   Labeit,S., Gautel,M., Lakey,A. and Trinick,J.
  TITLE     Towards a molecular understanding of titin
  JOURNAL   EMBO J. 11 (5), 1711-1716 (1992)
   PUBMED   1582406
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023270.7, AC010680.10,
            FJ695199.1 and AC009948.3.
            On Mar 13, 2010 this sequence version replaced gi:110349714.
            
            Summary: This gene encodes a large abundant protein of striated
            muscle. The product of this gene is divided into two regions, a
            N-terminal I-band and a C-terminal A-band. The I-band, which is the
            elastic part of the molecule, contains two regions of tandem
            immunoglobulin domains on either side of a PEVK region that is rich
            in proline, glutamate, valine and lysine. The A-band, which is
            thought to act as a protein-ruler, contains a mixture of
            immunoglobulin and fibronectin repeats, and possesses kinase
            activity. An N-terminal Z-disc region and a C-terminal M-line
            region bind to the Z-line and M-line of the sarcomere,
            respectively, so that a single titin molecule spans half the length
            of a sarcomere. Titin also contains binding sites for muscle
            associated proteins so it serves as an adhesion template for the
            assembly of contractile machinery in muscle cells. It has also been
            identified as a structural protein for chromosomes. Alternative
            splicing of this gene results in multiple transcript variants.
            Considerable variability exists in the I-band, the M-line and the
            Z-disc regions of titin. Variability in the I-band region
            contributes to the differences in elasticity of different titin
            isoforms and, therefore, to the differences in elasticity of
            different muscle types. Mutations in this gene are associated with
            familial hypertrophic cardiomyopathy 9, and autoantibodies to titin
            are produced in patients with the autoimmune disease scleroderma.
            [provided by RefSeq, Feb 2012].
            
            Transcript Variant: This variant (N2-B) encodes the major cardiac
            muscle isoform (N2-B). It lacks multiple exons in the region
            encoding PEVK repeats. This results in a shortened PEVK region in
            isoform N2-B compared to isoform IC. This variant is supported by
            data in PMIDs 10850961 and 11717165.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               AC023270.7         65697-65908         c
            213-316             AC023270.7         63037-63140         c
            317-520             AC023270.7         60623-60826         c
            521-808             AC023270.7         58880-59167         c
            809-894             AC023270.7         58310-58395         c
            895-1139            AC023270.7         57972-58216         c
            1140-1470           AC023270.7         53407-53737         c
            1471-1623           AC023270.7         52884-53036         c
            1624-1761           AC023270.7         51889-52026         c
            1762-1887           AC023270.7         50557-50682         c
            1888-2025           AC023270.7         48463-48600         c
            2026-2163           AC023270.7         47845-47982         c
            2164-2457           AC023270.7         44333-44626         c
            2458-2580           AC023270.7         44105-44227         c
            2581-2862           AC023270.7         42555-42836         c
            2863-2928           AC023270.7         42205-42270         c
            2929-3187           AC023270.7         41291-41549         c
            3188-3251           AC023270.7         41024-41087         c
            3252-3467           AC023270.7         40697-40912         c
            3468-3610           AC023270.7         39606-39748         c
            3611-3816           AC023270.7         38485-38690         c
            3817-4050           AC023270.7         37714-37947         c
            4051-4295           AC023270.7         37359-37603         c
            4296-4567           AC023270.7         36189-36460         c
            4568-4732           AC023270.7         35905-36069         c
            4733-4901           AC023270.7         35634-35802         c
            4902-6595           AC023270.7         33841-35534         c
            6596-6877           AC023270.7         33406-33687         c
            6878-7144           AC023270.7         32692-32958         c
            7145-7417           AC023270.7         32323-32595         c
            7418-7681           AC023270.7         31947-32210         c
            7682-7942           AC023270.7         31594-31854         c
            7943-8203           AC023270.7         29696-29956         c
            8204-8467           AC023270.7         28897-29160         c
            8468-8728           AC023270.7         28545-28805         c
            8729-8989           AC023270.7         28164-28424         c
            8990-9250           AC023270.7         27158-27418         c
            9251-9392           AC023270.7         26499-26640         c
            9393-9558           AC023270.7         26244-26409         c
            9559-9790           AC023270.7         24866-25097         c
            9791-10075          AC023270.7         23012-23296         c
            10076-10201         AC023270.7         22662-22787         c
            10202-10390         AC023270.7         17469-17657         c
            10391-10447         AC023270.7         11609-11665         c
            10448-10853         AC023270.7         1-406               c
            10854-13228         AC010680.10        173102-175476       c
            13229-13507         AC010680.10        172043-172321       c
            13508-13588         AC010680.10        76198-76278         c
            13589-13663         AC010680.10        75202-75276         c
            13664-13753         AC010680.10        74502-74591         c
            13754-13816         AC010680.10        74009-74071         c
            13817-13906         AC010680.10        73660-73749         c
            13907-13957         AC010680.10        71330-71380         c
            13958-14359         AC010680.10        70359-70760         c
            14360-14638         AC010680.10        69924-70202         c
            14639-14914         AC010680.10        69401-69676         c
            14915-15054         AC010680.10        69126-69265         c
            15055-15181         AC010680.10        68684-68810         c
            15182-15445         AC010680.10        68327-68590         c
            15446-15712         AC010680.10        67778-68044         c
            15713-15976         AC010680.10        67374-67637         c
            15977-16116         AC010680.10        67148-67287         c
            16117-16243         AC010680.10        66879-67005         c
            16244-16510         AC010680.10        66487-66753         c
            16511-16777         AC010680.10        66108-66374         c
            16778-17044         AC010680.10        64995-65261         c
            17045-17184         AC010680.10        64765-64904         c
            17185-17311         AC010680.10        64202-64328         c
            17312-17454         AC010680.10        63262-63404         c
            17455-17578         AC010680.10        59234-59357         c
            17579-17845         AC010680.10        58426-58692         c
            17846-17943         AC010680.10        56631-56728         c
            17944-18112         AC010680.10        55801-55969         c
            18113-18379         AC010680.10        55436-55702         c
            18380-18646         AC010680.10        55063-55329         c
            18647-18925         AC010680.10        54676-54954         c
            18926-19334         AC010680.10        54178-54586         c
            19335-19459         AC010680.10        53949-54073         c
            19460-19726         AC010680.10        53582-53848         c
            19727-19996         AC010680.10        52545-52814         c
            19997-20299         AC010680.10        52150-52452         c
            20300-20602         AC010680.10        51740-52042         c
            20603-20790         AC010680.10        51286-51473         c
            20791-20905         AC010680.10        51081-51195         c
            20906-21190         AC010680.10        50690-50974         c
            21191-21342         AC010680.10        50440-50591         c
            21343-21490         AC010680.10        49602-49749         c
            21491-21668         AC010680.10        49268-49445         c
            21669-21790         AC010680.10        48808-48929         c
            21791-22078         AC010680.10        48427-48714         c
            22079-22375         AC010680.10        48013-48309         c
            22376-22562         AC010680.10        47712-47898         c
            22563-22678         AC010680.10        47122-47237         c
            22679-22978         AC010680.10        46734-47033         c
            22979-23278         AC010680.10        46238-46537         c
            23279-23384         AC010680.10        46018-46123         c
            23385-23581         AC010680.10        45719-45915         c
            23582-23887         AC010680.10        45333-45638         c
            23888-24166         AC010680.10        44954-45232         c
            24167-24466         AC010680.10        44051-44350         c
            24467-24769         AC010680.10        43645-43947         c
            24770-25132         AC010680.10        43169-43531         c
            25133-25435         AC010680.10        42567-42869         c
            25436-25735         AC010680.10        42139-42438         c
            25736-26032         AC010680.10        41746-42042         c
            26033-26317         AC010680.10        41362-41646         c
            26318-26611         AC010680.10        40982-41275         c
            26612-26911         AC010680.10        39375-39674         c
            26912-27220         AC010680.10        38948-39256         c
            27221-27411         AC010680.10        38669-38859         c
            27412-27841         AC010680.10        37837-38266         c
            27842-28150         AC010680.10        36243-36551         c
            28151-28299         AC010680.10        35963-36111         c
            28300-28332         AC010680.10        35843-35875         c
            28333-28462         AC010680.10        35619-35748         c
            28463-28762         AC010680.10        35226-35525         c
            28763-29080         AC010680.10        34815-35132         c
            29081-29377         AC010680.10        33515-33811         c
            29378-29677         AC010680.10        33107-33406         c
            29678-29992         AC010680.10        32709-33023         c
            29993-30141         AC010680.10        32467-32615         c
            30142-30292         AC010680.10        31869-32019         c
            30293-30444         AC010680.10        31629-31780         c
            30445-30574         FJ695199.1         64-193              c
            30575-30877         AC010680.10        29469-29771         c
            30878-31180         AC010680.10        28306-28608         c
            31181-31462         AC010680.10        27923-28204         c
            31463-31762         AC010680.10        27530-27829         c
            31763-32065         AC010680.10        27135-27437         c
            32066-32374         AC010680.10        26737-27045         c
            32375-32656         AC010680.10        26341-26622         c
            32657-32956         AC010680.10        25940-26239         c
            32957-33250         AC010680.10        25561-25854         c
            33251-36217         AC010680.10        22500-25466         c
            36218-36538         AC010680.10        21861-22181         c
            36539-36823         AC010680.10        21478-21762         c
            36824-37123         AC010680.10        21080-21379         c
            37124-37426         AC010680.10        20467-20769         c
            37427-37702         AC010680.10        19034-19309         c
            37703-38002         AC010680.10        18631-18930         c
            38003-38305         AC010680.10        18238-18540         c
            38306-38605         AC010680.10        17569-17868         c
            38606-38893         AC010680.10        16902-17189         c
            38894-39190         AC010680.10        16258-16554         c
            39191-39493         AC010680.10        15868-16170         c
            39494-39799         AC010680.10        15461-15766         c
            39800-40087         AC010680.10        14284-14571         c
            40088-40378         AC010680.10        13901-14191         c
            40379-40666         AC010680.10        13523-13810         c
            40667-41254         AC010680.10        12768-13355         c
            41255-41359         AC010680.10        12573-12677         c
            41360-41557         AC010680.10        11950-12147         c
            41558-41854         AC010680.10        11564-11860         c
            41855-42442         AC010680.10        10885-11472         c
            42443-42745         AC010680.10        10491-10793         c
            42746-53123         AC010680.10        1-10378             c
            53124-59851         AC009948.3         165901-172628       c
            59852-60148         AC009948.3         164931-165227       c
            60149-60736         AC009948.3         164238-164825       c
            60737-61039         AC009948.3         163843-164145       c
            61040-61336         AC009948.3         163438-163734       c
            61337-61624         AC009948.3         161455-161742       c
            61625-61924         AC009948.3         161043-161342       c
            61925-62227         AC009948.3         160504-160806       c
            62228-62533         AC009948.3         160092-160397       c
            62534-64300         AC009948.3         158220-159986       c
            64301-64594         AC009948.3         157557-157850       c
            64595-64882         AC009948.3         156576-156863       c
            64883-65182         AC009948.3         156160-156459       c
            65183-67249         AC009948.3         153997-156063       c
            67250-67552         AC009948.3         153593-153895       c
            67553-67858         AC009948.3         153190-153495       c
            67859-68149         AC009948.3         152802-153092       c
            68150-68446         AC009948.3         152410-152706       c
            68447-68752         AC009948.3         151978-152283       c
            68753-69058         AC009948.3         150791-151096       c
            69059-69340         AC009948.3         150424-150705       c
            69341-69934         AC009948.3         149659-150252       c
            69935-70222         AC009948.3         149252-149539       c
            70223-70522         AC009948.3         148854-149153       c
            70523-70825         AC009948.3         147872-148174       c
            70826-71128         AC009948.3         146658-146960       c
            71129-71713         AC009948.3         145972-146556       c
            71714-72019         AC009948.3         145536-145841       c
            72020-72319         AC009948.3         145130-145429       c
            72320-72895         AC009948.3         143932-144507       c
            72896-73201         AC009948.3         143528-143833       c
            73202-73795         AC009948.3         142572-143165       c
            73796-79404         AC009948.3         136831-142439       c
            79405-79561         AC009948.3         136550-136706       c
            79562-80253         AC009948.3         135118-135809       c
            80254-80407         AC009948.3         134864-135017       c
            80408-80710         AC009948.3         134036-134338       c
            80711-82029         AC009948.3         132579-133897       c
FEATURES             Location/Qualifiers
     source          1..82029
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31"
     gene            1..82029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="titin"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
     exon            1..212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647840"
     misc_feature    202..204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="upstream in-frame stop codon"
     exon            213..316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     CDS             226..81006
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /EC_number="2.7.11.1"
                     /note="isoform N2-B is encoded by transcript variant N2-B;
                     connectin; rhabdomyosarcoma antigen MU-RMS-40.14"
                     /codon_start=1
                     /product="titin isoform N2-B"
                     /protein_id="NP_003310.4"
                     /db_xref="GI:291045223"
                     /db_xref="CCDS:CCDS54421.1"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
                     /translation="
MTTQAPTFTQPLQSVVVLEGSTATFEAHISGFPVPEVSWFRDGQVISTSTLPGVQISFSDGRAKLTIPAVTKANSGRYSLKATNGSGQATSTAELLVKAETAPPNFVQRLQSMTVRQGSQVRLQVRVTGIPTPVVKFYRDGAEIQSSLDFQISQEGDLYSLLIAEAYPEDSGTYSVNATNSVGRATSTAELLVQGEEEVPAKKTKTIVSTAQISESRQTRIEKKIEAHFDARSIATVEMVIDGAAGQQLPHKTPPRIPPKPKSRSPTPPSIAAKAQLARQQSPSPIRHSPSPVRHVRAPTPSPVRSVSPAARISTSPIRSVRSPLLMRKTQASTVATGPEVPPPWKQEGYVASSSEAEMRETTLTTSTQIRTEERWEGRYGVQEQVTISGAAGAAASVSASASYAAEAVATGAKEVKQDADKSAAVATVVAAVDMARVREPVISAVEQTAQRTTTTAVHIQPAQEQVRKEAEKTAVTKVVVAADKAKEQELKSRTKEVITTKQEQMHVTHEQIRKETEKTFVPKVVISAAKAKEQETRISEEITKKQKQVTQEAIMKETRKTVVPKVIVATPKVKEQDLVSRGREGITTKREQVQITQEKMRKEAEKTALSTIAVATAKAKEQETILRTRETMATRQEQIQVTHGKVDVGKKAEAVATVVAAVDQARVREPREPGHLEESYAQQTTLEYGYKERISAAKVAEPPQRPASEPHVVPKAVKPRVIQAPSETHIKTTDQKGMHISSQIKKTTDLTTERLVHVDKRPRTASPHFTVSKISVPKTEHGYEASIAGSAIATLQKELSATSSAQKITKSVKAPTVKPSETRVRAEPTPLPQFPFADTPDTYKSEAGVEVKKEVGVSITGTTVREERFEVLHGREAKVTETARVPAPVEIPVTPPTLVSGLKNVTVIEGESVTLECHISGYPSPTVTWYREDYQIESSIDFQITFQSGIARLMIREAFAEDSGRFTCSAVNEAGTVSTSCYLAVQVSEEFEKETTAVTEKFTTEEKRFVESRDVVMTDTSLTEEQAGPGEPAAPYFITKPVVQKLVEGGSVVFGCQVGGNPKPHVYWKKSGVPLTTGYRYKVSYNKQTGECKLVISMTFADDAGEYTIVVRNKHGETSASASLLEEADYELLMKSQQEMLYQTQVTAFVQEPKVGETAPGFVYSEYEKEYEKEQALIRKKMAKDTVVVRTYVEDQEFHISSFEERLIKEIEYRIIKTTLEELLEEDGEEKMAVDISESEAVESGFDSRIKNYRILEGMGVTFHCKMSGYPLPKIAWYKDGKRIKHGERYQMDFLQDGRASLRIPVVLPEDEGIYTAFASNIKGNAICSGKLYVEPAAPLGAPTYIPTLEPVSRIRSLSPRSVSRSPIRMSPARMSPARMSPARMSPARMSPGRRLEETDESQLERLYKPVFVLKPVSFKCLEGQTARFDLKVVGRPMPETFWFHDGQQIVNDYTHKVVIKEDGTQSLIIVPATPSDSGEWTVVAQNRAGRSSISVILTVEAVEHQVKPMFVEKLKNVNIKEGSRLEMKVRATGNPNPDIVWLKNSDIIVPHKYPKIRIEGTKGEAALKIDSTVSQDSAWYTATAINKAGRDTTRCKVNVEVEFAEPEPERKLIIPRGTYRAKEIAAPELEPLHLRYGQEQWEEGDLYDKEKQQKPFFKKKLTSLRLKRFGPAHFECRLTPIGDPTMVVEWLHDGKPLEAANRLRMINEFGYCSLDYGVAYSRDSGIITCRATNKYGTDHTSATLIVKDEKSLVEESQLPEGRKGLQRIEELERMAHEGALTGVTTDQKEKQKPDIVLYPEPVRVLEGETARFRCRVTGYPQPKVNWYLNGQLIRKSKRFRVRYDGIHYLDIVDCKSYDTGEVKVTAENPEGVIEHKVKLEIQQREDFRSVLRRAPEPRPEFHVHEPGKLQFEVQKVDRPVDTTETKEVVKLKRAERITHEKVPEESEELRSKFKRRTEEGYYEAITAVELKSRKKDESYEELLRKTKDELLHWTKELTEEEKKALAEEGKITIPTFKPDKIELSPSMEAPKIFERIQSQTVGQGSDAHFRVRVVGKPDPECEWYKNGVKIERSDRIYWYWPEDNVCELVIRDVTAEDSASIMVKAINIAGETSSHAFLLVQAKQLITFTQELQDVVAKEKDTMATFECETSEPFVKVKWYKDGMEVHEGDKYRMHSDRKVHFLSILTIDTSDAEDYSCVLVEDENVKTTAKLIVEGAVVEFVKELQDIEVPESYSGELECIVSPENIEGKWYHNDVELKSNGKYTITSRRGRQNLTVKDVTKEDQGEYSFVIDGKKTTCKLKMKPRPIAILQGLSDQKVCEGDIVQLEVKVSLESVEGVWMKDGQEVQPSDRVHIVIDKQSHMLLIEDMTKEDAGNYSFTIPALGLSTSGRVSVYSVDVITPLKDVNVIEGTKAVLECKVSVPDVTSVKWYLNDEQIKPDDRVQAIVKGTKQRLVINRTHASDEGPYKLIVGRVETNCNLSVEKIKIIRGLRDLTCTETQNVVFEVELSHSGIDVLWNFKDKEIKPSSKYKIEAHGKIYKLTVLNMMKDDEGKYTFYAGENMTSGKLTVAGGAISKPLTDQTVAESQEAVFECEVANPDSKGEWLRDGKHLPLTNNIRSESDGHKRRLIIAATKLDDIGEYTYKVATSKTSAKLKVEAVKIKKTLKNLTVTETQDAVFTVELTHPNVKGVQWIKNGVVLESNEKYAISVKGTIYSLRIKNCAIVDESVYGFRLGRLGASARLHVETVKIIKKPKDVTALENATVAFEVSVSHDTVPVKWFHKSVEIKPSDKHRLVSERKVHKLMLQNISPSDAGEYTAVVGQLECKAKLFVETLHITKTMKNIEVPETKTASFECEVSHFNVPSMWLKNGVEIEMSEKFKIVVQGKLHQLIIMNTSTEDSAEYTFVCGNDQVSATLTVTPIMITSMLKDINAEEKDTITFEVTVNYEGISYKWLKNGVEIKSTDKCQMRTKKLTHSLNIRNVHFGDAADYTFVAGKATSTATLYVEARHIEFRKHIKDIKVLEKKRAMFECEVSEPDITVQWMKDDQELQITDRIKIQKEKYVHRLLIPSTRMSDAGKYTVVAGGNVSTAKLFVEGRDVRIRSIKKEVQVIEKQRAVVEFEVNEDDVDAHWYKDGIEINFQVQERHKYVVERRIHRMFISETRQSDAGEYTFVAGRNRSSVTLYVNAPEPPQVLQELQPVTVQSGKPARFCAVISGRPQPKISWYKEEQLLSTGFKCKFLHDGQEYTLLLIEAFPEDAAVYTCEAKNDYGVATTSASLSVEVPEVVSPDQEMPVYPPAIITPLQDTVTSEGQPARFQCRVSGTDLKVSWYSKDKKIKPSRFFRMTQFEDTYQLEIAEAYPEDEGTYTFVASNAVGQVSSTANLSLEAPESILHERIEQEIEMEMKEFSSSFLSAEEEGLHSAELQLSKINETLELLSESPVYPTKFDSEKEGTGPIFIKEVSNADISMGDVATLSVTVIGIPKPKIQWFFNGVLLTPSADYKFVFDGDDHSLIILFTKLEDEGEYTCMASNDYGKTICSAYLKINSKGEGHKDTETESAVAKSLEKLGGPCPPHFLKELKPIRCAQGLPAIFEYTVVGEPAPTVTWFKENKQLCTSVYYTIIHNPNGSGTFIVNDPQREDSGLYICKAENMLGESTCAAELLVLLEDTDMTDTPCKAKSTPEAPEDFPQTPLKGPAVEALDSEQEIATFVKDTILKAALITEENQQLSYEHIAKANELSSQLPLGAQELQSILEQDKLTPESTREFLCINGSIHFQPLKEPSPNLQLQIVQSQKTFSKEGILMPEEPETQAVLSDTEKIFPSAMSIEQINSLTVEPLKTLLAEPEGNYPQSSIEPPMHSYLTSVAEEVLSPKEKTVSDTNREQRVTLQKQEAQSALILSQSLAEGHVESLQSPDVMISQVNYEPLVPSEHSCTEGGKILIESANPLENAGQDSAVRIEEGKSLRFPLALEEKQVLLKEEHSDNVVMPPDQIIESKREPVAIKKVQEVQGRDLLSKESLLSGIPEEQRLNLKIQICRALQAAVASEQPGLFSEWLRNIEKVEVEAVNITQEPRHIMCMYLVTSAKSVTEEVTIIIEDVDPQMANLKMELRDALCAIIYEEIDILTAEGPRIQQGAKTSLQEEMDSFSGSQKVEPITEPEVESKYLISTEEVSYFNVQSRVKYLDATPVTKGVASAVVSDEKQDESLKPSEEKEESSSESGTEEVATVKIQEAEGGLIKEDGPMIHTPLVDTVSEEGDIVHLTTSITNAKEVNWYFENKLVPSDEKFKCLQDQNTYTLVIDKVNTEDHQGEYVCEALNDSGKTATSAKLTVVKRAAPVIKRKIEPLEVALGHLAKFTCEIQSAPNVRFQWFKAGREIYESDKCSIRSSKYISSLEILRTQVVDCGEYTCKASNEYGSVSCTATLTVTVPGGEKKVRKLLPERKPEPKEEVVLKSVLRKRPEEEEPKVEPKKLEKVKKPAVPEPPPPKPVEEVEVPTVTKRERKIPEPTKVPEIKPAIPLPAPEPKPKPEAEVKTIKPPPVEPEPTPIAAPVTVPVVGKKAEAKAPKEEAAKPKGPIKGVPKKTPSPIEAERRKLRPGSGGEKPPDEAPFTYQLKAVPLKFVKEIKDIILTESEFVGSSAIFECLVSPSTAITTWMKDGSNIRESPKHRFIADGKDRKLHIIDVQLSDAGEYTCVLRLGNKEKTSTAKLVVEELPVRFVKTLEEEVTVVKGQPLYLSCELNKERDVVWRKDGKIVVEKPGRIVPGVIGLMRALTINDADDTDAGTYTVTVENANNLECSSCVKVVEVIRDWLVKPIRDQHVKPKGTAIFACDIAKDTPNIKWFKGYDEIPAEPNDKTEILRDGNHLYLKIKNAMPEDIAEYAVEIEGKRYPAKLTLGEREVELLKPIEDVTIYEKESASFDAEISEADIPGQWKLKGELLRPSPTCEIKAEGGKRFLTLHKVKLDQAGEVLYQALNAITTAILTVKEIELDFAVPLKDVTVPERRQARFECVLTREANVIWSKGPDIIKSSDKFDIIADGKKHILVINDSQFDDEGVYTAEVEGKKTSARLFVTGIRLKFMSPLEDQTVKEGETATFVCELSHEKMHVVWFKNDAKLHTSRTVLISSEGKTHKLEMKEVTLDDISQIKAQVKELSSTAQLKVLEADPYFTVKLHDKTAVEKDEITLKCEVSKDVPVKWFKDGEEIVPSPKYSIKADGLRRILKIKKADLKDKGEYVCDCGTDKTKANVTVEARLIKVEKPLYGVEVFVGETAHFEIELSEPDVHGQWKLKGQPLTASPDCEIIEDGKKHILILHNCQLGMTGEVSFQAANAKSAANLKVKELPLIFITPLSDVKVFEKDEAKFECEVSREPKTFRWLKGTQEITGDDRFELIKDGTKHSMVIKSAAFEDEAKYMFEAEDKHTSGKLIIEGIRLKFLTPLKDVTAKEKESAVFTVELSHDNIRVKWFKNDQRLHTTRSVSMQDEGKTHSITFKDLSIDDTSQIRVEAMGMSSEAKLTVLEGDPYFTGKLQDYTGVEKDEVILQCEISKADAPVKWFKDGKEIKPSKNAVIKADGKKRMLILKKALKSDIGQYTCDCGTDKTSGKLDIEDREIKLVRPLHSVEVMETETARFETEISEDDIHANWKLKGEALLQTPDCEIKEEGKIHSLVLHNCRLDQTGGVDFQAANVKSSAHLRVKPRVIGLLRPLKDVTVTAGETATFDCELSYEDIPVEWYLKGKKLEPSDKVVPRSEGKVHTLTLRDVKLEDAGEVQLTAKDFKTHANLFVKEPPVEFTKPLEDQTVEEGATAVLECEVSRENAKVKWFKNGTEILKSKKYEIVADGRVRKLVIHDCTPEDIKTYTCDAKDFKTSCNLNVVPPHVEFLRPLTDLQVREKEMARFECELSRENAKVKWFKDGAEIKKGKKYDIISKGAVRILVINKCLLDDEAEYSCEVRTARTSGMLTVLEEEAVFTKNLANIEVSETDTIKLVCEVSKPGAEVIWYKGDEEIIETGRYEILTEGRKRILVIQNAHLEDAGNYNCRLPSSRTDGKVKVHELAAEFISKPQNLEILEGEKAEFVCSISKESFPVQWKRDDKTLESGDKYDVIADGKKRVLVVKDATLQDMGTYVVMVGAARAAAHLTVIEKLRIVVPLKDTRVKEQQEVVFNCEVNTEGAKAKWFRNEEAIFDSSKYIILQKDLVYTLRIRDAHLDDQANYNVSLTNHRGENVKSAANLIVEEEDLRIVEPLKDIETMEKKSVTFWCKVNRLNVTLKWTKNGEEVPFDNRVSYRVDKYKHMLTIKDCGFPDEGEYIVTAGQDKSVAELLIIEAPTEFVEHLEDQTVTEFDDAVFSCQLSREKANVKWYRNGREIKEGKKYKFEKDGSIHRLIIKDCRLDDECEYACGVEDRKSRARLFVEEIPVEIIRPPQDILEAPGADVVFLAELNKDKVEVQWLRNNMVVVQGDKHQMMSEGKIHRLQICDIKPRDQGEYRFIAKDKEARAKLELAAAPKIKTADQDLVVDVGKPLTMVVPYDAYPKAEAEWFKENEPLSTKTIDTTAEQTSFRILEAKKGDKGRYKIVLQNKHGKAEGFINLKVIDVPGPVRNLEVTETFDGEVSLAWEEPLTDGGSKIIGYVVERRDIKRKTWVLATDRAESCEFTVTGLQKGGVEYLFRVSARNRVGTGEPVETDNPVEARSKYDVPGPPLNVTITDVNRFGVSLTWEPPEYDGGAEITNYVIELRDKTSIRWDTAMTVRAEDLSATVTDVVEGQEYSFRVRAQNRIGVGKPSAATPFVKVADPIERPSPPVNLTSSDQTQSSVQLKWEPPLKDGGSPILGYIIERCEEGKDNWIRCNMKLVPELTYKVTGLEKGNKYLYRVSAENKAGVSDPSEILGPLTADDAFVEPTMDLSAFKDGLEVIVPNPITILVPSTGYPRPTATWCFGDKVLETGDRVKMKTLSAYAELVISPSERSDKGIYTLKLENRVKTISGEIDVNVIARPSAPKELKFGDITKDSVHLTWEPPDDDGGSPLTGYVVEKREVSRKTWTKVMDFVTDLEFTVPDLVQGKEYLFKVCARNKCGPGEPAYVDEPVNMSTPATVPDPPENVKWRDRTANSIFLTWDPPKNDGGSRIKGYIVERCPRGSDKWVACGEPVAETKMEVTGLEEGKWYAYRVKALNRQGASKPSRPTEEIQAVDTQEAPEIFLDVKLLAGLTVKAGTKIELPATVTGKPEPKITWTKADMILKQDKRITIENVPKKSTVTIVDSKRSDTGTYIIEAVNVCGRATAVVEVNVLDKPGPPAAFDITDVTNESCLLTWNPPRDDGGSKITNYVVERRATDSEVWHKLSSTVKDTNFKATKLIPNKEYIFRVAAENMYGVGEPVQASPITAKYQFDPPGPPTRLEPSDITKDAVTLTWCEPDDDGGSPITGYWVERLDPDTDKWVRCNKMPVKDTTYRVKGLTNKKKYRFRVLAENLAGPGKPSKSTEPILIKDPIDPPWPPGKPTVKDVGKTSVRLNWTKPEHDGGAKIESYVIEMLKTGTDEWVRVAEGVPTTQHLLPGLMEGQEYSFRVRAVNKAGESEPSEPSDPVLCREKLYPPSPPRWLEVINITKNTADLKWTVPEKDGGSPITNYIVEKRDVRRKGWQTVDTTVKDTKCTVTPLTEGSLYVFRVAAENAIGQSDYTEIEDSVLAKDTFTTPGPPYALAVVDVTKRHVDLKWEPPKNDGGRPIQRYVIEKKERLGTRWVKAGKTAGPDCNFRVTDVIEGTEVQFQVRAENEAGVGHPSEPTEILSIEDPTSPPSPPLDLHVTDAGRKHIAIAWKPPEKNGGSPIIGYHVEMCPVGTEKWMRVNSRPIKDLKFKVEEGVVPDKEYVLRVRAVNAIGVSEPSEISENVVAKDPDCKPTIDLETHDIIVIEGEKLSIPVPFRAVPVPTVSWHKDGKEVKASDRLTMKNDHISAHLEVPKSVRADAGIYTITLENKLGSATASINVKVIGLPGPCKDIKASDITKSSCKLTWEPPEFDGGTPILHYVLERREAGRRTYIPVMSGENKLSWTVKDLIPNGEYFFRVKAVNKVGGGEYIELKNPVIAQDPKQPPDPPVDVEVHNPTAEAMTITWKPPLYDGGSKIMGYIIEKIAKGEERWKRCNEHLVPILTYTAKGLEEGKEYQFRVRAENAAGISEPSRATPPTKAVDPIDAPKVILRTSLEVKRGDEIALDASISGSPYPTITWIKDENVIVPEEIKKRAAPLVRRRKGEVQEEEPFVLPLTQRLSIDNSKKGESQLRVRDSLRPDHGLYMIKVENDHGIAKAPCTVSVLDTPGPPINFVFEDIRKTSVLCKWEPPLDDGGSEIINYTLEKKDKTKPDSEWIVVTSTLRHCKYSVTKLIEGKEYLFRVRAENRFGPGPPCVSKPLVAKDPFGPPDAPDKPIVEDVTSNSMLVKWNEPKDNGSPILGYWLEKREVNSTHWSRVNKSLLNALKANVDGLLEGLTYVFRVCAENAAGPGKFSPPSDPKTAHDPISPPGPPIPRVTDTSSTTIELEWEPPAFNGGGEIVGYFVDKQLVGTNEWSRCTEKMIKVRQYTVKEIREGADYKLRVSAVNAAGEGPPGETQPVTVAEPQEPPAVELDVSVKGGIQIMAGKTLRIPAVVTGRPVPTKVWTKEEGELDKDRVVIDNVGTKSELIIKDALRKDHGRYVITATNSCGSKFAAARVEVFDVPGPVLDLKPVVTNRKMCLLNWSDPEDDGGSEITGFIIERKDAKMHTWRQPIETERSKCDITGLLEGQEYKFRVIAKNKFGCGPPVEIGPILAVDPLGPPTSPERLTYTERTKSTITLDWKEPRSNGGSPIQGYIIEKRRHDKPDFERVNKRLCPTTSFLVENLDEHQMYEFRVKAVNEIGESEPSLPLNVVIQDDEVPPTIKLRLSVRGDTIKVKAGEPVHIPADVTGLPMPKIEWSKNETVIEKPTDALQITKEEVSRSEAKTELSIPKAVREDKGTYTVTASNRLGSVFRNVHVEVYDRPSPPRNLAVTDIKAESCYLTWDAPLDNGGSEITHYVIDKRDASRKKAEWEEVTNTAVEKRYGIWKLIPNGQYEFRVRAVNKYGISDECKSDKVVIQDPYRLPGPPGKPKVLARTKGSMLVSWTPPLDNGGSPITGYWLEKREEGSPYWSRVSRAPITKVGLKGVEFNVPRLLEGVKYQFRAMAINAAGIGPPSEPSDPEVAGDPIFPPGPPSCPEVKDKTKSSISLGWKPPAKDGGSPIKGYIVEMQEEGTTDWKRVNEPDKLITTCECVVPNLKELRKYRFRVKAVNEAGESEPSDTTGEIPATDIQEEPEVFIDIGAQDCLVCKAGSQIRIPAVIKGRPTPKSSWEFDGKAKKAMKDGVHDIPEDAQLETAENSSVIIIPECKRSHTGKYSITAKNKAGQKTANCRVKVMDVPGPPKDLKVSDITRGSCRLSWKMPDDDGGDRIKGYVIEKRTIDGKAWTKVNPDCGSTTFVVPDLLSEQQYFFRVRAENRFGIGPPVETIQRTTARDPIYPPDPPIKLKIGLITKNTVHLSWKPPKNDGGSPVTHYIVECLAWDPTGTKKEAWRQCNKRDVEELQFTVEDLVEGGEYEFRVKAVNAAGVSKPSATVGPVTVKDQTCPPSIDLKEFMEVEEGTNVNIVAKIKGVPFPTLTWFKAPPKKPDNKEPVLYDTHVNKLVVDDTCTLVIPQSRRSDTGLYTITAVNNLGTASKEMRLNVLGRPGPPVGPIKFESVSADQMTLSWFPPKDDGGSKITNYVIEKREANRKTWVHVSSEPKECTYTIPKLLEGHEYVFRIMAQNKYGIGEPLDSEPETARNLFSVPGAPDKPTVSSVTRNSMTVNWEEPEYDGGSPVTGYWLEMKDTTSKRWKRVNRDPIKAMTLGVSYKVTGLIEGSDYQFRVYAINAAGVGPASLPSDPATARDPIAPPGPPFPKVTDWTKSSADLEWSPPLKDGGSKVTGYIVEYKEEGKEEWEKGKDKEVRGTKLVVTGLKEGAFYKFRVRAVNIAGIGEPGEVTDVIEMKDRLVSPDLQLDASVRDRIVVHAGGVIRIIAYVSGKPPPTVTWNMNERTLPQEATIETTAISSSMVIKNCQRSHQGVYSLLAKNEAGERKKTIIVDVLDVPGPVGTPFLAHNLTNESCKLTWFSPEDDGGSPITNYVIEKRESDRRAWTPVTYTVTRQNATVQGLIQGKAYFFRIAAENSIGMGPFVETSEALVIREPITVPERPEDLEVKEVTKNTVTLTWNPPKYDGGSEIINYVLESRLIGTEKFHKVTNDNLLSRKYTVKGLKEGDTYEYRVSAVNIVGQGKPSFCTKPITCKDELAPPTLHLDFRDKLTIRVGEAFALTGRYSGKPKPKVSWFKDEADVLEDDRTHIKTTPATLALEKIKAKRSDSGKYCVVVENSTGSRKGFCQVNVVDRPGPPVGPVSFDEVTKDYMVISWKPPLDDGGSKITNYIIEKKEVGKDVWMPVTSASAKTTCKVSKLLEGKDYIFRIHAENLYGISDPLVSDSMKAKDRFRVPDAPDQPIVTEVTKDSALVTWNKPHDGGKPITNYILEKRETMSKRWARVTKDPIHPYTKFRVPDLLEGCQYEFRVSAENEIGIGDPSPPSKPVFAKDPIAKPSPPVNPEAIDTTCNSVDLTWQPPRHDGGSKILGYIVEYQKVGDEEWRRANHTPESCPETKYKVTGLRDGQTYKFRVLAVNAAGESDPAHVPEPVLVKDRLEPPELILDANMAREQHIKVGDTLRLSAIIKGVPFPKVTWKKEDRDAPTKARIDVTPVGSKLEIRNAAHEDGGIYSLTVENPAGSKTVSVKVLVLDKPGPPRDLEVSEIRKDSCYLTWKEPLDDGGSVITNYVVERRDVASAQWSPLSATSKKKSHFAKHLNEGNQYLFRVAAENQYGRGPFVETPKPIKALDPLHPPGPPKDLHHVDVDKTEVSLVWNKPDRDGGSPITGYLVEYQEEGTQDWIKFKTVTNLECVVTGLQQGKTYRFRVKAENIVGLGLPDTTIPIECQEKLVPPSVELDVKLIEGLVVKAGTTVRFPAIIRGVPVPTAKWTTDGSEIKTDEHYTVETDNFSSVLTIKNCLRRDTGEYQITVSNAAGSKTVAVHLTVLDVPGPPTGPINILDVTPEHMTISWQPPKDDGGSPVINYIVEKQDTRKDTWGVVSSGSSKTKLKIPHLQKGCEYVFRVRAENKIGVGPPLDSTPTVAKHKFSPPSPPGKPVVTDITENAATVSWTLPKSDGGSPITGYYMERREVTGKWVRVNKTPIADLKFRVTGLYEGNTYEFRVFAENLAGLSKPSPSSDPIKACRPIKPPGPPINPKLKDKSRETADLVWTKPLSDGGSPILGYVVECQKPGTAQWNRINKDELIRQCAFRVPGLIEGNEYRFRIKAANIVGEGEPRELAESVIAKDILHPPEVELDVTCRDVITVRVGQTIRILARVKGRPEPDITWTKEGKVLVREKRVDLIQDLPRVELQIKEAVRADHGKYIISAKNSSGHAQGSAIVNVLDRPGPCQNLKVTNVTKENCTISWENPLDNGGSEITNFIVEYRKPNQKGWSIVASDVTKRLIKANLLANNEYYFRVCAENKVGVGPTIETKTPILAINPIDRPGEPENLHIADKGKTFVYLKWRRPDYDGGSPNLSYHVERRLKGSDDWERVHKGSIKETHYMVDRCVENQIYEFRVQTKNEGGESDWVKTEEVVVKEDLQKPVLDLKLSGVLTVKAGDTIRLEAGVRGKPFPEVAWTKDKDATDLTRSPRVKIDTRADSSKFSLTKAKRSDGGKYVVTATNTAGSFVAYATVNVLDKPGPVRNLKIVDVSSDRCTVCWDPPEDDGGCEIQNYILEKCETKRMVWSTYSATVLTPGTTVTRLIEGNEYIFRVRAENKIGTGPPTESKPVIAKTKYDKPGRPDPPEVTKVSKEEMTVVWNPPEYDGGKSITGYFLEKKEKHSTRWVPVNKSAIPERRMKVQNLLPDHEYQFRVKAENEIGIGEPSLPSRPVVAKDPIEPPGPPTNFRVVDTTKHSITLGWGKPVYDGGAPIIGYVVEMRPKIADASPDEGWKRCNAAAQLVRKEFTVTSLDENQEYEFRVCAQNQVGIGRPAELKEAIKPKEILEPPEIDLDASMRKLVIVRAGCPIRLFAIVRGRPAPKVTWRKVGIDNVVRKGQVDLVDTMAFLVIPNSTRDDSGKYSLTLVNPAGEKAVFVNVRVLDTPGPVSDLKVSDVTKTSCHVSWAPPENDGGSQVTHYIVEKREADRKTWSTVTPEVKKTSFHVTNLVPGNEYYFRVTAVNEYGPGVPTDVPKPVLASDPLSEPDPPRKLEVTEMTKNSATLAWLPPLRDGGAKIDGYITSYREEEQPADRWTEYSVVKDLSLVVTGLKEGKKYKFRVAARNAVGVSLPREAEGVYEAKEQLLPPKILMPEQITIKAGKKLRIEAHVYGKPHPTCKWKKGEDEVVTSSHLAVHKADSSSILIIKDVTRKDSGYYSLTAENSSGTDTQKIKVVVMDAPGPPQPPFDISDIDADACSLSWHIPLEDGGSNITNYIVEKCDVSRGDWVTALASVTKTSCRVGKLIPGQEYIFRVRAENRFGISEPLTSPKMVAQFPFGVPSEPKNARVTKVNKDCIFVAWDRPDSDGGSPIIGYLIERKERNSLLWVKANDTLVRSTEYPCAGLVEGLEYSFRIYALNKAGSSPPSKPTEYVTARMPVDPPGKPEVIDVTKSTVSLIWARPKHDGGSKIIGYFVEACKLPGDKWVRCNTAPHQIPQEEYTATGLEEKAQYQFRAIARTAVNISPPSEPSDPVTILAENVPPRIDLSVAMKSLLTVKAGTNVCLDATVFGKPMPTVSWKKDGTLLKPAEGIKMAMQRNLCTLELFSVNRKDSGDYTITAENSSGSKSATIKLKVLDKPGPPASVKINKMYSDRAMLSWEPPLEDGGSEITNYIVDKRETSRPNWAQVSATVPITSCSVEKLIEGHEYQFRICAENKYGVGDPVFTEPAIAKNPYDPPGRCDPPVISNITKDHMTVSWKPPADDGGSPITGYLLEKRETQAVNWTKVNRKPIIERTLKATGLQEGTEYEFRVTAINKAGPGKPSDASKAAYARDPQYPPGPPAFPKVYDTTRSSVSLSWGKPAYDGGSPIIGYLVEVKRADSDNWVRCNLPQNLQKTRFEVTGLMEDTQYQFRVYAVNKIGYSDPSDVPDKHYPKDILIPPEGELDADLRKTLILRAGVTMRLYVPVKGRPPPKITWSKPNVNLRDRIGLDIKSTDFDTFLRCENVNKYDAGKYILTLENSCGKKEYTIVVKVLDTPGPPVNVTVKEISKDSAYVTWEPPIIDGGSPIINYVVQKRDAERKSWSTVTTECSKTSFRVANLEEGKSYFFRVFAENEYGIGDPGETRDAVKASQTPGPVVDLKVRSVSKSSCSIGWKKPHSDGGSRIIGYVVDFLTEENKWQRVMKSLSLQYSAKDLTEGKEYTFRVSAENENGEGTPSEITVVARDDVVAPDLDLKGLPDLCYLAKENSNFRLKIPIKGKPAPSVSWKKGEDPLATDTRVSVESSAVNTTLIVYDCQKSDAGKYTITLKNVAGTKEGTISIKVVGKPGIPTGPIKFDEVTAEAMTLKWAPPKDDGGSEITNYILEKRDSVNNKWVTCASAVQKTTFRVTRLHEGMEYTFRVSAENKYGVGEGLKSEPIVARHPFDVPDAPPPPNIVDVRHDSVSLTWTDPKKTGGSPITGYHLEFKERNSLLWKRANKTPIRMRDFKVTGLTEGLEYEFRVMAINLAGVGKPSLPSEPVVALDPIDPPGKPEVINITRNSVTLIWTEPKYDGGHKLTGYIVEKRDLPSKSWMKANHVNVPECAFTVTDLVEGGKYEFRIRAKNTAGAISAPSESTETIICKDEYEAPTIVLDPTIKDGLTIKAGDTIVLNAISILGKPLPKSSWSKAGKDIRPSDITQITSTPTSSMLTIKYATRKDAGEYTITATNPFGTKVEHVKVTVLDVPGPPGPVEISNVSAEKATLTWTPPLEDGGSPIKSYILEKRETSRLLWTVVSEDIQSCRHVATKLIQGNEYIFRVSAVNHYGKGEPVQSEPVKMVDRFGPPGPPEKPEVSNVTKNTATVSWKRPVDDGGSEITGYHVERREKKSLRWVRAIKTPVSDLRCKVTGLQEGSTYEFRVSAENRAGIGPPSEASDSVLMKDAAYPPGPPSNPHVTDTTKKSASLAWGKPHYDGGLEITGYVVEHQKVGDEAWIKDTTGTALRITQFVVPDLQTKEKYNFRISAINDAGVGEPAVIPDVEIVEREMAPDFELDAELRRTLVVRAGLSIRIFVPIKGRPAPEVTWTKDNINLKNRANIENTESFTLLIIPECNRYDTGKFVMTIENPAGKKSGFVNVRVLDTPGPVLNLRPTDITKDSVTLHWDLPLIDGGSRITNYIVEKREATRKSYSTATTKCHKCTYKVTGLSEGCEYFFRVMAENEYGIGEPTETTEPVKASEAPSPPDSLNIMDITKSTVSLAWPKPKHDGGSKITGYVIEAQRKGSDQWTHITTVKGLECVVRNLTEGEEYTFQVMAVNSAGRSAPRESRPVIVKEQTMLPELDLRGIYQKLVIAKAGDNIKVEIPVLGRPKPTVTWKKGDQILKQTQRVNFETTATSTILNINECVRSDSGPYPLTARNIVGEVGDVITIQVHDIPGPPTGPIKFDEVSSDFVTFSWDPPENDGGVPISNYVVEMRQTDSTTWVELATTVIRTTYKATRLTTGLEYQFRVKAQNRYGVGPGITSACIVANYPFKVPGPPGTPQVTAVTKDSMTISWHEPLSDGGSPILGYHVERKERNGILWQTVSKALVPGNIFKSSGLTDGIAYEFRVIAENMAGKSKPSKPSEPMLALDPIDPPGKPVPLNITRHTVTLKWAKPEYTGGFKITSYIVEKRDLPNGRWLKANFSNILENEFTVSGLTEDAAYEFRVIAKNAAGAISPPSEPSDAITCRDDVEAPKIKVDVKFKDTVILKAGEAFRLEADVSGRPPPTMEWSKDGKELEGTAKLEIKIADFSTNLVNKDSTRRDSGAYTLTATNPGGFAKHIFNVKVLDRPGPPEGPLAVTEVTSEKCVLSWFPPLDDGGAKIDHYIVQKRETSRLAWTNVASEVQVTKLKVTKLLKGNEYIFRVMAVNKYGVGEPLESEPVLAVNPYGPPDPPKNPEVTTITKDSMVVCWGHPDSDGGSEIINYIVERRDKAGQRWIKCNKKTLTDLRYKVSGLTEGHEYEFRIMAENAAGISAPSPTSPFYKACDTVFKPGPPGNPRVLDTSRSSISIAWNKPIYDGGSEITGYMVEIALPEEDEWQIVTPPAGLKATSYTITGLTENQEYKIRIYAMNSEGLGEPALVPGTPKAEDRMLPPEIELDADLRKVVTIRACCTLRLFVPIKGRPAPEVKWARDHGESLDKASIESTSSYTLLIVGNVNRFDSGKYILTVENSSGSKSAFVNVRVLDTPGPPQDLKVKEVTKTSVTLTWDPPLLDGGSKIKNYIVEKRESTRKAYSTVATNCHKTSWKVDQLQEGCSYYFRVLAENEYGIGLPAETAESVKASERPLPPGKITLMDVTRNSVSLSWEKPEHDGGSRILGYIVEMQTKGSDKWATCATVKVTEATITGLIQGEEYSFRVSAQNEKGISDPRQLSVPVIAKDLVIPPAFKLLFNTFTVLAGEDLKVDVPFIGRPTPAVTWHKDNVPLKQTTRVNAESTENNSLLTIKDACREDVGHYVVKLTNSAGEAIETLNVIVLDKPGPPTGPVKMDEVTADSITLSWGPPKYDGGSSINNYIVEKRDTSTTTWQIVSATVARTTIKACRLKTGCEYQFRIAAENRYGKSTYLNSEPTVAQYPFKVPGPPGTPVVTLSSRDSMEVQWNEPISDGGSRVIGYHLERKERNSILWVKLNKTPIPQTKFKTTGLEEGVEYEFRVSAENIVGIGKPSKVSECYVARDPCDPPGRPEAIIVTRNSVTLQWKKPTYDGGSKITGYIVEKKELPEGRWMKASFTNIIDTHFEVTGLVEDHRYEFRVIARNAAGVFSEPSESTGAITARDEVDPPRISMDPKYKDTIVVHAGESFKVDADIYGKPIPTIQWIKGDQELSNTARLEIKSTDFATSLSVKDAVRVDSGNYILKAKNVAGERSVTVNVKVLDRPGPPEGPVVISGVTAEKCTLAWKPPLQDGGSDIINYIVERRETSRLVWTVVDANVQTLSCKVTKLLEGNEYTFRIMAVNKYGVGEPLESEPVVAKNPFVVPDAPKAPEVTTVTKDSMIVVWERPASDGGSEILGYVLEKRDKEGIRWTRCHKRLIGELRLRVTGLIENHDYEFRVSAENAAGLSEPSPPSAYQKACDPIYKPGPPNNPKVIDITRSSVFLSWSKPIYDGGCEIQGYIVEKCDVSVGEWTMCTPPTGINKTNIEVEKLLEKHEYNFRICAINKAGVGEHADVPGPIIVEEKLEAPDIDLDLELRKIINIRAGGSLRLFVPIKGRPTPEVKWGKVDGEIRDAAIIDVTSSFTSLVLDNVNRYDSGKYTLTLENSSGTKSAFVTVRVLDTPSPPVNLKVTEITKDSVSITWEPPLLDGGSKIKNYIVEKREATRKSYAAVVTNCHKNSWKIDQLQEGCSYYFRVTAENEYGIGLPAQTADPIKVAEVPQPPGKITVDDVTRNSVSLSWTKPEHDGGSKIIQYIVEMQAKHSEKWSECARVKSLQAVITNLTQGEEYLFRVVAVNEKGRSDPRSLAVPIVAKDLVIEPDVKPAFSSYSVQVGQDLKIEVPISGRPKPTITWTKDGLPLKQTTRINVTDSLDLTTLSIKETHKDDGGQYGITVANVVGQKTASIEIVTLDKPDPPKGPVKFDDVSAESITLSWNPPLYTGGCQITNYIVQKRDTTTTVWDVVSATVARTTLKVTKLKTGTEYQFRIFAENRYGQSFALESDPIVAQYPYKEPGPPGTPFATAISKDSMVIQWHEPVNNGGSPVIGYHLERKERNSILWTKVNKTIIHDTQFKAQNLEEGIEYEFRVYAENIVGVGKASKNSECYVARDPCDPPGTPEPIMVKRNEITLQWTKPVYDGGSMITGYIVEKRDLPDGRWMKASFTNVIETQFTVSGLTEDQRYEFRVIAKNAAGAISKPSDSTGPITAKDEVELPRISMDPKFRDTIVVNAGETFRLEADVHGKPLPTIEWLRGDKEIEESARCEIKNTDFKALLIVKDAIRIDGGQYILRASNVAGSKSFPVNVKVLDRPGPPEGPVQVTGVTSEKCSLTWSPPLQDGGSDISHYVVEKRETSRLAWTVVASEVVTNSLKVTKLLEGNEYVFRIMAVNKYGVGEPLESAPVLMKNPFVLPGPPKSLEVTNIAKDSMTVCWNRPDSDGGSEIIGYIVEKRDRSGIRWIKCNKRRITDLRLRVTGLTEDHEYEFRVSAENAAGVGEPSPATVYYKACDPVFKPGPPTNAHIVDTTKNSITLAWGKPIYDGGSEILGYVVEICKADEEEWQIVTPQTGLRVTRFEISKLTEHQEYKIRVCALNKVGLGEATSVPGTVKPEDKLEAPELDLDSELRKGIVVRAGGSARIHIPFKGRPTPEITWSREEGEFTDKVQIEKGVNYTQLSIDNCDRNDAGKYILKLENSSGSKSAFVTVKVLDTPGPPQNLAVKEVRKDSAFLVWEPPIIDGGAKVKNYVIDKRESTRKAYANVSSKCSKTSFKVENLTEGAIYYFRVMAENEFGVGVPVETVDAVKAAEPPSPPGKVTLTDVSQTSASLMWEKPEHDGGSRVLGYVVEMQPKGTEKWSIVAESKVCNAVVTGLSSGQEYQFRVKAYNEKGKSDPRVLGVPVIAKDLTIQPSLKLPFNTYSIQAGEDLKIEIPVIGRPRPNISWVKDGEPLKQTTRVNVEETATSTVLHIKEGNKDDFGKYTVTATNSAGTATENLSVIVLEKPGPPVGPVRFDEVSADFVVISWEPPAYTGGCQISNYIVEKRDTTTTTWHMVSATVARTTIKITKLKTGTEYQFRIFAENRYGKSAPLDSKAVIVQYPFKEPGPPGTPFVTSISKDQMLVQWHEPVNDGGTKIIGYHLEQKEKNSILWVKLNKTPIQDTKFKTTGLDEGLEYEFKVSAENIVGIGKPSKVSECFVARDPCDPPGRPEAIVITRNNVTLKWKKPAYDGGSKITGYIVEKKDLPDGRWMKASFTNVLETEFTVSGLVEDQRYEFRVIARNAAGNFSEPSDSSGAITARDEIDAPNASLDPKYKDVIVVHAGETFVLEADIRGKPIPDVVWSKDGKELEETAARMEIKSTIQKTTLVVKDCIRTDGGQYILKLSNVGGTKSIPITVKVLDRPGPPEGPLKVTGVTAEKCYLAWNPPLQDGGANISHYIIEKRETSRLSWTQVSTEVQALNYKVTKLLPGNEYIFRVMAVNKYGIGEPLESGPVTACNPYKPPGPPSTPEVSAITKDSMVVTWARPVDDGGTEIEGYILEKRDKEGVRWTKCNKKTLTDLRLRVTGLTEGHSYEFRVAAENAAGVGEPSEPSVFYRACDALYPPGPPSNPKVTDTSRSSVSLAWSKPIYDGGAPVKGYVVEVKEAAADEWTTCTPPTGLQGKQFTVTKLKENTEYNFRICAINSEGVGEPATLPGSVVAQERIEPPEIELDADLRKVVVLRASATLRLFVTIKGRPEPEVKWEKAEGILTDRAQIEVTSSFTMLVIDNVTRFDSGRYNLTLENNSGSKTAFVNVRVLDSPSAPVNLTIREVKKDSVTLSWEPPLIDGGAKITNYIVEKRETTRKAYATITNNCTKTTFRIENLQEGCSYYFRVLASNEYGIGLPAETTEPVKVSEPPLPPGRVTLVDVTRNTATIKWEKPESDGGSKITGYVVEMQTKGSEKWSTCTQVKTLEATISGLTAGEEYVFRVAAVNEKGRSDPRQLGVPVIARDIEIKPSVELPFHTFNVKAREQLKIDVPFKGRPQATVNWRKDGQTLKETTRVNVSSSKTVTSLSIKEASKEDVGTYELCVSNSAGSITVPITIIVLDRPGPPGPIRIDEVSCDSITISWNPPEYDGGCQISNYIVEKKETTSTTWHIVSQAVARTSIKIVRLTTGSEYQFRVCAENRYGKSSYSESSAVVAEYPFSPPGPPGTPKVVHATKSTMLVTWQVPVNDGGSRVIGYHLEYKERSSILWSKANKILIADTQMKVSGLDEGLMYEYRVYAENIAGIGKCSKSCEPVPARDPCDPPGQPEVTNITRKSVSLKWSKPHYDGGAKITGYIVERRELPDGRWLKCNYTNIQETYFEVTELTEDQRYEFRVFARNAADSVSEPSESTGPIIVKDDVEPPRVMMDVKFRDVIVVKAGEVLKINADIAGRPLPVISWAKDGIEIEERARTEIISTDNHTLLTVKDCIRRDTGQYVLTLKNVAGTRSVAVNCKVLDKPGPPAGPLEINGLTAEKCSLSWGRPQEDGGADIDYYIVEKRETSHLAWTICEGELQMTSCKVTKLLKGNEYIFRVTGVNKYGVGEPLESVAIKALDPFTVPSPPTSLEITSVTKESMTLCWSRPESDGGSEISGYIIERREKNSLRWVRVNKKPVYDLRVKSTGLREGCEYEYRVYAENAAGLSLPSETSPLIRAEDPVFLPSPPSKPKIVDSGKTTITIAWVKPLFDGGAPITGYTVEYKKSDDTDWKTSIQSLRGTEYTISGLTTGAEYVFRVKSVNKVGASDPSDSSDPQIAKEREEEPLFDIDSEMRKTLIVKAGASFTMTVPFRGRPVPNVLWSKPDTDLRTRAYVDTTDSRTSLTIENANRNDSGKYTLTIQNVLSAASLTLVVKVLDTPGPPTNITVQDVTKESAVLSWDVPENDGGAPVKNYHIEKREASKKAWVSVTNNCNRLSYKVTNLQEGAIYYFRVSGENEFGVGIPAETKEGVKITEKPSPPEKLGVTSISKDSVSLTWLKPEHDGGSRIVHYVVEALEKGQKNWVKCAVAKSTHHVVSGLRENSEYFFRVFAENQAGLSDPRELLLPVLIKEQLEPPEIDMKNFPSHTVYVRAGSNLKVDIPISGKPLPKVTLSRDGVPLKATMRFNTEITAENLTINLKESVTADAGRYEITAANSSGTTKAFINIVVLDRPGPPTGPVVISDITEESVTLKWEPPKYDGGSQVTNYILLKRETSTAVWTEVSATVARTMMKVMKLTTGEEYQFRIKAENRFGISDHIDSACVTVKLPYTTPGPPSTPWVTNVTRESITVGWHEPVSNGGSAVVGYHLEMKDRNSILWQKANKLVIRTTHFKVTTISAGLIYEFRVYAENAAGVGKPSHPSEPVLAIDACEPPRNVRITDISKNSVSLSWQQPAFDGGSKITGYIVERRDLPDGRWTKASFTNVTETQFIISGLTQNSQYEFRVFARNAVGSISNPSEVVGPITCIDSYGGPVIDLPLEYTEVVKYRAGTSVKLRAGISGKPAPTIEWYKDDKELQTNALVCVENTTDLASILIKDADRLNSGCYELKLRNAMGSASATIRVQILDKPGPPGGPIEFKTVTAEKITLLWRPPADDGGAKITHYIVEKRETSRVVWSMVSEHLEECIITTTKIIKGNEYIFRVRAVNKYGIGEPLESDSVVAKNAFVTPGPPGIPEVTKITKNSMTVVWSRPIADGGSDISGYFLEKRDKKSLGWFKVLKETIRDTRQKVTGLTENSDYQYRVCAVNAAGQGPFSEPSEFYKAADPIDPPGPPAKIRIADSTKSSITLGWSKPVYDGGSAVTGYVVEIRQGEEEEWTTVSTKGEVRTTEYVVSNLKPGVNYYFRVSAVNCAGQGEPIEMNEPVQAKDILEAPEIDLDVALRTSVIAKAGEDVQVLIPFKGRPPPTVTWRKDEKNLGSDARYSIENTDSSSLLTIPQVTRNDTGKYILTIENGVGEPKSSTVSVKVLDTPAACQKLQVKHVSRGTVTLLWDPPLIDGGSPIINYVIEKRDATKRTWSVVSHKCSSTSFKLIDLSEKTPFFFRVLAENEIGIGEPCETTEPVKAAEVPAPIRDLSMKDSTKTSVILSWTKPDFDGGSVITEYVVERKGKGEQTWSHAGISKTCEIEVSQLKEQSVLEFRVFAKNEKGLSDPVTIGPITVKELIITPEVDLSDIPGAQVTVRIGHNVHLELPYKGKPKPSISWLKDGLPLKESEFVRFSKTENKITLSIKNAKKEHGGKYTVILDNAVCRIAVPITVITLGPPSKPKGPIRFDEIKADSVILSWDVPEDNGGGEITCYSIEKRETSQTNWKMVCSSVARTTFKVPNLVKDAEYQFRVRAENRYGVSQPLVSSIIVAKHQFRIPGPPGKPVIYNVTSDGMSLTWDAPVYDGGSEVTGFHVEKKERNSILWQKVNTSPISGREYRATGLVEGLDYQFRVYAENSAGLSSPSDPSKFTLAVSPVDPPGTPDYIDVTRETITLKWNPPLRDGGSKIVGYSIEKRQGNERWVRCNFTDVSECQYTVTGLSPGDRYEFRIIARNAVGTISPPSQSSGIIMTRDENVPPIVEFGPEYFDGLIIKSGESLRIKALVQGRPVPRVTWFKDGVEIEKRMNMEITDVLGSTSLFVRDATRDHRGVYTVEAKNASGSAKAEIKVKVQDTPGKVVGPIRFTNITGEKMTLWWDAPLNDGCAPITHYIIEKRETSRLAWALIEDKCEAQSYTAIKLINGNEYQFRVSAVNKFGVGRPLDSDPVVAQIQYTVPDAPGIPEPSNITGNSITLTWARPESDGGSEIQQYILERREKKSTRWVKVISKRPISETRFKVTGLTEGNEYEFHVMAENAAGVGPASGISRLIKCREPVNPPGPPTVVKVTDTSKTTVSLEWSKPVFDGGMEIIGYIIEMCKADLGDWHKVNAEACVKTRYTVTDLQAGEEYKFRVSAINGAGKGDSCEVTGTIKAVDRLTAPELDIDANFKQTHVVRAGASIRLFIAYQGRPTPTAVWSKPDSNLSLRADIHTTDSFSTLTVENCNRNDAGKYTLTVENNSGSKSITFTVKVLDTPGPPGPITFKDVTRGSATLMWDAPLLDGGARIHHYVVEKREASRRSWQVISEKCTRQIFKVNDLAEGVPYYFRVSAVNEYGVGEPYEMPEPIVATEQPAPPRRLDVVDTSKSSAVLAWLKPDHDGGSRITGYLLEMRQKGSDFWVEAGHTKQLTFTVERLVEKTEYEFRVKAKNDAGYSEPREAFSSVIIKEPQIEPTADLTGITNQLITCKAGSPFTIDVPISGRPAPKVTWKLEEMRLKETDRVSITTTKDRTTLTVKDSMRGDSGRYFLTLENTAGVKTFSVTVVVIGRPGPVTGPIEVSSVSAESCVLSWGEPKDGGGTEITNYIVEKRESGTTAWQLVNSSVKRTQIKVTHLTKYMEYSFRVSSENRFGVSKPLESAPIIAEHPFVPPSAPTRPEVYHVSANAMSIRWEEPYHDGGSKIIGYWVEKKERNTILWVKENKVPCLECNYKVTGLVEGLEYQFRTYALNAAGVSKASEASRPIMAQNPVDAPGRPEVTDVTRSTVSLIWSAPAYDGGSKVVGYIIERKPVSEVGDGRWLKCNYTIVSDNFFTVTALSEGDTYEFRVLAKNAAGVISKGSESTGPVTCRDEYAPPKAELDARLHGDLVTIRAGSDLVLDAAVGGKPEPKIIWTKGDKELDLCEKVSLQYTGKRATAVIKFCDRSDSGKYTLTVKNASGTKAVSVMVKVLDSPGPCGKLTVSRVTQEKCTLAWSLPQEDGGAEITHYIVERRETSRLNWVIVEGECPTLSYVVTRLIKNNEYIFRVRAVNKYGPGVPVESEPIVARNSFTIPSPPGIPEEVGTGKEHIIIQWTKPESDGGNEISNYLVDKREKKSLRWTRVNKDYVVYDTRLKVTSLMEGCDYQFRVTAVNAAGNSEPSEASNFISCREPSYTPGPPSAPRVVDTTKHSISLAWTKPMYDGGTDIVGYVLEMQEKDTDQWYRVHTNATIRNTEFTVPDLKMGQKYSFRVAAVNVKGMSEYSESIAEIEPVERIEIPDLELADDLKKTVTIRAGASLRLMVSVSGRPPPVITWSKQGIDLASRAIIDTTESYSLLIVDKVNRYDAGKYTIEAENQSGKKSATVLVKVYDTPGPCPSVKVKEVSRDSVTITWEIPTIDGGAPVNNYIVEKREAAMRAFKTVTTKCSKTLYRISGLVEGTMYYFRVLPENIYGIGEPCETSDAVLVSEVPLVPAKLEVVDVTKSTVTLAWEKPLYDGGSRLTGYVLEACKAGTERWMKVVTLKPTVLEHTVTSLNEGEQYLFRIRAQNEKGVSEPRETVTAVTVQDLRVLPTIDLSTMPQKTIHVPAGRPVELVIPIAGRPPPAASWFFAGSKLRESERVTVETHTKVAKLTIRETTIRDTGEYTLELKNVTGTTSETIKVIILDKPGPPTGPIKIDEIDATSITISWEPPELDGGAPLSGYVVEQRDAHRPGWLPVSESVTRSTFKFTRLTEGNEYVFRVAATNRFGIGSYLQSEVIECRSSIRIPGPPETLQIFDVSRDGMTLTWYPPEDDGGSQVTGYIVERKEVRADRWVRVNKVPVTMTRYRSTGLTEGLEYEHRVTAINARGSGKPSRPSKPIVAMDPIAPPGKPQNPRVTDTTRTSVSLAWSVPEDEGGSKVTGYLIEMQKVDQHEWTKCNTTPTKIREYTLTHLPQGAEYRFRVLACNAGGPGEPAEVPGTVKVTEMLEYPDYELDERYQEGIFVRQGGVIRLTIPIKGKPFPICKWTKEGQDISKRAMIATSETHTELVIKEADRGDSGTYDLVLENKCGKKAVYIKVRVIGSPNSPEGPLEYDDIQVRSVRVSWRPPADDGGADILGYILERREVPKAAWYTIDSRVRGTSLVVKGLKENVEYHFRVSAENQFGISKPLKSEEPVTPKTPLNPPEPPSNPPEVLDVTKSSVSLSWSRPKDDGGSRVTGYYIERKETSTDKWVRHNKTQITTTMYTVTGLVPDAEYQFRIIAQNDVGLSETSPASEPVVCKDPFDKPSQPGELEILSISKDSVTLQWEKPECDGGKEILGYWVEYRQSGDSAWKKSNKERIKDKQFTIGGLLEATEYEFRVFAENETGLSRPRRTAMSIKTKLTSGEAPGIRKEMKDVTTKLGEAAQLSCQIVGRPLPDIKWYRFGKELIQSRKYKMSSDGRTHTLTVMTEEQEDEGVYTCIATNEVGEVETSSKLLLQATPQFHPGYPLKEKYYGAVGSTLRLHVMYIGRPVPAMTWFHGQKLLQNSENITIENTEHYTHLVMKNVQRKTHAGKYKVQLSNVFGTVDAILDVEIQDKPDKPTGPIVIEALLKNSAVISWKPPADDGGSWITNYVVEKCEAKEGAEWQLVSSAISVTTCRIVNLTENAGYYFRVSAQNTFGISDPLEVSSVVIIKSPFEKPGAPGKPTITAVTKDSCVVAWKPPASDGGAKIRNYYLEKREKKQNKWISVTTEEIRETVFSVKNLIEGLEYEFRVKCENLGGESEWSEISEPITPKSDVPIQAPHFKEELRNLNVRYQSNATLVCKVTGHPKPIVKWYRQGKEIIADGLKYRIQEFKGGYHQLIIASVTDDDATVYQVRATNQGGSVSGTASLEVEVPAKIHLPKTLEGMGAVHALRGEVVSIKIPFSGKPDPVITWQKGQDLIDNNGHYQVIVTRSFTSLVFPNGVERKDAGFYVVCAKNRFGIDQKTVELDVADVPDPPRGVKVSDVSRDSVNLTWTEPASDGGSKITNYIVEKCATTAERWLRVGQARETRYTVINLFGKTSYQFRVIAENKFGLSKPSEPSEPTITKEDKTRAMNYDEEVDETREVSMTKASHSSTKELYEKYMIAEDLGRGEFGIVHRCVETSSKKTYMAKFVKVKGTDQVLVKKEISILNIARHRNILHLHESFESMEELVMIFEFISGLDIFERINTSAFELNEREIVSYVHQVCEALQFLHSHNIGHFDIRPENIIYQTRRSSTIKIIEFGQARQLKPGDNFRLLFTAPEYYAPEVHQHDVVSTATDMWSLGTLVYVLLSGINPFLAETNQQIIENIMNAEYTFDEEAFKEISIEAMDFVDRLLVKERKSRMTASEALQHPWLKQKIERVSTKVIRTLKHRRYYHTLIKKDLNMVVSAARISCGGAIRSQKGVSVAKVKVASIEIGPVSGQIMHAVGEEGGHVKYVCKIENYDQSTQVTWYFGVRQLENSEKYEITYEDGVAILYVKDITKLDDGTYRCKVVNDYGEDSSYAELFVKGVREVYDYYCRRTMKKIKRRTDTMRLLERPPEFTLPLYNKTAYVGENVRFGVTITVHPEPHVTWYKSGQKIKPGDNDKKYTFESDKGLYQLTINSVTTDDDAEYTVVARNKYGEDSCKAKLTVTLHPPPTDSTLRPMFKRLLANAECQEGQSVCFEIRVSGIPPPTLKWEKDGQPLSLGPNIEIIHEGLDYYALHIRDTLPEDTGYYRVTATNTAGSTSCQAHLQVERLRYKKQEFKSKEEHERHVQKQIDKTLRMAEILSGTESVPLTQVAKEALREAAVLYKPAVSTKTVKGEFRLEIEEKKEERKLRMPYDVPEPRKYKQTTIEEDQRIKQFVPMSDMKWYKKIRDQYEMPGKLDRVVQKRPKRIRLSRWEQFYVMPLPRITDQYRPKWRIPKLSQDDLEIVRPARRRTPSPDYDFYYRPRRRSLGDISDEELLLPIDDYLAMKRTEEERLRLEEELELGFSASPPSRSPPHFELSSLRYSSPQAHVKVEETRKDFRYSTYHIPTKAEASTSYAELRERHAQAAYRQPKQRQRIMAEREDEELLRPVTTTQHLSEYKSELDFMSKEEKSRKKSRRQREVTEITEIEEEYEISKHAQRESSSSASRLLRRRRSLSPTYIELMRPVSELIRSRPQPAEEYEDDTERRSPTPERTRPRSPSPVSSERSLSRFERSARFDIFSRYESMKAALKTQKTSERKYEVLSQQPFTLDHAPRITLRMRSHRVPCGQNTRFILNVQSKPTAEVKWYHNGVELQESSKIHYTNTSGVLTLEILDCHTDDSGTYRAVCTNYKGEASDYATLDVTGGDYTTYASQRRDEEVPRSVFPELTRTEAYAVSSFKKTSEMEASSSVREVKSQMTETRESLSSYEHSASAEMKSAALEEKSLEEKSTTRKIKTTLAARILTKPRSMTVYEGESARFSCDTDGEPVPTVTWLRKGQVLSTSARHQVTTTKYKSTFEISSVQASDEGNYSVVVENSEGKQEAEFTLTIQKARVTEKAVTSPPRVKSPEPRVKSPEAVKSPKRVKSPEPSHPKAVSPTETKPTPTEKVQHLPVSAPPKITQFLKAEASKEIAKLTCVVESSVLRAKEVTWYKDGKKLKENGHFQFHYSADGTYELKINNLTESDQGEYVCEISGEGGTSKTNLQFMGQAFKSIHEKVSKISETKKSDQKTTESTVTRKTEPKAPEPISSKPVIVTGLQDTTVSSDSVAKFAVKATGEPRPTAIWTKDGKAITQGGKYKLSEDKGGFFLEIHKTDTSDSGLYTCTVKNSAGSVSSSCKLTIKAIKDTEAQKVSTQKTSEITPQKKAVVQEEISQKALRSEEIKMSEAKSQEKLALKEEASKVLISEEVKKSAATSLEKSIVHEEITKTSQASEEVRTHAEIKAFSTQMSINEGQRLVLKANIAGATDVKWVLNGVELTNSEEYRYGVSGSDQTLTIKQASHRDEGILTCISKTKEGIVKCQYDLTLSKELSDAPAFISQPRSQNINEGQNVLFTCEISGEPSPEIEWFKNNLPISISSNVSISRSRNVYSLEIRNASVSDSGKYTIKAKNFRGQCSATASLMVLPLVEEPSREVVLRTSGDTSLQGSFSSQSVQMSASKQEASFSSFSSSSASSMTEMKFASMSAQSMSSMQESFVEMSSSSFMGISNMTQLESSTSKMLKAGIRGIPPKIEALPSDISIDEGKVLTVACAFTGEPTPEVTWSCGGRKIHSQEQGRFHIENTDDLTTLIIMDVQKQDGGLYTLSLGNEFGSDSATVNIHIRSI
"
     misc_feature    241..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    262..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    535..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    556..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    1753..1872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    1879..2004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2017..2142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2914..3183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2965..3168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3331..3600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3382..3597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3964..4230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4009..4215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4456..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4495..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    4753..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4774..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <5251..5469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    5608..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    5626..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6319..6591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6370..6579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    6610..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6628..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    6889..7143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6907..>7095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <7249..>7374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    7426..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7441..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7687..7938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7951..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7969..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8209..8463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8473..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8488..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    8734..8985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8752..8988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8998..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9013..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    9262..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9280..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <9622..9786
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9844..10065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9871..10062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10120..10380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10141..10383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    10594..10863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10645..10854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10948..11220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11014..11211
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    12952..13218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    <13036..13218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    13234..13503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13285..13494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14080..14355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14140..14346
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14413..14604
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    14671..>14865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    14932..15177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15196..15444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15457..15708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15475..15708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15721..15972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15751..15972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    15988..16239
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16012..16239
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16273..16497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16522..16773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16807..>17001
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    17056..17307
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17329..17574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17341..17574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    17590..17841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17614..17850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of semaphorin;
                     Region: Ig_Semaphorin_C; cd04979"
                     /db_xref="CDD:143180"
     misc_feature    order(17635..17637,17764..17766)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143180"
     misc_feature    17917..18075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    18145..18339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18391..18642
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18406..18642
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18655..18921
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18673..18921
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    18937..19188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18955..19188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19204..19455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19222..19455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    19471..>19680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19753..19992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19780..19992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    20002..20268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20002..20004,20197..20199,20245..20247)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20248..20253,20257..20262)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20305..20583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20305..20307,20503..20505,20548..20550)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20551..20556,20560..20565)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20608..20889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20608..20610,20806..20808,20851..20853)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20854..20859,20863..20868)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20950..21186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20965..21186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    21196..21453
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21196..21198,21391..21393,21436..21438)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21439..21444,21448..21453)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21496..21765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21496..21498,21691..21693,21736..21738)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21739..21744,21748..21753)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21832..22074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21853..22074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    22084..22362
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22084..22086,22279..22281,22324..22326)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22327..22332,22336..22341)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22381..22653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22381..22383,22579..22581,22624..22626)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22627..22632,22636..22641)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22705..22953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22879..22881,22924..22926)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22927..22932,22936..22941)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22984..23253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22984..22986,23179..23181,23224..23226)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23227..23232,23236..23241)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23284..23559
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23284..23286,23482..23484,23527..23529)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23530..23535,23539..23544)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23608..23862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23788..23790,23833..23835)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23836..23841,23845..23850)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23893..24162
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23941..24162
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    24172..24432
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24172..24174,24367..24369,24412..24414)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24415..24420,24424..24429)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24508..24750
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24670..24672,24715..24717)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24718..24723,24727..24732)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24793..25128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24829..25128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    25138..25422
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25138..25140,25339..25341,25384..25386)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25387..25392,25396..25401)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25441..25719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25441..25443,25636..25638,25681..25683)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25684..25689,25693..25698)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25759..26019
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25936..25938,25981..25983)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25984..25989,25993..25998)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26095..26313
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    26323..26592
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26323..26325,26515..26517,26560..26562)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26563..26568,26572..26577)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26617..26895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26617..26619,26815..26817,26860..26862)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26863..26868,26872..26877)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26977..27216
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    27226..27507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27226..27228,27427..27429,27472..27474)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27475..27480,27484..27489)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27529..27816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27529..27531,27742..27744,27787..27789)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27790..27795,27799..27804)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27847..28122
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27847..27849,28051..28053,28096..28098)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28099..28104,28108..28113)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28213..28458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    28468..28746
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28468..28470,28663..28665,28708..28710)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28711..28716,28720..28725)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28768..29064
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28768..28770,28981..28983,29026..29028)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29029..29034,29038..29043)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29110..29373
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    29383..29664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29383..29385,29581..29583,29626..29628)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29629..29634,29638..29643)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29683..29976
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29683..29685,29893..29895,29938..29940)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29941..29946,29950..29955)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29995..30273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29995..29997,30193..30195,30238..30240)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30241..30246,30250..30255)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30355..30570
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    30580..30855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30580..30582,30778..30780,30823..30825)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30826..30831,30835..30840)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30883..31164
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30883..30885,31081..31083,31126..31128)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31129..31134,31138..31143)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31258..31446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    31492..31749
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(31666..31668,31711..31713)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31714..31719,31723..31728)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31768..32037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(31768..31770,31966..31968,32011..32013)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32014..32019,32023..32028)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32071..32337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32071..32073,32275..32277,32320..32322)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32323..32328,32332..32337)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32437..32652
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    32662..32925
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32662..32664,32857..32859,32902..32904)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32905..32910,32914..32919)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32962..33231
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32962..32964,33154..33156,33199..33201)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33202..33207,33211..33216)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33292..33534
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    33313..33534
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    33544..33825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33544..33546,33742..33744,33787..33789)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33790..33795,33799..33804)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33844..34119
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33844..33846,34039..34041,34084..34086)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34087..34092,34096..34101)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34168..34419
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34345..34347,34390..34392)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34393..34398,34402..34407)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34507..34728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    34738..35010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34738..34740,34930..34932,34975..34977)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34978..34983,34987..34992)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35035..35316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35035..35037,35233..35235,35278..35280)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35281..35286,35290..35295)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35335..35613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    35386..35613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    35623..35901
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35623..35625,35818..35820,35863..35865)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35866..35871,35875..35880)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35920..36201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35920..35922,36118..36120,36163..36165)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36166..36171,36175..36180)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36223..36519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36223..36225,36439..36441,36484..36486)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36487..36492,36496..36501)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36601..36819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    36829..37089
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36829..36831,37024..37026,37069..37071)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37072..37077,37081..37086)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37129..37407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37129..37131,37327..37329,37372..37374)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37375..37380,37384..37389)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37447..37698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37477..37698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    37708..37974
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37708..37710,37906..37908,37951..37953)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37954..37959,37963..37968)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38008..38289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38008..38010,38206..38208,38251..38253)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38254..38259,38263..38268)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38305..38589
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38506..38508,38551..38553)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38554..38559,38563..38568)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38647..38889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38668..38889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    38899..39177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38899..38901,39094..39096,39139..39141)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39142..39147,39151..39156)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39196..39465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39196..39198,39394..39396,39439..39441)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39442..39447,39451..39456)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39499..39765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39499..39501,39700..39702,39745..39747)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39748..39753,39757..39762)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39835..40083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39862..40083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    40093..40368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40093..40095,40288..40290,40333..40335)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40336..40341,40345..40350)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40384..40650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40384..40386,40573..40575,40618..40620)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40621..40626,40630..40635)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40729..40950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    40960..41241
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40960..40962,41158..41160,41203..41205)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41206..41211,41215..41220)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41302..41541
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41458..41460,41503..41505)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41506..41511,41515..41520)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41557..41835
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41752..41754,41797..41799)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41803..41808,41812..41817)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41935..42141
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    42151..42426
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42151..42153,42346..42348,42391..42393)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42394..42399,42403..42408)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42448..42720
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42448..42450,42646..42648,42691..42693)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42694..42699,42703..42708)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42751..43014
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42751..42753,42952..42954,42997..42999)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43000..43005,43009..43014)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43084..43326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    43111..43326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    43336..43605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43336..43338,43531..43533,43576..43578)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43579..43584,43588..43593)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43627..43902
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43627..43629,43819..43821,43864..43866)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43867..43872,43876..43881)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43978..44202
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    44209..44490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44209..44211,44407..44409,44452..44454)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44455..44460,44464..44469)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44509..44781
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44509..44511,44707..44709,44752..44754)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44755..44760,44764..44769)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44806..45087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45001..45003,45046..45048)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45052..45057,45061..45066)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45118..45387
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    45169..45387
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    45397..45672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45397..45399,45595..45597,45640..45642)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45643..45648,45652..45657)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45718..45975
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45895..45897,45940..45942)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45943..45948,45952..45957)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46000..46263
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46000..46002,46201..46203,46246..46248)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46249..46254,46258..46263)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46336..46578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    46363..46578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    46588..46857
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46588..46590,46783..46785,46828..46830)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46831..46836,46840..46845)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46879..47130
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46879..46881,47071..47073,47116..47118)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47119..47124,47128..47130)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47176..47445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    47224..47445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    47455..47736
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47455..47457,47653..47655,47698..47700)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47701..47706,47710..47715)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47791..48036
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47953..47955,47998..48000)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48001..48006,48010..48015)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48052..48333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48247..48249,48292..48294)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48295..48297,48301..48303,48307..48312)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48391..48633
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    48412..48633
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    48643..48924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48643..48645,48841..48843,48886..48888)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48889..48894,48898..48903)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48943..49212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48943..48945,49141..49143,49186..49188)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49189..49194,49198..49203)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49246..49512
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49246..49248,49447..49449,49492..49494)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49495..49500,49504..49509)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49609..49824
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    49834..50109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49834..49836,50029..50031,50074..50076)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50077..50082,50086..50091)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50125..50376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50125..50127,50317..50319,50362..50364)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50365..50370,50374..50376)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50455..50682
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    50470..50685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    50701..50982
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50701..50703,50899..50901,50944..50946)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50947..50952,50956..50961)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51001..51282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51001..51003,51199..51201,51244..51246)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51247..51252,51256..51261)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51298..51579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51493..51495,51538..51540)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51544..51549,51553..51558)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51619..51879
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    51658..51879
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    51889..52164
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51889..51891,52087..52089,52132..52134)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52135..52140,52144..52149)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52189..52467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52189..52191,52387..52389,52432..52434)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52435..52440,52444..52449)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52492..52758
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52492..52494,52693..52695,52738..52740)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52741..52746,52750..52755)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52828..53070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    52861..53070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    53080..53355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53080..53082,53275..53277,53320..53322)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53323..53328,53332..53337)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53371..53622
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53371..53373,53563..53565,53608..53610)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53611..53616,53620..53622)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53701..53937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    53716..53937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    53947..54228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53947..53949,54145..54147,54190..54192)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54193..54198,54202..54207)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54247..54522
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54247..54249,54445..54447,54490..54492)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54493..54498,54502..54507)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54544..54825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54739..54741,54784..54786)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54787..54789,54793..54795,54799..54804)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54904..55128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    55138..55419
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55138..55140,55336..55338,55381..55383)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55384..55389,55393..55398)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55438..55716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55438..55440,55636..55638,55681..55683)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55684..55689,55693..55698)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55741..56007
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55741..55743,55942..55944,55987..55989)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55990..55995,55999..56004)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56077..56319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    56104..56319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    56329..56598
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56329..56331,56524..56526,56569..56571)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56572..56577,56581..56586)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56620..56871
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56620..56622,56812..56814,56857..56859)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56860..56865,56869..56871)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56917..57186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    56965..57186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    57196..57441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57196..57198,57391..57393,57436..57438)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    57514..57765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57691..57693,57736..57738)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57739..57744,57748..57753)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57790..58059
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57985..57987,58033..58035)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58036..58041,58045..58050)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58150..58371
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    58381..58662
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58381..58383,58579..58581,58624..58626)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58627..58632,58636..58641)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58681..58959
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58681..58683,58879..58881,58924..58926)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58927..58932,58936..58941)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58984..59259
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58984..58986,59179..59181,59224..59226)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59227..59232,59236..59241)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59314..59556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    59341..59556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    59566..59841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59566..59568,59761..59763,59806..59808)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59809..59814,59818..59823)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59857..60108
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59857..59859,60049..60051,60094..60096)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60097..60102,60106..60108)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60178..60432
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    60211..60432
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    60442..60723
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60442..60444,60640..60642,60685..60687)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60688..60693,60697..60702)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60742..61014
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60742..60744,60940..60942,60985..60987)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60988..60993,60997..61002)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61039..61320
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61234..61236,61279..61281)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61285..61290,61294..61299)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61342..61620
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    61399..61620
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    61630..61911
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61630..61632,61828..61830,61873..61875)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61876..61881,61885..61890)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61930..62208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61930..61932,62128..62130,62173..62175)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62176..62181,62185..62190)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62254..62499
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62434..62436,62479..62481)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62482..62487,62491..62496)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62569..62820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    62596..62820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    62830..63099
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62830..62832,63025..63027,63070..63072)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63073..63078,63082..63087)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63121..63396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63121..63123,63313..63315,63358..63360)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63361..63366,63370..63375)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63472..63654
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    63703..63984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63703..63705,63901..63903,63946..63948)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63949..63954,63958..63963)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64003..64281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64003..64005,64201..64203,64246..64248)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64249..64254,64258..64263)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64300..64575
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64492..64494,64537..64539)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64540..64542,64546..64548,64552..64557)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64657..64878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    64909..65169
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65086..65088,65131..65133)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65134..65139,65143..65148)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65188..65451
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65188..65190,65389..65391,65434..65436)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65437..65442,65446..65451)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65494..65763
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65494..65496,65692..65694,65737..65739)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65740..65745,65749..65754)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65854..66069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66079..66333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66079..66081,66274..66276,66319..66321)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66322..66327,66331..66333)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66370..66636
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66370..66372,66562..66564,66607..66609)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66610..66615,66619..66624)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66724..66945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66955..67236
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66955..66957,67153..67155,67198..67200)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67201..67206,67210..67215)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67255..67533
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67255..67257,67453..67455,67498..67500)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67501..67506,67510..67515)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67552..67842
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67756..67758,67801..67803)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67804..67806,67810..67812,67816..67821)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67924..68145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    68155..68433
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68155..68157,68350..68352,68395..68397)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68398..68403,68407..68412)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68452..68736
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68452..68454,68653..68655,68698..68700)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68701..68706,68710..68715)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68758..69030
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68758..68760,68959..68961,69004..69006)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69007..69012,69016..69021)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69094..69336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69121..69336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    69346..69621
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69346..69348,69541..69543,69586..69588)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69589..69594,69598..69603)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69637..69918
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69637..69639,69835..69837,69880..69882)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69883..69888,69892..69897)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69970..70218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69997..70218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    70228..70503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70228..70230,70426..70428,70471..70473)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70474..70479,70483..70488)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70528..70797
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70528..70530,70726..70728,70771..70773)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70774..70779,70783..70788)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70831..71067
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70831..70833,71029..71031)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    71191..71406
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    71416..71688
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71416..71418,71614..71616,71659..71661)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71662..71667,71671..71676)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71752..72003
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71920..71922,71965..71967)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71968..71973,71977..71982)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72025..72282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72025..72027,72223..72225,72268..72270)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72271..72276,72280..72282)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72331..72594
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    72382..72585
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    72667..72885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    72901..73182
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72901..72903,73102..73104,73147..73149)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73150..73155,73159..73164)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73207..73488
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73207..73209,73405..73407,73450..73452)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73453..73458,73462..73467)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73516..73791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    73567..73782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    73864..74088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    74098..74370
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74098..74100,74290..74292,74335..74337)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74338..74343,74347..74352)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74485..75249
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    74503..75243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(74503..74517,74527..74529,74566..74568,74572..74574,
                     74656..74658,74704..74715,74725..74727,74731..74733,
                     74845..74847,74851..74853,74857..74862,74866..74868,
                     74905..74907,74914..74916,74959..74970)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(74503..74517,74527..74529,74566..74568,74572..74574,
                     74656..74658,74704..74715,74725..74727,74845..74847,
                     74851..74853,74857..74862,74866..74868,74905..74907)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(74515..74517,74725..74727,74731..74733,74845..74847,
                     74851..74853,74857..74859,74914..74916,74959..74970)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(74902..74922,74959..74970)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    75487..75699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    75802..76080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    75826..76080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    76117..76389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76153..76389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    77854..78123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    77875..78123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    78406..78681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="M5, fifth immunoglobulin (Ig)-like domain of human
                     titin C terminus and similar proteins; Region:
                     Ig5_Titin_like; cd05747"
                     /db_xref="CDD:143224"
     misc_feature    78418..78684
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78886..79140
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78931..79149
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    79288..79557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79309..79557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    79867..80109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    80134..80403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    80152..80403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    80719..80994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    80788..80994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            317..520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647842"
     exon            521..808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647843"
     exon            809..894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647844"
     exon            895..1139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647845"
     variation       1228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647846"
     exon            1471..1623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1624..1761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34337578"
     variation       1717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647851"
     exon            1762..1887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1888..2025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2160
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72647860"
     exon            2164..2457
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2458..2580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35813871"
     exon            2581..2862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647861"
     variation       2851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647862"
     exon            2863..2928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2929..3187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647865"
     exon            3188..3251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647867"
     variation       3220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647868"
     exon            3252..3467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             3399..3542
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1574E"
                     /db_xref="UniSTS:150658"
     exon            3468..3610
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3496
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647870"
     exon            3611..3816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3817..4050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2291308"
     variation       3971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1552280"
     exon            4051..4295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4071
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72647872"
     exon            4296..4567
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647875"
     variation       4409
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647876"
     exon            4568..4732
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             4622..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="A008T22"
                     /db_xref="UniSTS:24210"
     variation       4717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647877"
     exon            4733..4901
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            4902..6595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       5475
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647878"
     STS             6193..6321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1524E"
                     /db_xref="UniSTS:45880"
     variation       6335
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72647879"
     exon            6596..6877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       6747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647880"
     variation       6860
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647881"
     exon            6878..7144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7145..7417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7418..7681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7682..7942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7943..8203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8204..8467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8468..8728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8676
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647883"
     exon            8729..8989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8774
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647884"
     exon            8990..9250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647885"
     variation       9237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647886"
     exon            9251..9392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9393..9558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647894"
     exon            9559..9790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9791..10075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10076..10201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10202..10390
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10391..10447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10448..13228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       10506
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648918"
     variation       11111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648919"
     variation       11391
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742357"
     variation       11552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648920"
     variation       11694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648921"
     variation       11916
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746578"
     variation       12354
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1883084"
     variation       12398
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648922"
     variation       12936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1883085"
     exon            13229..13507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13508..13588
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13589..13663
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13664..13753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13754..13816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13817..13906
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13907..13957
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13958..14359
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650077"
     variation       14134
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650078"
     exon            14360..14638
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14442
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650079"
     exon            14639..14914
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14915..15054
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15055..15181
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15182..15445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15334
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650080"
     exon            15446..15712
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650081"
     exon            15713..15976
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15977..16116
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             15978..16086
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1881"
                     /db_xref="UniSTS:153573"
     exon            16117..16243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16214
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650084"
     exon            16244..16510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16511..16777
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16778..17044
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16948
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650088"
     exon            17045..17184
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17185..17311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17312..17454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677216"
     exon            17455..17578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17579..17845
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17846..17943
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17944..18112
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677221"
     exon            18113..18379
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18303
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677223"
     exon            18380..18646
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18438
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677225"
     exon            18647..18925
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18768
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303829"
     variation       18790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677226"
     exon            18926..19334
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72677227"
     exon            19335..19459
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19460..19726
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19481
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677229"
     exon            19727..19996
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19997..20299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20221
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677231"
     variation       20278
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677232"
     exon            20300..20602
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20345
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677233"
     exon            20603..20790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677237"
     exon            20791..20905
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20906..21190
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21191..21342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677238"
     exon            21343..21490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21424
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303830"
     exon            21491..21668
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21654
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677240"
     exon            21669..21790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21757
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677242"
     exon            21791..22078
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21983
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677243"
     variation       22026
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677244"
     exon            22079..22375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22376..22562
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22436
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677245"
     exon            22563..22678
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22679..22978
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2115558"
     variation       22788
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677247"
     exon            22979..23278
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23279..23384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23385..23581
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23388
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677249"
     exon            23582..23887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23842
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677250"
     exon            23888..24166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78462639"
     exon            24167..24466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24287
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632860"
     exon            24467..24769
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288566"
     exon            24770..25132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632861"
     exon            25133..25435
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            25436..25735
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            25736..26032
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303831"
     exon            26033..26317
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26126
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646808"
     variation       26153
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2303832"
     variation       26222
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646809"
     exon            26318..26611
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26612..26911
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26912..27220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27030
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646813"
     variation       27219
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303834"
     exon            27221..27411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27412..27841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27842..28150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28151..28299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28169
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646819"
     exon            28300..28332
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28333..28462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646822"
     exon            28463..28762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646823"
     exon            28763..29080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29081..29377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29131
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001238"
     STS             29278..29383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1532E"
                     /db_xref="UniSTS:150620"
     exon            29378..29677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29559
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646827"
     exon            29678..29992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             29782..29920
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65766"
                     /db_xref="UniSTS:17479"
     variation       29836
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646828"
     STS             29927..30025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1570E"
                     /db_xref="UniSTS:150654"
     exon            29993..30141
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30142..30292
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30293..30574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30361
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646831"
     variation       30492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646832"
     variation       30494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646833"
     exon            30575..30877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30878..31180
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31181..31462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646837"
     exon            31463..31762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288569"
     variation       31580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646838"
     exon            31763..32065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31963
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303836"
     exon            32066..32374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646839"
     variation       32345
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646840"
     exon            32375..32656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32657..32956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646842"
     exon            32957..33250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560220"
     exon            33251..36217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646843"
     variation       33848
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646844"
     variation       33851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646845"
     variation       34275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2163009"
     variation       34906
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646846"
     variation       35088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560221"
     variation       35208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646847"
     variation       35415
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646848"
     variation       35462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646849"
     variation       36053
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646850"
     variation       36056
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646851"
     variation       36195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646852"
     exon            36218..36538
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646853"
     exon            36539..36823
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646854"
     variation       36619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646855"
     exon            36824..37123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646857"
     exon            37124..37426
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646859"
     variation       37238
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2042996"
     exon            37427..37702
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37703..38002
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646860"
     exon            38003..38305
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38122
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646861"
     exon            38306..38605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38606..38893
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646866"
     variation       38805
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646867"
     exon            38894..39190
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39116
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646868"
     exon            39191..39493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39494..39799
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646869"
     variation       39703
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646870"
     exon            39800..40087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646871"
     variation       40069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303837"
     exon            40088..40378
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40105
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303838"
     variation       40129
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646873"
     STS             40317..40717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_23497-23498:1027358865:1"
                     /db_xref="UniSTS:268713"
     exon            40379..40666
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646876"
     variation       40665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288570"
     exon            40667..41254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646877"
     exon            41255..41359
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41360..41557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41488
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646880"
     exon            41558..41854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41855..42442
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42175
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646881"
     variation       42413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646882"
     exon            42443..42745
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288572"
     variation       42615
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:67041405"
     variation       42680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646884"
     variation       42706
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646885"
     exon            42746..59851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646887"
     variation       43510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646888"
     variation       43681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646889"
     variation       43707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646890"
     variation       43862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646891"
     variation       43894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646892"
     variation       44970
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646893"
     variation       45063
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646894"
     STS             45239..45364
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1571E"
                     /db_xref="UniSTS:150655"
     variation       46057
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646895"
     variation       46250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646896"
     variation       46576
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646897"
     variation       47632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646898"
     variation       47869
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744426"
     variation       47921
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646899"
     variation       48002
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744427"
     variation       48067
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744428"
     variation       48104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731743"
     variation       48650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646900"
     variation       48667
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646901"
     STS             48773..48974
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1580E"
                     /db_xref="UniSTS:150664"
     STS             49096..49196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1593E"
                     /db_xref="UniSTS:150677"
     variation       49373
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813243"
     variation       49443
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646902"
     variation       49729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3813244"
     variation       49750
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813245"
     STS             49935..50275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="TTN-1"
                     /db_xref="UniSTS:254009"
     variation       50309
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813246"
     variation       50943
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648203"
     variation       51093
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648204"
     variation       51776
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010407"
     variation       51922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648205"
     variation       52256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648206"
     variation       52295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731745"
     variation       52656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648207"
     variation       52892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731746"
     variation       52971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648208"
     variation       52974
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648209"
     variation       53503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648210"
     variation       53829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813247"
     variation       54052
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648211"
     variation       54135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648212"
     STS             54796..54922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1550E"
                     /db_xref="UniSTS:150635"
     variation       55515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648213"
     variation       55717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648214"
     variation       55784
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648215"
     variation       55827
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648216"
     variation       56146
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648217"
     variation       56243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648218"
     variation       56353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829746"
     variation       57233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648219"
     variation       57383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648220"
     variation       57670
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648221"
     variation       57849
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648222"
     variation       58233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648223"
     STS             58429..58644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1560E"
                     /db_xref="UniSTS:150645"
     STS             58973..59151
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH48674"
                     /db_xref="UniSTS:32026"
     variation       58999
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648224"
     variation       59032
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648225"
     STS             59072..59183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1572E"
                     /db_xref="UniSTS:150656"
     variation       59556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648226"
     exon            59852..60148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             59896..59977
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1553E"
                     /db_xref="UniSTS:150638"
     exon            60149..60736
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60442
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648227"
     variation       60641
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648228"
     variation       60699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648229"
     exon            60737..61039
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60801
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648230"
     variation       60937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648231"
     STS             60967..61104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_21540-21541:1033053987:1"
                     /db_xref="UniSTS:268573"
     exon            61040..61336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            61337..61624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61526
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648234"
     exon            61625..61924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648235"
     variation       61798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648236"
     exon            61925..62227
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            62228..62533
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             62267..62380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1519E"
                     /db_xref="UniSTS:22697"
     variation       62416
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648237"
     variation       62456
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648238"
     exon            62534..64300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648240"
     variation       62937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648241"
     variation       63471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648242"
     STS             63819..63961
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65575"
                     /db_xref="UniSTS:58532"
     variation       64103
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648243"
     exon            64301..64594
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            64595..64882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       64603
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648244"
     exon            64883..65182
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             64937..65075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH98821"
                     /db_xref="UniSTS:85869"
     variation       64967
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648245"
     variation       65029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648246"
     exon            65183..67249
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       65206
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648247"
     variation       65891
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648248"
     variation       65906
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648249"
     STS             66141..66232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1540E"
                     /db_xref="UniSTS:150626"
     variation       66196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648250"
     variation       66273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731748"
     variation       66554
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648251"
     variation       66623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648252"
     STS             66672..66773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1546E"
                     /db_xref="UniSTS:150631"
     exon            67250..67552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            67553..67858
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       67728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648253"
     exon            67859..68149
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       67872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370821616"
     variation       67873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648254"
     variation       67876
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648255"
     variation       67881
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648256"
     variation       68077
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648257"
     exon            68150..68446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68219..68220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857280"
     variation       68289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648258"
     variation       68300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648259"
     exon            68447..68752
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857267"
     variation       68583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648260"
     variation       68596
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648261"
     variation       68677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648262"
     variation       68683
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648263"
     variation       68719..68720
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857270"
     exon            68753..69058
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68996
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72648265"
     exon            69059..69340
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            69341..69934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857279"
     variation       69905
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200676850"
     exon            69935..70222
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69948
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648266"
     exon            70223..70522
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648267"
     exon            70523..70825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3731749"
     exon            70826..71128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            71129..71713
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       71148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648269"
     variation       71194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648270"
     variation       71202
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648271"
     variation       71272
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648272"
     variation       71324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648273"
     variation       71397
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648274"
     exon            71714..72019
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            72020..72319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       72185
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648276"
     exon            72320..72895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            72896..73201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       72931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648278"
     variation       72985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648279"
     exon            73202..73795
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       73274
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648282"
     variation       73403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648283"
     variation       73436
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857264"
     variation       73489
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629779"
     exon            73796..79404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       74132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962659"
     variation       74469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629781"
     variation       74738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629782"
     variation       75549
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857265"
     variation       75863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3731752"
     variation       75907
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629783"
     variation       76004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857266"
     variation       76083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731753"
     variation       76262
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72629784"
     variation       76393
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629785"
     variation       76811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829747"
     variation       76988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629786"
     variation       77203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857268"
     variation       77407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72629787"
     STS             77486..77610
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65621"
                     /db_xref="UniSTS:70042"
     variation       77606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:68080670"
     variation       77621
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629788"
     STS             78017..78225
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1568E"
                     /db_xref="UniSTS:150652"
     variation       78018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829748"
     variation       78120
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629789"
     variation       78223
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857269"
     variation       78242
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813249"
     variation       78414
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813250"
     variation       78612
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829749"
     variation       78817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67254537"
     variation       78851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2857271"
     exon            79405..79561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            79562..80253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             79766..79944
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1564E"
                     /db_xref="UniSTS:150649"
     exon            80254..80407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            80408..80710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       80606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629793"
     exon            80711..82029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81049
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629794"
     variation       81065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629795"
     STS             81624..81738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S2648"
                     /db_xref="UniSTS:75793"
     variation       81670
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629796"
     variation       81748
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629797"
     polyA_signal    82002..82007
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
     variation       82021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629798"
     polyA_site      82029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
ORIGIN      
gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgcatagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctcaccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagcaaccttgggcttagtcccaccctttttaggcactcttgagaaatcagagtgcctagaaagatgacaactcaagcaccgacgtttacgcagccgttacaaagcgttgtggtactggagggtagtaccgcaacctttgaggctcacattagtggttttccagttcctgaggtgagctggtttagggatggccaggtgatttccacttccactctgcccggcgtgcagatctcctttagcgatggccgcgctaaactgacgatccccgccgtgactaaagccaacagtggacgatattccctgaaagccaccaatggatctggacaagcgactagtactgctgagcttctcgtgaaagctgagacagcaccacccaacttcgttcaacgactgcagagcatgaccgtgagacaaggaagccaagtgagactccaagtgagagtgactggaatccctacacctgtggtgaagttctaccgggatggagccgaaatccagagctcccttgatttccaaatttcacaagaaggcgacctctacagcttactgattgcagaagcataccctgaggactcagggacctattcagtaaatgccaccaatagcgttggaagagctacttcgactgctgaattactggttcaaggtgaagaagaagtacctgctaaaaagacaaagacaattgtttcgactgctcagatctcagaatcaagacaaacccgaattgaaaagaagattgaagcccactttgatgccagatcaattgcaacagttgagatggtcatagatggtgccgctgggcaacagctgccacataaaacacctcccaggattcctccgaagccaaagtcaagatccccaacaccaccgtctattgctgccaaagcacagctggctcggcagcagtccccatcgcccataagacactccccttccccggtcagacacgtgcgggcaccgaccccatctccggtcaggtccgtgtctccagcagcaagaatctccacatcccccatcaggtctgttaggtctccattgctcatgcgtaagactcaggcatccaccgtggccacaggtcctgaagtgcctcccccttggaagcaagagggctacgtggcctcctcatctgaggctgagatgagagagacaacgctgacaacctctactcagatcaggacagaagagagatgggaagggagatacggtgtccaggagcaagtgaccatcagtggtgctgcgggtgctgccgccagtgtgtcggccagtgctagctacgcagcagaggctgttgccactggtgctaaagaggtgaaacaagatgctgacaaaagtgcagctgttgcgactgttgttgctgccgttgatatggccagagtgagagaaccagtgatcagcgctgtagagcagactgctcagaggacaaccacgactgctgtgcacatccaacctgctcaagaacaggtaagaaaggaagcggagaagactgctgtaactaaggtagtagtggccgccgataaagccaaggaacaagaattaaaatcaagaaccaaagaagtaattaccacaaagcaagagcagatgcacgtaactcatgagcagataagaaaagaaactgaaaaaacatttgtaccaaaggtagtaatttccgcagctaaagccaaagaacaagaaactagaatttctgaagaaattactaagaaacagaaacaagtaactcaagaagcaataatgaaggaaactaggaaaacagttgtacctaaagtcatagttgccacacccaaagtcaaagaacaagatttagtatcaagaggtagagaaggcattactaccaaaagagaacaagtgcaaataactcaggagaagatgagaaaggaagccgagaaaactgccttgtctacaatagcagttgctactgctaaagccaaagaacaagaaacaatactgagaactagagaaactatggctactagacaagaacaaatccaagttacccatggaaaggtggacgttggaaaaaaggctgaagctgtagcaacagttgttgctgcagtagaccaggcccgagtcagagagcccagagagcctgggcatcttgaagaatcctatgctcagcagaccactttggagtacggatataaggaacgcatttccgccgcaaaggtagctgagcctccccaacgtccagcctcagaaccccacgttgtccctaaagcagtcaagcctagagtaatccaggctccttctgagactcatatcaaaactactgatcaaaagggaatgcacatatcatcacagatcaagaaaactacagatctaacaacggaaagattagtccatgtggataaacgcccccgcacagctagccctcactttactgtttcaaaaatttctgttcctaagacagaacatggatatgaggcatcaatagccggtagtgctattgccacattacaaaaagagttgtcagccacatcttctgctcagaagatcaccaaatcggtgaaggctcctactgtgaagcccagtgagactagagtaagggcagagcccacacccttgccacagttccccttcgctgacacaccagatacttacaagagtgaagctggcgttgaggtgaaaaaggaagtaggggtgagcatcactggcaccaccgtccgtgaagagcgctttgaagtactgcacggacgcgaagccaaggtaacagaaacagcaagagtaccagcacctgttgaaattcctgttactccaccaactttggtctcgggcttaaaaaatgtgactgtcatagaaggtgaatctgtcaccttggagtgccacatctctggatacccatccccgacagtgacatggtacagggaagactaccaaatcgaaagttccattgacttccagataaccttccagagtggaattgctcgtcttatgattcgcgaagcatttgcggaagacagcgggcgatttacttgcagtgctgtaaatgaggctggaaccgtcagcacatcctgctatctggctgtgcaggtgtcagaagaatttgaaaaggaaaccacagccgtgactgagaaatttactacagaagagaaacgctttgttgagtcaagagatgtggttatgactgatactagcctcacagaggaacaagcagggcctggagaacctgccgcgccttactttattacaaaaccagtggtccagaaactggtggaaggtgggagcgtggtgtttggatgccaagttggcggcaacccaaagccccatgtatactggaaaaaatctggtgttcctctaaccactggatacagatacaaagtgagttacaacaaacaaaccggtgaatgcaagctggtgatttctatgacttttgctgatgatgctggagaatacactattgttgttcgcaataagcatggagaaacttctgcatctgcttccttgcttgaagaagctgattatgagttactgatgaagtcccagcaagaaatgctttatcagacacaagtgactgcatttgttcaagaacctaaagttggagaaacagcacctggatttgtatactctgagtatgaaaaagagtatgaaaaagaacaagccttaattaggaagaaaatggccaaagatactgtagtggtcagaacttatgtagaagatcaggaattccatatttcttcctttgaagagagacttattaaagaaattgaatatagaataataaagactacattagaagaacttcttgaagaagatggagaagaaaagatggcagttgacatttctgaatctgaagctgttgaatcaggatttgattcaagaatcaagaattatagaattcttgaggggatgggtgtcacttttcattgcaagatgtctggatatccattaccaaagattgcttggtacaaagatggcaagcgcatcaaacatggagaaagataccaaatggactttctacaagatggcagagctagtctgcgtatacctgttgttcttccagaagatgaaggaatctacactgcatttgccagcaatattaaaggaaatgcaatttgctcagggaaattgtatgtggagcctgctgcaccacttggagctccgacttacattcccacactagagccagtgagcagaatcagatctctctctccacgttcagtgagcaggtctcctatacgcatgtctcctgcacggatgtcacctgcaaggatgtctcctgcacggatgtcccctgcaagaatgtcccctggacgtaggctggaggagacagatgagtcacaacttgagagactatataaaccagtctttgtgttaaaacctgtttctttcaaatgtttagaagggcaaactgccagatttgacttaaaggttgttggtagacctatgccagagacgttctggtttcatgatggccagcaaattgtcaatgactatacccataaagtagtcattaaagaagatggtactcaatcactaattattgtccctgccacacccagtgattctggggaatggactgtggttgcccaaaacagggcaggcagatcttcaatttcagtgattttaactgtggaagctgtggaacatcaggtaaaaccgatgtttgtagaaaaactgaaaaatgtcaatataaaggaaggttcccgacttgaaatgaaagtcagagctacgggtaaccccaaccctgacattgtatggttgaaaaacagtgacatcattgtgcctcataaatatcccaaaatcagaattgaaggaaccaagggagaagctgcccttaaaatcgattccactgtcagccaagattctgcctggtatactgcgactgctattaataaagctggcagagacactacaagatgcaaagtaaatgttgaagttgagtttgcagagcctgagccagagagaaagttaatcatcccacgggggacatatagagcaaaggagattgcagccccagaactggagcccctccatttgcgatatggccaagagcaatgggaagaaggtgatctctatgacaaagagaaacaacagaaaccatttttcaagaaaaaactcacttccttaagacttaagcgctttgggcctgcccactttgaatgcaggctaacacccattggtgacccaacgatggtggtggagtggctccatgatggaaagccacttgaagcagccaacaggctccgtatgatcaatgaatttgggtactgcagccttgattatggcgttgcatattctagagacagtggtatcattacttgcagagccactaacaaatatggaacagatcacacatctgctacccttattgttaaagatgagaaaagtcttgtggaagaatcccaattgcctgaggggaggaaaggcttacagagaattgaagaattagagagaatggctcatgaaggtgcacttacaggtgtaacaacagatcagaaagaaaagcaaaagccagacattgtcttgtacccagagccagttagagtacttgaaggggagactgcaaggttccgctgcagggtaacaggctaccctcagcccaaagtcaactggtacctcaatggacagctcatccgcaaaagcaaaaggttcagagttcgctatgatggtatccattacctggacatcgtggactgcaaatcatatgacacaggtgaagtgaaggtcaccgcggaaaatcctgaaggtgtgatagagcataaagtgaagcttgagattcaacagagggaagattttaggtctgtccttaggagagctcctgaaccaaggcctgagtttcacgtacatgaaccaggaaagcttcagtttgaagtacaaaaagtggatagacctgttgacaccactgaaaccaaagaagttgtgaagttgaaaagggctgaaagaattacccatgaaaaagtgcctgaagagtcggaagagctgcgcagtaaattcaagcgcagaacagaagagggctattatgaagccattaccgctgtggagctcaagtctcgaaagaaggatgaatcctatgaggaactcctcaggaagacaaaagatgaacttctccactggaccaaagagttaactgaagaggaaaagaaagctcttgccgaagaaggcaaaatcacgattccaacttttaaacctgacaagattgaactaagtcctagtatggaggctccaaaaatcttcgaaagaatccagagccaaacagtgggccaaggatctgatgcacacttccgggtcagagtcgtggggaaaccagaccccgaatgtgaatggtacaaaaatggtgtcaaaattgaacggtctgaccggatctactggtactggcccgaagacaatgtttgtgaattggtcataagagatgtgactgctgaggactctgccagcatcatggtaaaagccatcaacatagctggagaaacctccagtcacgcattcttacttgtccaagccaagcaattgatcactttcacacaggaattacaagatgttgttgctaaggaaaaagacactatggcaacctttgaatgtgaaacttcagaaccatttgtcaaagtgaaatggtataaagatggtatggaggttcatgagggagataaatacaggatgcactctgacagaaaggttcacttcctctccatactgaccattgatacgtctgatgctgaagattacagctgtgtacttgtggaagatgaaaatgtcaaaacgactgctaaacttattgttgaaggtgcagttgttgagtttgtgaaagaacttcaggacatagaagttccagaatcatattcaggagaattagagtgcattgtatccccagaaaatatagaaggaaaatggtatcataatgatgtggagcttaaatccaatggcaaatatacaattacatctcgtcgtggacgtcagaacctcacggtcaaggatgtaaccaaggaggaccagggagaatacagctttgtcatcgacgggaaaaagacaacctgtaaattaaagatgaaaccccgccccattgctatcctacaaggacttagtgaccaaaaagtctgtgagggtgacattgttcagcttgaagttaaagtctccttggaaagtgtggaaggcgtctggatgaaagacggccaagaagtgcagcccagtgacagggttcacattgtgatagacaaacaatctcatatgctgctcattgaagacatgactaaggaagatgctggaaattactctttcaccattccagcccttggcctctccaccagtgggcgtgtctctgtctatagtgtggacgtgataacacctctaaaagatgttaatgtgattgaaggcaccaaggctgtgcttgaatgtaaggtgtcagtccctgatgtgacttctgttaagtggtacttaaatgatgaacaaatcaagcctgatgaccgtgtacaggccattgtgaaaggtactaaacagcgactagtcattaaccgaactcatgcttcagacgaaggaccttacaagctgatagttggcagagttgaaaccaactgtaatctctctgtagaaaaaattaaaattatcagaggtcttcgtgaccttacctgtacagaaactcaaaatgtggtgtttgaggttgagctgtcccactctggaattgatgtcctgtggaattttaaggacaaggaaatcaagcccagttctaaatataaaattgaagcacatggaaaaatatataaattgacagttctaaatatgatgaaagatgatgaaggaaaatacacattttacgcgggagaaaatatgacatctggaaaacttactgtggcaggtggggccatctccaagccactcacagatcagaccgtagctgaatcccaggaagctgtgtttgaatgtgaagttgccaacccagattccaaaggcgaatggttgagggatggcaaacacctaccactgactaacaacatcagaagtgagtctgatggccacaaaaggagacttatcattgctgccaccaaattagatgacattggagaatatacctacaaggtggccacctccaaaacatctgccaaactcaaagttgaagctgtcaaaattaagaagactctgaagaacctcacagtgacagaaacacaggatgctgttttcactgtcgagcttacacaccctaatgtcaaaggtgtccagtggatcaaaaatggagttgtgctggaatccaatgaaaagtatgctatctctgtcaaaggaacaatttactctctgaggattaaaaactgtgccatcgtggatgagtctgtttatggcttcaggcttggaaggcttggagccagtgccagactgcacgtggagactgtcaagatcattaaaaagccaaaggatgtgacagccttggaaaatgccactgttgcctttgaagttagtgtttcccatgacactgttccagtaaaatggttccataagagtgtggaaattaagccaagtgacaaacacagactggtctcagaaaggaaagtccacaagctgatgctgcagaacatctccccctcagatgctggggaatacacagctgtggtcgggcaattggaatgcaaagcaaaactgtttgtggagacattacatattacaaaaaccatgaaaaatatcgaggtgcctgagaccaaaactgcctcttttgagtgtgaggtgtcccacttcaatgtcccttccatgtggctgaagaatggtgtggaaattgagatgagtgaaaagttcaagatagttgtgcagggaaaactccatcagctgatcatcatgaacaccagcacagaggactcggcagaatacacatttgtctgtggcaatgaccaagtcagtgccaccctgacagtcaccccaatcatgattacttccatgctgaaagacatcaacgctgaagaaaaagacactattacttttgaggtgacagtgaactatgaaggcatctcttacaaatggttaaagaatggtgtggaaatcaaatcaactgacaagtgccagatgagaaccaaaaagctcacacactcactgaacatcaggaatgttcactttggggatgctgctgactacacctttgtggctggaaaagcaacatcaacagccacactttatgtggaagctcgtcatatagaatttaggaaacacattaaggacattaaggtactggagaagaagcgagccatgtttgaatgtgaagtttctgaacctgacatcactgtacagtggatgaaagatgaccaggaactgcagatcacagacagaataaagattcagaaggagaaatatgtccaccgccttctgatcccatccacccggatgtctgatgctgggaagtacacagtggtggcaggaggcaacgtgtcaactgcaaaactctttgtagaaggcagagatgttcgcatccgaagtattaaaaaggaggttcaggtcattgagaaacagcgtgctgttgttgaatttgaggtcaatgaagacgatgttgatgcccactggtataaagatggcattgaaatcaatttccaagttcaagaacgacacaaatatgtagtggaaagaagaatccaccgaatgtttatctctgagaccagacagagcgatgcaggagaatacacctttgtggcaggaaggaacaggagttctgtcactctctatgtcaatgctcctgaaccgccccaagttctgcaggagctccagcctgtcactgtgcagtctggcaagcctgcccgcttctgtgccgtgatatccggaagaccacagcccaaaatttcctggtacaaggaagagcagctgctttccactggcttcaagtgcaaatttcttcatgatgggcaagaatacacgcttttgctaattgaagccttcccagaggatgcggcagtctatacctgtgaagccaagaatgactatggtgttgccacaacatcagcttcactctcagtggaagttccagaagttgtgtctcctgatcaggaaatgcctgtttatccacctgccatcatcaccccgcttcaggacactgtcacttctgaagggcagccagcccgttttcaatgccgggtttctggaacagatctaaaagtgtcgtggtacagcaaagacaagaaaatcaagccatctcggttctttagaatgactcaatttgaagacacttatcaactggaaattgccgaagcttatccagaagatgaaggaacttacacgtttgttgctagtaatgctgtaggccaagtatcaagcacagccaacctgagtctggaagctcctgaatcaattttgcatgagaggattgaacaagagattgagatggaaatgaaagagttttctagttcttttctgtctgccgaggaagaaggacttcatagcgccgaacttcaattatctaaaataaatgaaacacttgaacttttgtctgaatctccagtttacccaactaaatttgattccgaaaaggaaggcactggcccaattttcatcaaagaagtgtcaaatgctgatataagcatgggggatgtggctacactgtctgtaactgtcattggcatccccaaacctaaaattcagtggttctttaatggagtgctattaaccccttctgctgactacaaatttgtttttgacggtgatgatcatagcctgatcattctgttcaccaaattggaggatgagggagagtatacatgtatggccagtaatgactatggaaagacaatatgtagtgcctatctaaaaattaattccaaaggagagggtcacaaagacactgaaacagaatcagcagtggcaaaatctctggaaaagctgggaggtccttgtcctcctcacttccttaaggagttaaaaccaattcgctgtgctcaagggcttcctgccatctttgagtacacagtggttggagagcctgcccctactgttacatggttcaaagaaaacaagcagctttgcaccagtgtttattacactatcattcataaccctaatggctctggaactttcattgtcaatgaccctcagagggaagacagtggcctctatatctgtaaagcagagaatatgttgggtgagtccacctgtgcagcagagctgcttgtgcttctggaagacacagacatgactgataccccctgcaaagcaaagtccacaccagaggctcctgaggattttccacagacacccttaaagggtcccgcagttgaagcacttgactcagagcaggaaattgcaacgtttgtaaaagacaccattttgaaagctgctttaattacagaagaaaaccagcaactatcttatgagcatattgctaaagccaatgaattgagcagtcagcttcctttgggagctcaggaattgcaatccattttggagcaagacaagctcactcctgaaagcaccagggaatttctttgcatcaatggcagtattcactttcagcctctcaaggaaccatctcccaacctacagctgcagattgtacagtcccagaaaaccttctccaaagaaggtattctaatgcctgaagagcctgagacacaggcagttctatcagataccgagaaaatcttcccaagtgccatgtccatagaacaaattaattcattaacagttgagcctctgaaaactttattagctgaacctgaagggaattatccacagtcttcaatagaacctccaatgcattcttatctaacctctgtggctgaggaagtactttcaccaaaagaaaagacagtatctgacaccaacagagagcaaagagtgactcttcaaaagcaagaggcacaaagtgcgctcatcttgagtcagagcttagctgagggacacgtggagagtctccagagtcctgatgtcatgatctctcaggtaaactatgagcccctagtcccttcagaacactcatgcacagaaggaggtaaaattttgatagaaagtgcaaatccactggaaaatgcagggcaagattctgcggtcagaattgaggaaggcaagtccttaagatttccactagcacttgaagaaaagcaggtactgctcaaagaagagcattctgacaacgtggtgatgcccccagaccaaatcattgagtctaaaagagagcccgtggcaataaagaaagtgcaggaggtacagggaagggaccttctttctaaggaaagcttgctttctggtattccagaagagcagagattaaacctgaaaattcaaatctgccgggctttgcaagcagccgtggccagcgagcagccaggtcttttctctgagtggctaagaaatattgaaaaggtggaggtcgaggctgtaaacatcacccaagagcccagacacatcatgtgcatgtaccttgttacttcggcaaagtctgtaacagaagaagtaaccatcattattgaagatgttgatcctcaaatggctaacctgaaaatggaacttagggatgctttgtgtgctattatatatgaggaaatagacatcctaacagctgagggtcctagaattcagcaaggagccaaaacaagtttgcaagaagaaatggattctttttcaggttcacagaaggttgaacccattactgaaccagaagttgaatctaaatatctgatctcaactgaagaggtcagttattttaacgtgcaaagtagggttaaatatttggatgccacacctgtcactaaaggggttgcttcagctgttgtctctgacgaaaaacaagatgagagtctgaaaccatcagaggaaaaagaggagtcttcctctgaaagtggtactgaggaggttgctacagtaaagatacaggaagctgagggtggcttaatcaaagaggatggccccatgatacatacacctttagtggacactgtttctgaggaaggtgatattgtacacctcacaacatccataacaaatgctaaagaggtgaattggtattttgagaataaactggtgccttcagatgaaaagttcaagtgtttacaagatcaaaatacatatacgctagtcatcgacaaagtaaataccgaagaccatcaaggagagtatgtctgtgaggccttgaatgacagcggaaaaacagcaacttcagccaaactcactgtagtaaaaagagctgccccagtgatcaagaggaaaatcgaacccctggaagtagcactgggccacctagccaaattcacctgtgagatccaaagtgctcccaatgtccggttccagtggtttaaagctggccgagaaatttatgagagtgacaagtgttctattcgatcttcaaagtatatctccagccttgaaatcctgagaacccaggtggttgactgcggcgagtatacatgcaaagcttccaatgagtatggcagtgtcagctgtacagccacactaactgtgacagtgcctggaggtgaaaagaaagttcgcaaattacttccggaacgtaaacctgaaccaaaggaagaagttgttctgaaaagcgttctaagaaaaagacctgaagaagaagaacctaaagtagaacctaaaaaactagaaaaagttaaaaaacctgcagtaccagaaccaccacctccaaaacctgttgaagaggttgaagtacctactgttacaaaaagggaaaggaagattcctgaaccaacaaaagtgcctgaaatcaagccagcaatacctctccctgcacctgaaccgaaaccaaagcccgaagcagaagtgaaaacaatcaaaccacctcctgtggaacctgaaccaacccccatcgctgccccagtaacagtgccagtggttggaaagaaagcagaagccaaagcacctaaggaagaggctgccaagccaaaaggtcctatcaaaggtgtacccaaaaagactccttcaccaatagaagccgaaaggagaaagttaaggccaggaagtggtggagagaaacctcctgatgaagccccgttcacctaccagctaaaggctgtgccactgaagtttgtgaaagaaatcaaagacatcatcttgacagaatcagagttcgttggctcttcagcaatctttgaatgtttggtctccccttccactgcaattacaacctggatgaaagacggtagcaatatccgtgagagtcccaagcacaggtttattgcagatggtaaagacagaaagctgcacatcattgatgttcaactttccgatgctggtgaatacacctgtgttttacgtttgggaaacaaagaaaagacctccacggctaaacttgttgtagaagaacttcctgtgcgttttgtaaaaacactggaagaggaagtcacagtggtcaaaggacagccattgtacttgagctgcgagttaaacaaagagcgtgacgtggtctggaggaaggatggcaagattgtggtggagaaacctggccgaattgtgccaggcgtcattggcttgatgcgggctctgaccatcaacgatgcagatgacacagatgctggaacatacacagttactgtggaaaacgccaacaacctggagtgttcatcttgcgtaaaagtagtagaagtcattagagattggctggtgaaacctatacgagaccagcatgtgaaacccaaggggacagctatttttgcctgtgatatagcaaaagatactccaaacattaagtggttcaaaggatatgatgaaatccctgcggaaccaaatgataagactgaaatactgagagatggaaatcatctgtacctcaaaattaagaatgctatgccagaagatattgctgagtatgcagtggaaattgaaggaaaaagataccctgcaaagctgacacttggagagcgtgaagttgaactgcttaaaccaatagaggacgttaccatttatgagaaagaaagtgcaagctttgatgcagaaatctcagaggcagacattcctggacaatggaaactgaaaggagaacttctaaggccctcacctacttgtgaaatcaaagcagaaggtggaaaacgcttcttaactttgcacaaagtcaaactggaccaagctggtgaagtcctctaccaggcccttaatgcaattacaactgccattttgacagtaaaagaaatcgaacttgactttgctgtgcccctgaaggatgtcactgttccagaaaggcgacaggctcgattcgaatgtgtcctcacccgagaggcaaatgttatatggtccaaaggacctgatataattaagtcatctgacaaatttgatatcatcgctgatggaaagaaacatattcttgttattaatgattctcaatttgatgatgaaggggtctatactgctgaggtggagggcaagaagacctcagctcggttgtttgtcacaggtataagactgaaattcatgtcacctcttgaagatcaaacagtaaaagaaggtgaaacagcaacttttgtttgtgaactttctcatgaaaaaatgcatgtagtctggttcaaaaatgatgccaaactccatacaagcagaacagtactcatctcttctgagggcaagactcacaaattggaaatgaaagaagtgacattggatgatatatctcagataaaagctcaagtcaaggagctgagctccacagcacagctgaaggtcttagaggccgatccctacttcactgtgaaattacatgacaaaactgcagtggagaaggatgagattactttgaagtgtgaagtgagcaaagatgtaccagtgaaatggttcaaagatggtgaagagattgtcccttcacccaaatattctatcaaggcagatggcctgcgccgcatcttaaaaatcaaaaaggcggaccttaaagataaaggcgaatatgtgtgtgactgtggcacagacaagaccaaggcaaatgttactgttgaggctcgactaataaaagtggaaaagcctctgtacggagtagaggtgtttgttggtgaaacagcccactttgaaattgaactttctgaacctgatgttcacggccagtggaagctgaaaggacagcctttgacagcttcccctgactgtgaaatcattgaggatggaaagaagcatattctgatccttcataactgtcagctgggtatgacaggagaggtttccttccaggctgctaatgccaaatctgcagccaatctgaaagtgaaagaattgcctcttatcttcatcacacctctcagtgatgttaaagtcttcgagaaagatgaggctaagtttgagtgtgaagtatccagggagcccaaaacattccgttggctaaaaggaacccaggaaatcacaggtgatgacagatttgagcttataaaggatggcactaagcattcaatggtgatcaagtcagctgcttttgaagatgaagcaaaatacatgtttgaagctgaagataagcacacaagtggcaaactgatcattgaaggaatccggctcaaattcctcacccctctcaaagatgtaactgccaaagagaaggaaagtgctgtatttactgtggagttatctcatgataacatccgagttaaatggttcaagaatgaccagcgcctacacaccaccaggtcggtctcaatgcaagacgaagggaaaactcattcgatcacattcaaagacctgtctattgatgacacctcccaaattagagtagaagctatggggatgagttcagaagctaaactcactgtgcttgagggagacccatattttacaggaaaacttcaagattatactggtgtagagaaagatgaagttattctacagtgtgaaattagcaaagcagatgcaccagtgaaatggtttaaggatgggaaggaaataaagccatccaaaaatgctgttattaaggcagatggcaagaaacgcatgctaatcctaaagaaagccttgaaatcagatattggacagtacacctgtgactgtgggacagataagacctcaggaaaacttgacattgaggatcgggaaattaaactggtgcgacccctgcacagtgtggaggtgatggagactgagacagcacgctttgaaaccgaaatctctgaagatgatatccacgccaactggaaactcaagggagaggccctactccaaacacctgattgtgaaattaaggaagaaggcaaaatacactcccttgttttgcacaactgtcgcctggaccagacgggtggggtggatttccaagctgccaatgttaaatctagtgcccacctccgagttaagccacgagtaattggtcttctgaggcctttaaaggatgtcaccgtgactgcaggggaaacagccaccttcgactgcgagctctcctacgaagatatcccagtggaatggtatctcaaagggaagaaactagagcccagcgataaggtggtcccacgttcagaaggaaaagttcatacacttactctgagggatgtaaagttagaagatgctggggaagtccaactaacagcaaaagatttcaaaactcacgccaacctctttgtgaaagaacccccagttgaattcactaagcctcttgaggaccagacggtcgaagagggagccactgcagtgctggagtgtgaagtctccagagaaaatgctaaggtgaaatggttcaaaaatgggacagaaatcctcaaaagcaagaagtatgaaattgttgctgatggcagggtcagaaaacttgttatacatgactgtaccccagaggatattaaaacatacacttgtgatgctaaggattttaagacttcctgtaacctgaatgtcgtgcctcctcatgtggaattcttaagaccactcaccgaccttcaagttagagaaaaagaaatggctcgatttgagtgtgaactttcccgagaaaatgctaaggttaagtggtttaaagatggtgctgaaattaaaaagggcaaaaaatatgacatcatatccaagggagcagtgcgcattcttgtcatcaacaaatgtctactggatgatgaagctgaatattcctgtgaagtaaggacagcgagaacttctggcatgctgacagttctggaagaagaagctgtctttaccaaaaatcttgccaacattgaagttagtgaaacagacactataaaactggtttgtgaagtctccaaacctggcgcagaagtgatttggtataaaggggatgaggagatcattgaaacaggaagatatgaaatactgactgaaggacggaagagaatcctggtcattcagaacgctcaccttgaggatgctggcaactacaactgtcgactcccaagctctcgaaccgatggcaaagtcaaagtacatgaactggctgctgaatttatctcaaagcctcaaaaccttgaaatacttgaaggagaaaaggctgaatttgtctgctctatatcaaaagaaagctttccagtccagtggaagagggatgataagacacttgaatctggagataaatatgacgttattgctgatggtaaaaagagggtcctagttgtgaaagatgccacattacaagatatgggcacttacgttgtcatggtaggggccgccagagcagcagctcacttgacagtcattgaaaaactcaggatcgtagttcctcttaaggacacccgggtgaaggaacaacaggaagttgtcttcaactgtgaagtcaatactgaaggtgccaaagccaaatggttcagaaatgaagaagctatatttgatagttcaaaatacatcattctccaaaaagacctagtctacaccctcagaattagagatgcacacttagatgaccaagccaactataatgtgtctttgaccaatcacagaggtgaaaatgttaaaagtgcagccaatctaatagtagaagaggaagaccttaggattgttgagcctcttaaagatattgaaacaatggagaagaaatctgtcacattctggtgcaaggtgaatcgtctcaatgtaacactgaagtggaccaaaaatggtgaagaagtgccttttgacaaccgtgtctcatacagagttgataagtacaagcacatgttaaccattaaagactgtggcttcccagatgaaggtgaatacattgtcactgctggacaagataaatctgttgctgagcttctcatcatagaagccccgacagaatttgtggaacacttggaagatcagacagtcactgagttcgatgacgctgtcttctcctgccagctctccagagagaaagccaatgtaaaatggtacagaaatgggagagaaatcaaagaaggcaaaaaatacaaatttgaaaaagatggaagtatacacagactcattataaaagattgcaggctggatgatgagtgtgaatatgcttgcggggtagaagacaggaagtctcgtgctagactttttgtggaagaaattcctgttgagatcatcaggcctccacaagatattcttgaagcccctggtgctgatgttgtctttttagcagaactcaataaagataaggtggaagtccaatggctaagaaataacatggttgttgtccagggtgataaacaccagatgatgagtgaaggaaagatacatcgactacagatttgtgatattaagccccgtgaccagggtgaatacagatttattgccaaagacaaagaagccagagctaagcttgaactggcagctgcaccaaaaatcaagacagctgaccaagaccttgtggttgatgttggcaagcctctgacaatggtggtgccatatgatgcctaccccaaagcagaagctgaatggtttaaagaaaatgaacctttatctacaaaaaccattgatactacggctgaacaaacttctttcagaattttagaagccaagaaaggagacaaagggaggtataaaattgtgcttcagaacaaacatggaaaagcagaaggattcatcaatttaaaagttattgatgttcctgggccagtacgtaacttagaagtgacagaaacatttgatggtgaagtgagccttgcttgggaagaacctttaactgatggtggaagcaaaatcataggttacgttgttgaaagacgtgacattaagagaaagacctgggttctggccacagaccgtgcagagagttgtgagtttactgtcactggtctacagaaaggaggagttgagtacctattccgtgtgagtgcaagaaacagagttggcactggtgagccagtagaaactgacaatcctgtagaagcaaggagtaaatatgatgttccaggccctcctttgaatgtaaccatcactgatgtgaatcgatttggtgtctcactgacatgggaaccaccagagtatgatggaggtgctgagatcacaaactacgtcattgaattaagagacaagacttctatcaggtgggatactgccatgactgtgagagctgaagacctgtctgcaactgttactgatgtggtagaaggacaggagtacagtttccgagtgagagcccaaaatcgaattggagttggaaaaccaagtgcagccacacccttcgtcaaagttgctgatccaattgagagaccaagtcctcctgtaaacctaacttcctcagatcagactcagtcatcagttcagctcaaatgggaacctcctctgaaagatggaggaagcccaatattaggctatataattgagcgatgcgaagaaggaaaagataattggattcgttgcaatatgaaacttgtccctgaactgacttacaaggttaccggattggaaaaaggaaataaatatttatatagagtatctgcagaaaataaagctggtgtttcagatccatctgaaattcttggtcctctcaccgctgacgatgcatttgttgaaccaacaatggatttaagtgcatttaaagatggtctggaagttattgtcccaaatcctatcacgatcctggttccaagtacaggctatccaaggccaactgcaacctggtgttttggagataaagtactagaaacaggggaccgggtgaaaatgaagaccttgtctgcctatgccgaacttgtcatttctccaagtgaacgttcagacaagggcatttatacactgaaattagaaaaccgtgtgaaaacaatttctggggaaattgatgtcaatgtaattgctcgcccaagtgcacccaaagaattgaaatttggtgatataaccaaggactcagtacatttgacttgggaaccacctgatgatgatggaggaagtccgttaactggatacgttgttgaaaaacgagaagtcagccggaaaacatggactaaagttatggactttgtgactgatctagaattcacagttcctgatcttgttcaaggaaaagagtacttatttaaagtttgtgctcgtaacaaatgtggccctggagaacctgcatatgttgatgaacctgtaaatatgtcaactcctgcaacggtacctgacccaccagagaatgttaaatggagagatcgaacagccaatagcatcttcttaacatgggatccacctaaaaatgatggtggttcacgcatcaaaggatatatagttgaaagatgtccacgtggttctgataaatgggttgcctgtggagaacctgttgcagaaacaaaaatggaagtgacaggtcttgaggaaggcaaatggtatgcctaccgcgtgaaggccttaaacaggcagggtgctagcaaaccaagcagacccacagaggaaatccaggctgtggacacacaagaggccccagaaatcttcctcgatgtgaagctccttgctggtctcactgtaaaagctgggaccaagattgaacttcctgccaccgtaaccggaaaacctgaacctaaaataacttggacaaaggctgatatgattctgaagcaggacaaaagaattaccattgaaaatgtccctaagaaatccacagtgactattgttgatagtaagagaagtgacactggcacatatatcattgaggctgtgaatgtgtgtggccgggccactgctgtggtggaagtgaacgtcttagataaacccggaccaccagctgcctttgacatcacagatgtaaccaatgagtcatgtcttctaacatggaacccaccacgcgatgatggtggatctaagatcacaaactatgttgtggagagacgagcaactgatagtgaagtgtggcacaagctctcatccaccgtcaaggatacaaacttcaaggccaccaaattaatccccaataaagagtacatcttcagagttgctgcagaaaacatgtatggtgttggtgaaccagttcaggcctctccaataacagccaaatatcagtttgatccacctggtcctccaactcgcctagaaccttctgatatcactaaagacgcagtgactctcacatggtgtgagccagatgatgatggtggcagcccaatcacaggatactgggttgaaagactggatcctgatacagataaatgggttagatgcaataagatgccagtaaaggacacaacatacagagtgaaaggtctcactaataagaaaaaatacagattccgtgtgttggctgaaaatcttgctggacctggaaaaccaagcaaatcaactgaaccaatcttaataaaggatcccatagatcctccatggccccctggaaaaccaactgtaaaagatgtaggcaaaacatcagtaaggttgaattggacaaaaccagaacatgatggaggtgcaaagattgagtcttatgtcattgaaatgctgaagactggaacagatgagtgggtcagagtggcggaaggggttcccaccactcagcacttgctcccagggctcatggaaggacaggaatactcattccgagttagagctgtgaataaggctggggaaagtgaacccagtgaacccagtgaccctgtgctttgccgggagaagctatatcctccatcaccaccacgctggcttgaagttattaatatcacaaaaaatacagcagacctaaaatggacagttcctgagaaagatggagggtcccccatcaccaactacattgtggaaaagagagacgtcaggcgaaaaggctggcaaacagtggataccactgtcaaggacaccaagtgcacagtcaccccactgactgagggctctttatatgtgttccgagttgctgcagaaaatgctataggacaaagcgactacaccgaaattgaggactctgtgctggccaaagacacctttaccactcctggaccaccctacgccctggcagtggttgatgtgacaaaacgacatgttgacctaaagtgggagccacctaaaaatgatggtggaagaccaatacagagatatgtcattgagaagaaagaaaggttaggtacccgttgggtgaaagctggaaagactgcaggacctgactgtaacttcagagtaactgatgtcatcgaaggaacagaggtccagtttcaggttcgggctgaaaatgaagctggagttggccacccaagtgaacccacagaaatcctatccattgaagatccaacaagtcctccctcaccaccccttgacctacatgtgactgatgctgggagaaaacacattgccattgcttggaagcctccagagaaaaatggtggaagtcctatcataggataccatgttgaaatgtgtccagtaggcactgagaaatggatgagagttaattctcgcccaataaaggacttgaaattcaaggttgaagaaggtgttgttcctgacaaagaatatgtcctgagagtgagagcagtcaatgctattggtgtcagcgagccatctgaaatctctgaaaatgtggttgccaaagacccagactgcaagccaacaattgacctggagactcatgacattattgttattgaaggtgaaaagttaagcattcctgttcccttcagagctgtcccagttccaactgttagttggcataaagatggcaaagaagttaaagcaagtgatagattaacaatgaagaatgatcacatctctgcacaccttgaagttcccaagagtgtccgtgcagatgccggaatttataccattacactggagaataagctcggctcagcaacagcctcaatcaatgtcaaagtcataggcctacctggaccatgcaaagatattaaagcaagtgacattaccaagagttcttgtaagttaacttgggaacctccagaatttgatggtggaaccccaattcttcattatgtcctggagcgcagagaagctgggaggagaacatatataccagtcatgtctggtgagaacaaactgtcatggactgtgaaggatctcataccaaatggtgaatacttcttccgtgttaaagcagtcaacaaggttggtggaggagaatatattgaactgaaaaatccagtcattgctcaagatccaaagcaaccccctgatccacctgtagatgtagaggttcataatcctacagcggaggcaatgactattacatggaagccacctttgtatgatggagggagcaagataatgggctacatcatagagaagattgctaagggtgaagaaaggtggaagagatgcaatgaacacctggtaccaatcctgacctatacagcaaaaggacttgaagaggggaaagagtaccaattccgtgtgcgagcagagaacgccgcgggtattagtgaaccttctcgggctactcctccaaccaaagctgtagatcccattgatgcccccaaagtcattctgagaacaagcctagaagtgaaacgaggtgatgaaatagcacttgatgcaagtatttctggatcaccttacccaactattacatggataaaggatgaaaatgttattgtaccagaggaaattaagaagcgtgcagcacccttggttaggagaaggaagggtgaagttcaagaagaagaaccatttgtcctgcctctgacacagcgtttgagtattgacaacagcaaaaagggagaatctcagctacgcgtccgagattctctccgacctgaccatggtctgtatatgatcaaagttgaaaatgaccacggtattgcaaaagctccttgtactgtcagtgtgttagatacaccgggaccaccaatcaactttgtatttgaagatatcagaaagacctcagtcctttgtaaatgggaaccaccccttgatgatggtggcagtgaaatcataaactacactttggaaaagaaagacaagacaaaacccgactcagaatggattgttgtcacttcaacacttagacattgcaaatattcagtaacaaaactgattgaaggaaaagagtacctcttccgtgtaagagctgaaaacagatttgggccaggtccaccatgtgtttcaaagccacttgtggctaaagatccatttggaccacctgatgcaccagataagcccattgtggaagatgttaccagcaacagtatgctagtgaaatggaatgaaccaaaagataatggaagccccattttgggttactggcttgaaaaacgtgaagttaacagtacacattggtctcgtgtcaacaaaagccttctgaatgccttgaaagccaatgtagatggcttattagaaggactcacctatgtcttcagagtatgtgctgaaaatgcagctggacctggaaagttcagtccaccttcagatcccaaaacagcacatgatccaatctctcctcctgggccacctatcccaagagtcactgacacaagctctacaactattgaactagaatgggaacccccagctttcaatggtggtggggaaattgttggctattttgttgataagcagttggttggcacaaatgaatggtcacgctgcacagagaagatgatcaaggtccgtcagtacaccgtcaaagaaatccgagagggtgctgattacaaacttcgggtgagtgctgtcaatgccgcaggggaaggaccgcctggagaaacacaacctgttactgtggctgaaccacaagagcctccagctgtggaactggatgtttctgtcaagggtggaatacaaataatggctgggaagactcttagaattccagctgtggtgactggtcgccctgtacctacaaaagtatggaccaaagaagaaggggagctggataaagaccgtgttgtaatagacaacgttggaaccaaatctgaactaattatcaaggatgcactgcgaaaagaccatggcagatatgtgattacagctacaaatagctgtggttccaaatttgcagcagccagggtagaagtttttgatgtccctggtccagttcttgacttaaaacctgttgtaacaaacagaaaaatgtgtctacttaactggtctgatccagaagatgatggaggaagtgaaataacaggctttatcattgaaagaaaagatgccaagatgcatacttggagacaaccaatagagactgagagatctaaatgtgacatcacaggtctgcttgagggacaagaatataagttccgtgttattgccaagaacaagtttggctgtggccctcctgttgaaataggaccaattcttgcagttgatccactaggtcctccaacatctccagagaggctcacatacactgaaaggacaaagtccactatcacacttgactggaaagagccccgcagtaatggtggcagtcccatccaaggatatatcattgaaaaacggcgtcatgacaaacctgactttgaaagagttaacaagcgactctgcccaaccacatcttttctggttgaaaatcttgatgaacaccaaatgtatgagttccgtgtcaaagctgtcaatgaaattggtgaaagtgaaccatccctacctcttaatgtagtcatacaagatgatgaagtgcctccaactattaagttgcgtctgagtgttcgaggagacactatcaaagttaaggcaggagagcctgtccacatccctgcagatgtgacaggccttccaatgcctaagattgaatggtccaaaaatgaaactgtaattgaaaaacccactgatgcacttcagataaccaaggaagaggtatcccgaagtgaggcaaaaactgagcttagcattcccaaagcggtccgggaggacaaaggcacttacacagttactgcttccaatcgccttggctcagtgttccgaaatgttcacgttgaagtatatgaccgcccatccccaccaagaaatcttgctgttactgacattaaagctgaatcttgctacttgacatgggatgcccctcttgataatggtggcagtgaaatcacccattatgttattgacaaacgtgatgcaagtaggaagaaagcagaatgggaggaagtcaccaacactgctgtagagaaaagatatgggatctggaaacttatccccaatggtcagtatgagttccgagtcagggcagtgaataaatatggaatcagtgatgagtgcaaatcagataaagtagtcattcaagatccttatcgccttcctggacctccaggaaaaccaaaagttttggcacgcaccaaaggatcaatgctagtgagctggactcctcctttggacaatggtggctctccaattactggctactggctggagaaaagagaagagggaagtccttattggtcacgtgttagccgagcaccaataaccaaagtgggattgaaaggcgtggaatttaatgttcctcgtttgcttgaaggcgttaaataccagttcagagccatggcaataaatgctgcaggaattggtcctcccagtgaaccatcagatccagaggttgcaggagatcccatatttccaccggggccaccttcttgcccagaagttaaagataaaacgaagtcaagcatctcactaggatggaaacctccagccaaagatggtggcagcccaatcaaaggatacattgtagaaatgcaagaagaaggtactactgactggaaaagagtaaatgaaccagacaaacttataactacctgtgaatgtgtggtgcctaatctgaaagagctcaggaagtacagattcagagtgaaagctgtcaatgaagctggtgaatctgaaccaagtgatacaactggggagatccctgccactgatattcaagaggaaccagaagttttcattgacattggagcacaggactgtctggtttgtaaagctggctcacagattaggattcctgctgtcatcaagggacgcccaacaccaaaatcatcttgggaatttgatggaaaggcaaagaaagcaatgaaggatggagttcatgacatacccgaagatgcacagctggagactgctgaaaactcctcagtaattattattccggagtgtaaacgatctcatacaggcaaatacagcatcacagccaagaataaagcaggacaaaagactgcaaattgcagagttaaagtcatggatgtaccaggcccacccaaagatctgaaagtcagtgatatcacaaggggtagttgcagactttcatggaagatgccagacgacgatggaggagacaggatcaaaggctatgttattgagaagaggactattgatggaaaagcctggaccaaagtcaatccagactgtggaagcaccacatttgtagtgcctgatctcctctctgaacagcaatatttcttccgtgtgcgagcagaaaaccgttttggtattggcccacctgtggaaaccattcagaggaccactgccagagatccgatatatcctcctgatcctcctattaaactcaagattggcctcatcacaaagaacacagtgcatctgtcatggaaacccccgaagaatgatgggggctcccctgttacccactatattgttgagtgccttgcatgggaccctactgggacaaagaaagaagcctggaggcagtgcaataagcgtgatgtggaagaactgcaatttactgttgaagacctagtagagggtggggaatatgaattccgagtcaaagctgtcaatgctgcaggagtcagcaagccttcagccactgttggccctgtgactgtcaaagaccagacatgcccaccatcaattgatctaaaagaattcatggaggttgaagaaggaaccaatgttaacattgtggccaaaattaaaggtgtgccattcccgacactaacctggtttaaagctcctccaaagaagcctgataacaaagaacctgttctctatgacacccatgtcaacaaactggtggtagatgatacttgcactttagttattccgcagtctcgcaggagtgacactggcttatataccatcacagctgtaaataatctgggaacagcatcaaaggagatgagactgaatgtcctgggtcgtcctggccctccagtgggacccataaaatttgaatctgtttcagcagatcaaatgacactatcttggtttccacctaaagatgatggtgggtctaagattacaaactatgtaattgagaaaagagaagctaacaggaagacatgggtccatgtctccagtgaacctaaggagtgcacgtacacgattcccaaattgctagaaggccatgaatatgtattccgaatcatggcccagaataaatatggcattggagaacctcttgacagtgaacctgaaacagcaagaaacctcttctctgtccctggagcaccagataaaccaacagttagcagcgtgactcgtaactccatgactgtcaactgggaagagccagaatatgatggaggctctcctgtgacagggtactggctggaaatgaaagacaccacttcaaagagatggaagagagttaaccgagatcctatcaaagccatgactttgggtgtttcttataaagtgactggtcttattgaaggttccgactatcaattccgggtatatgcaatcaatgctgctggcgtgggtccagcaagtctgccatcagacccagcgactgctagagatccaattgcccctcctggtcctccatttcccaaagtgacagattggactaaatcatctgcagatctggagtggtctcccccactaaaagatggtggatccaaagtaactggatacatcgttgaatataaagaagaaggaaaagaagaatgggaaaagggtaaagataaagaagtgagaggaacaaagcttgttgtgacaggattaaaggaaggagcattctacaaatttagagttagagcagtcaacattgctggcattggagaacctggagaggtcacagatgtcattgaaatgaaggacagacttgtttcacctgaccttcagctagatgccagtgtcagagatagaattgttgtccatgctggaggggtgatccgaatcattgcctatgtgtctggaaagcctcctccaaccgtcacctggaacatgaatgaaagaaccttacctcaagaagccaccattgagaccacagccattagctcatccatggtcatcaagaactgccagaggagccatcaaggcgtctattctcttcttgccaaaaatgaagccggagaaagaaagaagacaattattgttgatgtattagatgttccaggtcccgttggaacaccattcctagctcacaacctaaccaatgagtcctgcaaactgacatggttttctccagaagatgatggaggctctccaatcaccaattatgtcattgaaaagcgtgaatctgaccgcagagcatggaccccagtgacatatacagttacccgacaaaatgctactgtccagggtctcattcaaggaaaagcctactttttccgaattgcggctgaaaatagtattggcatgggtccatttgttgagacatcagaggcacttgttatcagagagccaataactgtaccagagcgtcctgaagacctggaagtcaaagaagttactaaaaatactgtaactttgacttggaatcctcctaagtatgatggtgggtcagaaattattaactatgtcctagaaagtcggctcattgggactgagaagttccacaaagttacaaatgacaacttgcttagcagaaaatacactgttaaaggcttaaaagaaggtgatacctatgagtaccgtgtcagtgctgtcaacattgttggacaaggcaaaccatcattttgcaccaaaccaattacttgcaaggatgagctggcacccccaacgcttcacctcgacttcagagataagctcacgattcgagttggtgaagcttttgccctcactggccgttactcaggcaaaccaaagcctaaggtttcctggttcaaagatgaagctgatgtgctggaagatgatcgcactcatataaagactacaccagcaacacttgctttagagaagatcaaggccaaacgttcagattccggcaaatactgtgtggttgtggagaacagtacaggctctaggaaaggtttctgtcaagttaatgttgttgaccgtcctggaccaccagtaggaccagttagttttgatgaggtgaccaaagattacatggttatctcttggaagcctcctttagatgatggaggcagtaaaatcaccaattatattattgagaagaaggaagtgggtaaagacgtctggatgccagtgacatctgcaagtgctaaaacaacatgcaaagtttctaaactacttgaaggaaaagattatattttccggatacatgctgaaaatctgtatggaataagtgatcctctggtgtctgattcaatgaaagccaaagatcgtttcagggttcctgatgcacctgatcagccaattgttacagaagttaccaaagactctgcattagtaacctggaataagccacatgatggaggaaaacccatcacaaactacatcctggaaaagagagaaactatgtctaaacgatgggctagagttaccaaagatcctattcatccatacactaaatttagggttcctgatcttctagaaggatgtcagtatgaattccgggtttctgcagaaaatgaaattggtattggagatccaagcccaccatccaaaccagtctttgctaaagatccaattgctaaaccaagtccacctgttaatcctgaagcaatagatacaacatgcaattcagtcgatctaacttggcagccaccacgtcatgatggtgggagcaagattctgggttatattgttgagtaccagaaagttggagatgaagagtggagaagagccaatcacacccctgagtcatgtcctgaaactaaatataaagtcaccggtcttcgggacggtcaaacctataagtttagagtgttagcagtcaatgcagctggtgaatcagatccagctcatgttccggagccagtcctagtaaaagacaggcttgaaccccctgagttgattcttgatgccaacatggcaagagaacaacacattaaagttggtgatactctaagacttagtgccatcatcaaaggagtgccattcccaaaagtaacttggaaaaaagaagacagagatgctccaactaaagcaagaattgatgtgactccagttggtagcaagcttgaaattcgtaatgctgcccatgaagatggtggaatttattctttaacagtggagaatccagctggttcaaaaactgtctcagtaaaagtacttgtattagataaacctgggccacctagagatctggaagtcagtgaaattaggaaagattcatgttaccttacttggaaagaaccactggatgatggtggttctgttattaccaattatgtggttgagaggagagatgttgccagcgcccagtggtcacctctctcagctacatcaaagaaaaagagtcacttcgctaagcatctgaatgaaggcaaccagtacctcttccgagtagctgcggagaaccagtatggacgtggtccttttgttgaaacaccaaaaccaatcaaggctttggatcctctccatcccccagggccacccaaggacctgcaccatgtagatgttgacaagactgaagtctccctagtctggaataagccggatcgtgatggtggttctccaatcactggatatttggtagaatatcaagaagaaggcacccaggactggattaaatttaagactgtgacaaacttagagtgtgtggttactggactacaacaaggaaagacctatagattccgtgtaaaagctgaaaacattgtgggtcttggtctccctgacacaactatcccgatagaatgtcaagaaaaactagtgcctccatccgtggagctagatgtgaaattaattgaaggtcttgtggtaaaggctggaaccacagtcagattccctgctattataagaggtgtgcctgttcctactgcaaagtggacaaccgatgggagtgagattaaaaccgatgagcactacacagttgaaacagacaacttctcatcagtacttaccattaagaactgcttaaggagagacactggggaatatcaaatcacagtttccaatgcagccggtagcaaaacagtagccgtacatcttactgttcttgatgttcctgggccaccaacaggtcctattaatattctggatgttactcctgaacacatgactatctcatggcagccacctaaggatgatggaggaagccctgtgataaattatattgttgagaaacaagatacaaggaaagacacgtggggtgttgtctcttccggaagcagtaagacaaagctgaaaatcccacatctgcagaagggctgtgaatatgttttccgagttagagcagagaataagataggtgttggtcctccccttgactccacacctactgttgctaagcataaatttagtcctccgtctcctcctggtaaaccagtggttactgacattactgaaaatgcagcaacagtgtcttggaccctgccaaaatctgatggtggcagtccaataactggctactatatggaacgtcgagaagtaactggcaaatgggtgagggtcaacaaaacacctatcgctgacctgaagttcagagtgactggactctatgaaggaaatacatatgagtttagagtttttgctgaaaatcttgcaggactaagcaaaccatccccaagttctgatccaataaaagcttgccggcccatcaaaccacctggaccacctattaatcctaaactgaaagacaagagcagagaaacagctgatttggtgtggacaaagcctctcagtgatggtggtagccccattctaggatatgtagtggaatgtcagaaacctggcacagcacaatggaacaggattaataaagatgaactcattaggcaatgtgcctttagggtacctggactaattgaaggaaatgagtacagattccgtataaaggcagctaatattgtaggagagggtgagccaagagaactagcagaatctgtgattgcaaaagatatccttcatcctccagaagtagaacttgatgttacttgtcgtgatgttattaccgtgagagtaggccaaactatccgcattctagctcgagtcaaaggcagacctgaaccagacataacttggactaaggaaggcaaagtattggtccgagaaaagagggtggaccttattcaggatctacctcgtgttgagttacaaattaaagaagctgttagagctgatcatggcaagtatatcatctcagctaagaacagcagtggacatgcccaaggttcagccatcgttaacgtccttgacagacctgggccttgccagaatttgaaggttaccaatgtaaccaaagagaactgtacaatttcttgggaaaacccactagataatggtggctcagaaataacaaacttcatagtagaatatcgcaaaccaaaccagaaaggctggtcaattgttgcatcagatgtcactaaacgattaatcaaggccaaccttttagccaacaatgaatactatttccgagtttgtgcagagaataaagtaggtgttgggccaaccatcgaaacaaaaactcccattctggctattaaccctattgacagaccaggtgagcctgaaaaccttcacattgcagataaaggaaagacatttgtctatctaaagtggcggaggcctgactatgatggtggcagtccaaatctgtcatatcatgttgagagaaggcttaagggctccgatgactgggaaagagtgcataaaggaagcattaaagaaactcactacatggttgacagatgtgttgaaaaccagatttatgagttcagagtgcaaacaaagaatgaaggtggggaaagtgactgggtgaagacagaggaagttgttgtgaaagaagacttacaaaaaccagtacttgatctgaaattaagtggggtcctaactgtcaaagcaggggacaccattaggcttgaggcaggggttagaggcaaaccattcccagaagttgcatggaccaaggacaaagacgctacagacttaacaagatcaccaagggtcaagattgatacccgtgctgattcatctaaattttctcttactaaagcaaagcgaagtgatgggggtaaatatgtagttacggcaactaacacggctggcagttttgtggcctatgccactgtcaatgttttagataagcctggtcctgtgagaaatctgaaaattgttgatgtgtccagtgataggtgtactgtttgctgggatccaccagaagatgatggtggctgtgaaatccaaaattatattctagaaaaatgtgagacaaagcgaatggtttggtctacctattctgctactgtcttgacacctggtactacagtaacacgtctcatagaaggaaatgaatatattttcagagtccgtgcagaaaataaaataggcacagggcctccaacagaaagtaaaccagtcatagccaaaaccaagtatgataaacctggtcgccctgatcccccagaagtcactaaagtaagcaaagaagagatgactgtggtttggaatccacctgaatatgatggtggaaagtctataactggatactttttggagaaaaaggaaaagcattcaacacgatgggtccctgtcaacaagagtgcaatccctgagagacgtatgaaagtacagaatctcctcccagaccatgaatatcagttccgtgtcaaggcagaaaatgaaattggaattggagaaccaagcttgccttcaagaccggtggtggcaaaagaccccatagagccacctggtccaccaaccaatttcagagtggttgatacaaccaaacattccataactcttgggtggggaaaaccagtctatgatggtggtgcaccgatcattggatatgttgtggaaatgagaccaaaaatagcagatgcgtctcctgatgaaggctggaaacggtgtaatgctgcagcacagcttgtacgcaaggaattcactgttaccagcttggatgaaaaccaggaatatgagttcagggtgtgtgcccaaaaccaagttggtattgggcgccctgcagagctaaaggaagctatcaaacctaaagaaatactagaacctccggagattgatttggatgccagcatgaggaaactggtcatagtgagagcaggatgccctattcgtctctttgctatagtgagaggacgaccagcccctaaagtcacttggcgaaaagttggcattgataatgtggtcagaaaaggacaagttgatctggttgacactatggccttccttgtcatccccaattctacccgtgatgactcaggaaaatattccttaacacttgtgaacccagcaggagaaaaggctgtattcgtaaatgtcagagtattagacactcctgggcctgtgtctgatttaaaagtttcagatgtcactaaaacatcatgccatgtgtcctgggcccctcctgaaaacgacggtgggagccaagtgacacattatatcgtggagaaacgtgaggcagacagaaagacatggtcgaccgttaccccagaagttaagaaaacaagcttccatgtaaccaatcttgtccctgggaatgagtattacttcagagtaactgctgtcaacgaatatggccctggcgtcccaacagatgtcccaaaaccagtgcttgcatcagatcctctaagtgagccggatcccccaaggaaattagaagtgactgaaatgaccaagaacagtgccaccttagcctggttacctcccctacgtgatggaggtgctaaaatcgatggctacatcactagttacagagaagaagagcagcctgcagatcgctggacagagtactcagtggtaaaagatctgagccttgttgtcactggcctaaaggaaggaaagaaatacaaatttagagtagcggccagaaatgctgttggagtcagtttgccaagagaagctgaaggagtgtatgaagccaaagaacaactgttgccaccaaagatccttatgccagagcaaataactatcaaagctgggaaaaaactccgaattgaagcccatgtgtatggaaagcctcatcccacctgtaaatggaaaaaaggagaagatgaagttgtcacatccagccacctggcagtgcataaagcagacagctcttcaattctgatcataaaagatgtgactaggaaagacagtggttactacagcctcacagcagagaacagttctgggacagacactcagaaaatcaaagttgtagtcatggatgcccccggcccccctcagcctccatttgacatttctgatatagacgctgatgcttgctccctgtcatggcacatccctctggaggacggaggcagtaacatcaccaattatatagtggagaagtgtgatgtaagccgaggtgactgggtcacggctctagcttcagtcacaaaaacttcctgcagggttggaaagctgatcccaggccaggagtacatcttccgggtccgtgctgaaaaccgatttggcatttcagagcctctcacatctccaaagatggttgcgcagttcccatttggtgttcctagtgaaccaaagaatgcacgagtcaccaaagtcaacaaggactgtatttttgttgcttgggacagaccagatagtgatggagggagccccattattggttatctgattgaacgcaaggaaagaaacagtttgctgtgggtgaaagccaatgatactcttgtccggtcaactgaatatccttgtgctggccttgtagaaggtcttgagtattcattcagaatctatgccctaaacaaagctggatccagcccacccagcaaacccacagaatatgtaactgcaagaatgccagttgatcctcctgggaaacctgaggttattgatgtcaccaagagtactgtatctctgatctgggctcgtccaaagcatgatggaggcagtaaaattattggctatttcgtagaagcttgcaaacttcctggtgataaatgggtacggtgcaatactgcacctcaccagattccccaggaagagtacacagctactggcctagaagagaaagctcagtatcaatttagagctattgccaggaccgcggtaaacattagcccaccttctgaaccttctgatccagtgactatcctcgcagaaaatgtccctcccaggatagacctgagtgtggctatgaaatctttgcttactgtgaaagctggaactaatgtctgcttggatgctactgtttttggtaaaccgatgccaacagtttcttggaaaaaagatggcacactgctaaaaccagcagaaggcataaagatggccatgcagcggaatctgtgcaccttggagctattcagcgtgaaccggaaggactcaggagactataccattactgctgaaaattcaagtggttctaaatcagccaccattaagcttaaagtgttagataaaccgggtcctccagcatctgttaaaatcaacaaaatgtattcagatcgtgctatgctttcttgggaaccgcctcttgaagatggaggctcagaaatcaccaactatattgttgacaaacgtgaaacaagcaggcccaactgggctcaagtctctgcaactgtgcctatcaccagctgcagcgtggagaaacttatagagggccatgagtatcagttccgtatttgtgctgaaaataaatatggagtaggcgatccagtcttcactgaaccagcaattgccaaaaacccatatgacccaccaggacgctgtgatcctcctgttattagcaacataaccaaagatcacatgacagtcagctggaagccaccagcagatgatgggggctcacccatcactggctatttgcttgaaaagcgggaaacccaggctgttaactggactaaggtcaacagaaaacctattatagaaagaacattaaaagcaacaggtcttcaagaaggtaccgaatatgagttccgtgttacagctataaataaagctggaccaggcaaacccagtgacgcatccaaggccgcttatgctcgggaccctcagtatcctcctggcccaccggctttccctaaagtatatgatacaactcgcagctctgtgagtctatcttggggcaagccagcctatgacggcggcagccctatcattggttatctcgttgaagtaaaacgggctgactccgataactgggtgaggtgcaacttaccacagaatctacagaaaacccgctttgaggttactggcctgatggaagacacacaatatcaattccgtgtgtatgccgttaataagattggatacagtgaccccagtgatgtgccagataaacactatcccaaggacatcttaattccacctgagggagaacttgatgcggacttaaggaagacactcatattacgtgctggagttactatgagactatatgtaccagtaaaaggacgcccacctccaaagattacttggtctaaaccaaatgtcaatctaagagacaggattggactggacataaagtcaactgactttgacactttcttgcgctgtgaaaatgtgaacaaatatgatgcaggaaaatatatcttaaccctggagaacagctgtggtaaaaaggaatataccattgttgtgaaagtgcttgatactcctgggccacctgtcaatgtgactgttaaggaaatatccaaagactctgcttatgttacctgggagcctcccattattgatggcggaagccccatcataaactatgtggtacaaaaacgtgatgcagagaggaaatcctggtctacagtgacaactgagtgctccaaaacaagcttcagagtagctaatttggaggagggaaaatcctacttcttccgagtgtttgctgaaaatgagtatggcattggtgatcccggtgaaactcgtgatgctgtcaaagcttcccaaactcctggaccagttgtggacctgaaagtgaggtctgtatctaagtcatcctgtagcattggctggaaaaagcctcacagtgatggtggaagtcggattattggatatgtagttgatttcctgactgaagaaaataagtggcaacgagttatgaaatccttaagcctacagtactctgcaaaagatttgactgaagggaaggaatataccttcagagtgagtgctgagaatgaaaatggagaaggaaccccaagcgaaatcactgttgtggcaagggatgatgttgtggctcctgatcttgacttaaagggtctacctgatttgtgctacttggctaaagaaaacagcaacttccggcttaagatccccataaaaggcaagccagctccatcagtctcctggaagaaaggggaagatcctctagcaactgacactagagtcagtgttgagtcatctgcggttaacacaactcttatagtgtacgattgccaaaaatctgatgctggaaaatacacaatcacacttaagaatgttgctggcaccaaggaaggaactatctccataaaggttgttggcaagcctggcatccccactggaccaatcaaatttgatgaagtcacagcagaagccatgaccttaaagtgggctcctccaaaggatgatggaggttctgaaatcaccaactatatcctagagaagagggattctgtgaacaacaagtgggtgacgtgcgcctcagctgtccagaaaaccacctttagagtaaccagacttcatgagggcatggaatataccttcagggtcagtgccgaaaataaatatggtgtaggggaaggcctgaaatcggagccaattgttgcgagacatccatttgatgtgcctgatgctcccccacctcccaatattgtggatgtcagacacgattcagtatctctaacttggactgaccccaagaaaactggtggttctccaattacagggtatcatctcgagttcaaggaaagaaacagccttttgtggaagagagctaacaagactccgataaggatgagagactttaaagtgacaggattaactgaaggtcttgaatatgaattccgagttatggcaatcaatttagcaggtgtgggcaagccaagcctaccatcagagcctgttgtggcactggacccaattgatcctcctggaaaacctgaggttattaacataacaaggaattcagtgactctcatttggactgaacctaaatatgacggtggtcataagttaactggatatatagtggagaagcgagatctaccttcgaagtcttggatgaaagccaaccatgttaatgtcccagaatgtgcctttactgtaactgaccttgttgagggtggaaaatatgaattcagaattagagcaaagaatacagcaggtgctatcagtgctccatcagaaagtacagaaaccattatttgcaaggatgaatacgaggcaccaacaattgtccttgatcccacaataaaagatgggctaacaattaaagcaggggataccattgttttgaatgccattagcattcttggcaaaccccttccaaaatcaagttggtccaaggcaggaaaagacattagaccatcagatatcactcagataacttcaaccccaacatcttccatgcttactatcaagtatgccactagaaaagatgcgggtgaatataccatcactgctaccaatccttttggcacgaaggtggaacatgtgaaggtaacagtccttgatgtacctggtcccccaggtcctgttgaaatcagtaatgtttctgctgaaaaagcaacacttacatggacacctcccttggaagatggcggctcaccaattaagtcctatatacttgaaaagagagaaaccagccgacttttgtggacagtggtttctgaagatattcagtcttgcaggcatgtggcaaccaaacttatccaaggaaatgagtacatcttccgggtctcagctgtaaaccactatggcaaaggagaacctgtacagtctgaacctgtcaaaatggtagacagatttggtccccctggccctcctgaaaaaccagaggtatcaaatgtcactaagaacactgccactgtcagctggaaaaggccagtggatgatggtggcagcgaaattacaggatatcatgtagaaaggagagaaaagaaaagcctgcgatgggtgagagcaataaaaacaccagtttccgatctcaggtgcaaagtaacaggactgcaagaaggaagcacctacgaattccgtgtcagtgcagaaaacagagcaggaattggtccacccagtgaggcttcagattctgttctgatgaaagatgcagcatatcctccaggaccaccttcaaatccgcatgtcactgatactaccaagaaatctgcttctttggcatggggcaagcctcattatgatggtggacttgaaatcactggctatgtcgtggagcatcaaaaagtaggagacgaggcctggataaaagataccacaggaaccgccctcagaatcactcagttcgttgttcctgatcttcagactaaagaaaaatacaacttcagaatcagtgccatcaacgatgcaggtgttggggagccagcggtgattccagatgttgaaatcgtagaacgggagatggctcctgattttgaactagatgccgagcttcgaagaacacttgttgttagagcaggactcagtattaggatatttgtgccaattaaaggtcgtcctgctcctgaagtgacatggaccaaagataacatcaacctgaaaaaccgagccaacattgaaaatacggaatcatttactcttctgattatcccagaatgtaacagatatgataccggtaaatttgtcatgaccattgaaaacccggctgggaagaaaagtggctttgtgaacgtcagagtcttggacacgccaggcccagtcctcaacctgcggcctacagacatcacaaaggacagtgtcaccctgcactgggacctccctctgatagatggaggctcacgtataacaaactacattgtagagaaacgtgaagcaacacggaaatcttattccacagccaccactaagtgccataaatgcacatataaagttaccggcttgtctgaagggtgtgaatatttcttcagagtgatggcagagaatgaatatggaattggtgagccaacagaaactacagagcccgtaaaagcctctgaagcaccatctccaccagacagccttaacatcatggacataactaagagcaccgtcagcctggcatggcctaagcccaaacacgatggtggcagcaagatcactggctatgtgattgaagcccaaagaaaaggctctgaccagtggacccacatcacaaccgtgaaagggttagaatgtgttgtgaggaatctaactgaaggagaggaatataccttccaagtgatggcagtgaacagcgcggggagaagtgcccctagagaaagcagacccgtcattgtcaaggagcagacaatgcttccagagctggatctccgtggcatctatcagaaactggtcattgccaaagctggtgacaacatcaaagttgaaattccagtgctcggtcgaccgaagcccacagtgacatggaaaaaaggagaccaaattcttaaacagacacagagagttaattttgaaaccacagcgacttcaaccattttaaatatcaatgagtgtgtcagaagtgatagtgggccctatccattaacagcaaggaacattgtaggagaggttggtgatgtcatcaccattcaagtccatgatatcccagggccacctactggaccaatcaaatttgatgaagtttcatctgattttgtaaccttctcttgggacccacctgagaacgatggtggtgtaccaataagcaactatgtagtggaaatgcggcagactgacagtactacctgggttgagttagcaaccaccgttatacgtactacctataaagccacccgccttactactggattagagtatcagttccgtgtaaaagctcagaatagatatggagttggaccaggcatcacatcagcatgcatagttgccaactatccatttaaggttcctggacctcctggtacccctcaggtaactgcagttaccaaggattcaatgacaattagctggcatgagccactttctgatggtggaagccccattttaggatatcatgttgaaagaaaagaacgaaatggtattctctggcagactgtgagcaaagctttagtaccaggcaacattttcaaatcaagtggacttacagatggtattgcttatgagttccgggtgattgcagaaaacatggcaggcaaaagtaagccaagcaagccatcagaacctatgttggctctggatcccattgacccacctggaaaaccagtacctctaaatattacaagacacacagtaacacttaaatgggctaagcctgaatatactgggggctttaaaattaccagttatatcgttgaaaagagagaccttcctaatggacggtggctgaaggccaacttcagcaacattttggagaatgaatttacagtcagtggcctaacagaagatgctgcatatgaattccgtgtgatcgccaaaaatgctgcaggtgccatcagtccaccatctgagccatctgatgctatcacttgcagggatgatgttgaggcaccaaagataaaggtggatgttaaatttaaggacacggttatattaaaagcaggtgaagcattcagactggaagctgatgtttcaggccgcccacctccaacaatggaatggagcaaagatggaaaagagctggaaggcacagcaaagttagaaataaaaattgcagatttctctactaatctggtaaacaaagattcaacaagaagggatagtggtgcctatacccttacagcgactaatcctggtggctttgctaaacacattttcaatgtcaaagttcttgacagaccaggcccacctgaaggacctttggctgtaactgaagtgacatcagaaaagtgtgtactatcatggttccctccactggatgatggaggtgccaaaattgatcattacatagtacagaaacgtgaaaccagcagattggcatggacaaatgtagcctcagaagtccaagtaacaaagctaaaggtcactaaactcttgaaaggcaatgaatacatattccgtgtcatggctgtaaataaatatggagtgggagagccactggaatcagagcctgtgcttgcagtgaatccttatggaccccctgatccgcccaaaaaccctgaagtgacaactattactaaagattcgatggttgtctgctggggacatcctgattctgatggtggaagtgaaatcatcaattatattgtggaacggcgtgataaagctggccaacgctggattaaatgcaacaaaaaaactcttactgatttaagatataaagtgtctggactgacagaaggacatgaatatgagttcaggattatggctgaaaatgctgctggaattagtgcaccaagtcctaccagtccattttacaaggcttgtgacactgtgtttaaacctggaccaccaggtaacccacgtgttctggatacaagcagatcatccatttcaatcgcttggaataaacctatctatgatggtggttcagaaatcactgggtatatggttgagattgccctgccagaggaagatgaatggcagattgtcactccaccagcaggactcaaggcaacttcgtatactatcactggcctcacagagaatcaggaatataagatccgcatctatgccatgaattccgaaggacttggggaacctgcccttgttcctggaactccaaaggctgaagacagaatgctgcctccagaaattgaactggatgctgacctgcgcaaagttgttactataagggcctgctgcaccctgagactttttgttcccatcaaaggaaggcctgcacctgaggtgaagtgggcccgggaccatggagaatctttagataaagctagcatcgaatccacaagctcttacaccctgcttattgttggaaatgtaaacagatttgacagtggcaaatatatactaactgtagaaaatagttcaggcagcaagtctgcatttgtcaatgttagagttctcgatacaccaggccccccacaggatctgaaggtaaaagaggtcactaagacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaagaactatattgttgaaaagcgggaatcaacaagaaaagcatattcaactgttgcaacaaactgccacaagacttcctggaaggtagaccagcttcaagaaggctgtagctactatttcagggttctcgcagaaaatgaatatggcattgggctgcctgctgaaaccgcagaatctgtgaaagcatcagaacgacctcttcctccaggaaaaataactttgatggatgtcacaagaaatagtgtgtcactctcttgggagaaaccagagcatgatggaggcagccgaattctaggctacattgtggagatgcagaccaaaggcagtgacaaatgggccacgtgtgccacagtcaaggtcactgaagccactatcactggattaattcagggtgaagaatactctttccgtgtttcagctcagaatgaaaagggcatcagtgatcctagacaactgagtgtgccagtgatcgccaaagatcttgtcattccaccagccttcaaactcctgttcaatactttcactgtactggcaggtgaagacctaaaagttgatgttccattcattggccgccctaccccagctgtaacctggcataaagataatgtaccactgaagcagacaactagagtaaatgcagagagcacagaaaataattcactactgacaataaaggacgcctgccgagaagatgttggccattatgtggttaaactgactaactcagctggtgaagctattgaaacccttaatgttatcgttcttgacaaaccagggcctccaactggaccagttaaaatggatgaagtgacagctgatagtattactctttcctggggcccacccaagtatgatggtggaagttctatcaataattacattgttgagaaacgggacacttccacaaccacctggcaaattgtatcagctacagttgcaaggacaacaataaaggcttgcagactgaagactggatgtgaatatcagtttagaattgcagctgaaaacagatatgggaagagtacctacctcaattcagagcctactgtagcccaatatccattcaaagttcctggtcctcctggcactccagttgtcacactgtcctccagggacagcatggaagtacaatggaatgagccaatcagtgatggaggaagtagagtcattggctatcatctagaacgcaaggaaagaaatagcatcctctgggttaagttgaataaaacacctattcctcaaaccaagtttaagacaactggccttgaagaaggtgttgaatatgaatttagagtctctgcagagaacatcgtgggcattggcaagccgagtaaagtatcagaatgttatgtggctcgtgacccatgtgatccaccaggacggccagaggcaatcattgtcacaaggaattctgtgactcttcagtggaagaaacccacctatgacggtggaagcaagatcactggttatattgttgagaagaaagaattacctgagggccgttggatgaaagccagttttacaaatattattgacactcattttgaagtaactggcctagttgaagatcacagatatgagttccgggttatagcccgaaatgccgcaggagtgtttagtgagccttcagaaagcacaggagcaataacagctagagatgaggtagatccaccacgaataagtatggatccaaaatacaaagacacaatcgtggttcatgctggtgaatcattcaaggttgatgcagatatttatggcaaaccaataccaaccattcagtggataaaaggtgatcaggagctttcaaacacagctcgattagaaataaagagcaccgactttgccaccagtctcagtgtaaaagatgcagtacgtgtcgacagtggaaattacatactgaaggccaaaaatgttgcaggagaaagatcagttactgtgaatgtcaaggttcttgacagaccagggccacctgaaggacctgttgttatctcaggagttacagcagaaaaatgcacactagcttggaaacccccacttcaggatggtgggagtgacatcataaattatattgtggaaaggagagaaaccagccgcttagtttggactgtggttgatgccaatgtgcagactctcagctgcaaggttactaagcttcttgaaggcaatgaatatactttccgtataatggcagtaaacaaatatggtgttggtgaacctcttgaatctgagccagtagttgccaagaatccatttgtagtaccagatgcaccaaaagctccagaagtcacaacagtgaccaaggactcaatgattgttgtatgggaaagaccagcatctgatggtggtagtgaaattcttggatatgttcttgagaaacgggataaagaaggcattagatggacaagatgccataagcgtctgattggagagttgcgcctgagagtaactggactcatagaaaatcacgattatgagttcagagtttctgctgagaatgctgctggacttagtgaaccaagccctccttctgcttaccaaaaggcttgtgatcctatttataaaccaggacccccaaacaaccccaaagtcatagacataaccagatcttcagtattcctttcttggagcaaaccaatatatgatggtggctgtgaaattcaaggatacattgttgaaaaatgtgatgtgagtgttggtgaatggacaatgtgcactccaccaacaggaattaataaaacaaacatagaagtagagaagctgttggaaaagcatgaatacaacttccgtatctgtgctattaataaagctggagttggagaacatgctgacgtccctggacctattatagttgaagaaaaattagaagcaccagacattgatcttgacctagaactaaggaaaatcataaatataagggcaggtggctccttaaggttatttgttcctataaaaggtcgtcctacaccagaagttaaatggggaaaggtggatggtgaaatccgagatgcagctataattgatgtcactagcagtttcacctctcttgttcttgacaatgtcaaccgatatgatagtggaaaatatacgcttacattagaaaacagcagtggaacaaagtctgcctttgttactgtgagagttctggacacgccaagtccacctgttaacctgaaagtcacagaaatcaccaaagactcagtatcaattacatgggaacctcctttgttggatgggggatccaaaataaaaaattacattgttgagaaacgtgaagccacaagaaaatcatatgctgctgttgtaactaactgccataagaattcttggaaaatcgatcagctccaagaaggttgcagttattactttagagtcacagctgagaatgagtatggtattggccttcctgcccagactgctgatccaattaaggttgcagaagtgccacaacctcctggaaaaataactgtggatgatgtcaccagaaacagtgtctctctgagttggacaaaacctgaacatgatggtggcagtaaaatcattcagtatattgtggaaatgcaagctaaacacagtgagaaatggtcagagtgtgctcgagtaaagtctcttcaggcagtaattaccaacctaactcaaggggaagaatatctttttagagttgttgctgtaaatgaaaaggggagaagtgatcctcggtcccttgcagttccaatagttgccaaagatctggtaattgagccagatgtaaaacctgcattcagtagttacagtgtacaggttggccaagatttgaaaatagaagtgccaatttctggacgtcctaagccaaccattacctggactaaagatggtctcccactgaagcagaccacaagaatcaatgttaccgattcactggatctcaccacactcagtattaaagaaactcataaggatgatggtggacaatatggaatcacagttgccaatgttgttggtcagaagacagcatccatcgaaattgtaactctagataaacctgatcctccaaaaggacctgttaaatttgatgacgtcagtgctgaaagtattacattatcttggaaccctccattatatacagggggctgccaaatcaccaactacattgttcagaaaagagatacaaccaccacagtatgggatgttgtttctgctactgttgctagaactacactcaaagtgaccaaactgaaaactggtacagaataccaatttagaatatttgccgaaaacagatatggacaaagctttgccttagagtctgatccaattgtagctcaatatccctacaaagaaccaggccctccaggtacaccatttgccacagccatttccaaagactccatggtcatacagtggcatgaaccagtcaacaatggtggaagccccgtcataggttaccacctggagagaaaagaaagaaacagtattttgtggacaaaggtcaacaaaactattattcatgacacccaattcaaagcacagaatcttgaagaaggcattgaatatgaattcagagtgtatgctgaaaatattgttggtgtaggcaaagcaagcaagaattctgaatgctatgtagccagagatccctgtgacccaccaggaaccccagaaccaataatggttaaaagaaatgaaatcactttacagtggaccaaacctgtgtatgatggtggaagtatgattacaggctacattgtagagaaacgtgatttgcctgatggtcgttggatgaaagctagctttacaaatgtcattgaaactcaatttactgtgtcaggtcttactgaagatcaaagatatgaattcagagtcattgcaaagaatgcagctggtgcaataagtaaaccctctgacagtactggaccaataactgccaaggatgaggttgaactcccaagaatttcaatggatccaaaattcagagacacaattgtggtaaatgctggagaaacattcagacttgaggctgatgtccatggaaagcccctacctaccattgagtggttaagaggagataaggaaattgaagaatctgctagatgtgaaataaagaacacagatttcaaggctttacttattgtaaaagatgcaattagaattgatggtgggcagtatattttaagagcttccaatgttgcaggttctaagtcattcccagtaaatgtaaaagtattagatagaccaggacctccagaagggccagtccaggttactggagtcacttctgaaaaatgctctttaacatggtctccaccacttcaagatggtggcagtgacatttctcactatgttgttgaaaagcgagaaaccagtcgacttgcctggactgttgttgcttcagaagttgtgaccaattctctgaaagttaccaaactcttagaaggtaatgaatatgttttccgtataatggctgtcaacaaatatggtgttggagagcctttggaatctgcaccagtactaatgaaaaatccatttgtgcttcctggaccaccaaaaagcttggaagtcacaaatattgccaaagactccatgaccgtctgttggaaccgtccagatagtgatggtggaagtgagattattggttacattgtagagaaaagagacagaagtggcattcgatggataaaatgtaataaacgccgcattacagatttgcgtctaagagtgacaggattaacagaagatcatgagtatgaattcagggtctctgcagaaaatgctgctggagttggggaaccaagtccagctacagtttattataaagcctgtgatcctgtgttcaaacctggcccacctaccaatgcacacattgtagacaccactaaaaattcaatcacacttgcctggggtaaacccatctatgatggcggcagtgagatcttgggatatgtagtagaaatctgtaaagcagatgaagaagaatggcaaatagttactccacagactggcctgagagtcactcgatttgaaatttcaaaactcactgaacaccaagagtataaaatacgagtctgtgccctcaacaaagttggtttaggtgaggctacatcagttcctggtactgtgaaaccagaagataaacttgaagcacctgaacttgaccttgactccgaattaagaaaaggaattgttgtaagagctggtggatctgccagaattcacattccattcaaaggtcgtccaacgcctgagatcacttggtctcgagaggaaggtgaattcacagataaggtccaaattgaaaagggagtaaactatacccaactatcaatagataactgtgatagaaatgatgctggaaaatacattcttaagttggaaaacagcagtggatcaaagtctgcttttgtaactgtgaaagttcttgacactccaggaccaccacagaatttggcagtcaaagaagtgagaaaagattctgccttcctggtatgggagccacccatcattgatggaggggcaaaggtcaagaactatgtgattgacaaacgtgagtcaaccagaaaagcgtatgctaatgtgagtagtaaatgcagcaaaacaagttttaaagtggaaaaccttacagaaggagccatttattacttcagagtcatggctgaaaatgaatttggagttggtgttccagtggaaactgttgatgccgtgaaagctgctgaacctccttccccaccaggaaaggttacactcactgatgtgtcccagaccagtgcatcacttatgtgggagaaacctgaacatgatggcggtagcagagtcctggggtacgttgttgaaatgcagcccaaaggaactgaaaaatggagcattgtggctgaatccaaagtctgtaatgcagttgttactggtttgagttctggacaagaatatcagttccgtgtcaaggcttataatgagaaaggaaaaagcgatccaagagtgttgggtgttcctgtcatagccaaggacttgactatacagcctagtttaaagttaccatttaacacatatagtatccaagctggagaagatcttaaaatagaaattccagttataggccgaccaagacctaacatttcttgggtcaaagatggtgagcctcttaaacagacaacaagagtaaacgttgaagaaacagctacctcaactgttttgcacattaaagaaggtaacaaagatgactttggaaaatacaccgtaacggcaacaaatagtgcaggcacagcaacagaaaatctcagtgttatcgttttagaaaagcctggacctccagttggcccagttcggtttgatgaagttagtgcagactttgtagtcatatcttgggaacctccagcctatactggtggctgccaaataagcaactacattgtagagaagcgagatacaaccaccaccacttggcacatggtatcagcaacagttgcaagaacaacaattaaaataaccaaactgaaaacaggcacggagtaccagtttagaatttttgctgaaaacaggtatggaaaaagtgccccactggattctaaggcagttattgtacaatatccatttaaagaacctggaccacctggaactccttttgtgacatcaatctcaaaagatcagatgcttgtgcaatggcatgagccagtgaatgatggaggcaccaaaattattggctaccatcttgaacagaaagaaaagaacagtattttatgggtcaagttaaataagacccccattcaggacaccaaattcaaaacaactgggcttgatgagggccttgagtatgagttcaaagtttctgctgaaaatattgttggcattggcaagcctagcaaagtgtcagaatgctttgttgctcgtgatccatgtgacccacctggtcgccctgaagccattgttattacaagaaacaatgtcacactgaaatggaagaaacctgcctatgatggtggtagcaaaataacaggttatattgtagaaaagaaagatctacctgatggccgctggatgaaagccagctttaccaacgtattagaaactgaatttacagtgagtggacttgtagaagaccaaagatatgaatttagagtaattgcaagaaatgcagctggaaactttagtgaaccatctgatagtagtggtgccattactgcaagagatgaaattgatgcaccaaatgcctctctggatccaaaatataaagatgtcatcgttgttcatgcaggagagacttttgttcttgaagccgacatccgtggcaaacctatacctgatgttgtttggtcaaaagatggaaaagaacttgaagaaacagctgctagaatggaaattaaatctactattcagaaaacaactcttgttgtcaaagactgtatacggactgatggaggacaatatattctgaaactcagcaatgttggtggtacaaagtctatacccatcactgtaaaggtacttgacaggccagggcctcctgaagggcctctgaaagttactggagttactgcggaaaaatgttacctggcatggaacccacctttgcaagatggtggtgctaatatttcacattacatcattgaaaagagggagacaagccgactctcttggacccaggtttcaactgaggtacaggcccttaactacaaagttactaaacttcttcctggtaatgagtacattttccgtgtcatggctgtgaataaatatggaattggagagcccttggaatctgggcctgttacggcctgtaatccttataagccaccaggtcctccctcaacacctgaagtctcagcaatcaccaaagattctatggtagtaacatgggcacgcccagtagacgacggaggtaccgaaattgagggctacattcttgaaaaacgagataaggaaggcgttagatggaccaagtgcaacaagaaaacattaacggatctgcggctcagggtaactggtcttaccgaaggccattcctatgaattcagagttgctgctgaaaatgcagctggtgtgggagaacctagtgagccatctgttttctaccgtgcgtgtgatgccttgtatccaccaggtcccccaagcaatccaaaagtgacggacacttccagatcttctgtctccctggcatggagtaagccaatttatgatggtggcgcacctgttaaaggctatgttgtagaggtcaaagaagctgctgcggatgaatggacaacctgcactccaccaacaggattacaaggaaagcagttcacagtgaccaagcttaaagaaaacactgaatataacttccgtatttgtgccatcaattctgaaggtgtaggtgaacctgcaactctacctggctcagtggttgctcaggagaggatagagccaccagaaatagaactcgatgctgatctcagaaaggtggtcgttctgcgtgcaagtgctactttacgcttatttgtcactatcaaaggtcgaccagaacccgaagttaaatgggaaaaggcagaaggcattctcactgacagggctcagatagaggtgaccagctcatttacaatgttggtgattgataatgttaccagatttgacagtggtcggtataatctgacattagaaaataatagtggctccaaaacagcttttgttaacgtcagagttcttgactcaccaagtgcccctgtgaatttgaccataagagaagtgaagaaagactcagtgacgttgtcctgggaaccaccacttattgatggtggagctaagattacaaactacattgtcgaaaaacgagaaactacaagaaaagcctatgctaccattacaaataattgcactaaaactactttcagaattgaaaatctacaagaaggatgttcttactacttccgagtcttggcttccaatgaatatgggattggtttgccagctgaaacaacagaacccgttaaagtgtctgaaccacccctcccacctggaagagtaactcttgttgatgtgacccgtaatacagctacaattaagtgggagaaaccagaaagtgatggtggcagcaaaattactggttatgtggttgaaatgcagactaaagggagtgaaaagtggagcacctgcacacaagttaagactctagaagcaactatatctggcttaactgcaggagaagagtatgtcttcagggtagctgcagttaacgaaaagggaagaagtgatccaagacaacttggagtgccagtaattgcaagggatattgaaataaagccttcagttgagcttcctttccatactttcaatgtaaaggctagagaacaacttaagattgatgtgccattcaaaggaagacctcaagctactgtgaactggagaaaagatggtcagactcttaaagagacaactagagtcaatgtttcttcttcaaagactgtaacatcactatctattaaggaagcttcaaaggaagatgttggaacttatgaattatgtgtttcaaacagtgctggatccataacagttcctattactataattgtccttgacagaccaggacctccaggtcctatacgtattgatgaggttagttgtgacagcataaccatttcttggaatcctccagaatatgatggtggctgccaaattagcaattacattgttgaaaagaaagaaaccacctctacaacatggcacatagtttcacaagcagttgcaagaacatccattaaaatagttcgcctgacaacaggaagtgagtatcagttccgtgtttgtgcagaaaaccgctatggaaagagctcctacagtgaatcttcagctgttgttgcagagtatccattcagtcccccaggtcctcctggtactcctaaagttgtgcatgccacaaaatctaccatgcttgtaacctggcaagtgccagttaatgatggaggaagtcgagtaattggctatcatcttgagtataaagaaagaagcagcattctttggtcaaaagcaaataaaatcctcattgctgatactcaaatgaaagtctccggccttgatgaaggactgatgtatgagtatcgtgtatatgctgaaaatattgctggaattggtaaatgcagtaaatcttgtgaaccagtccctgcaagagatccttgtgaccctcctggacaacctgaagtcacaaatatcacaagaaaatcagtgtcacttaaatggtctaaaccacattatgatggtggagctaagatcacaggatacattgttgaacgcagagaactaccagatggccggtggctgaagtgcaattatactaatatacaagaaacatactttgaagtaactgaacttactgaagatcagcgttatgaattccgggtttttgcaaggaatgctgctgactcagttagtgagccatctgaatccactgggcctattatagttaaagatgatgttgagcctccaagagttatgatggatgtcaagttccgagacgttattgttgtcaaagctggagaggtccttaagataaatgcagacattgcagggcgacctctgccagtaatttcctgggccaaggatggtatagaaattgaagaaagagcaagaacagaaatcatctcaacagacaatcatactttgttaacagttaaagactgtataagacgagacactgggcaatatgtactaacactgaagaatgttgccggcactcggtctgtggccgttaattgcaaagtacttgataagcctggtccaccagcaggaccacttgaaataaatggcctcactgctgagaaatgctctctttcctggggacgtccccaagaagatggtggtgcagatatcgactattacatcgtagaaaaacgtgaaacaagccaccttgcatggacaatatgtgaaggagagttacagatgacatcctgtaaagtaaccaagttactcaaaggcaatgaatatatatttagagtaactggtgttaataaatatggtgttggtgagcccctagagagtgtagctataaaggcactagatccatttacagttccaagtccacccacgtctttggaaattacttctgtgaccaaagaatctatgacactttgctggtcaagacccgagagtgatggaggtagtgaaatatctggatatataattgaaaggcgagagaaaaatagcctaagatgggtgcgtgtaaacaaaaaaccagtttatgatctaagagtgaaatcaacaggacttcgggaaggatgtgaatatgaatatcgtgtttatgcagaaaatgctgctggcctaagtcttccaagtgaaacctctcccttaattagggcagaagatccagtgttcctaccatctcctccatccaaacccaaaattgtggactcaggcaagacaactataactattgcctgggttaagccgctgtttgatggtggggccccgataactggatatactgtagaatacaaaaaatctgatgacactgactggaaaacttccattcagagcttacgagggacagaatatacaataagcggactaacaacaggagctgaatatgttttcagagtaaaatctgtcaataaggttggtgctagtgaccccagtgatagctctgaccctcagatagcaaaggaaagagaagaagaacctttatttgatattgacagtgaaatgaggaagaccttgattgtcaaggctggtgcctcatttaccatgactgtgcctttccgaggaagaccagtacccaatgtcttgtggagtaagccagacactgacctccgtactagagcttatgttgataccacagactctcgtacatcactgaccattgaaaatgccaacagaaatgactctggaaagtacacattaacaattcagaatgttttgagtgctgcttcactgaccttagttgtcaaagttttagataccccaggtcctccaaccaacattactgtgcaagatgtaaccaaagagtctgcagtgttatcctgggatgttcctgaaaacgatggtggagcaccagtgaagaattaccacatagaaaaacgtgaggccagcaagaaagcatgggtctctgtgaccaacaactgtaaccgcctctcctacaaagttaccaatttacaagaaggagctatctattacttcagagtctctggagaaaatgagtttggtgttggtataccagctgaaacaaaggaaggagtaaaaataacagaaaaaccaagcccacctgaaaaacttggagtaacaagtatatccaaagacagtgtttccctgacctggctgaagcctgaacatgatggcggaagcagaattgtacactatgtcgttgaagcactagaaaaaggacagaaaaactgggttaaatgtgcagtggcaaagtcaacccatcacgttgtttccggtctgagagagaattctgaatactttttccgagtgtttgctgaaaatcaagctggcctgagtgacccgagagagcttctgcttcctgttcttattaaggagcaactagaaccacctgaaattgatatgaagaatttcccaagtcacactgtatatgttagagctggttcaaaccttaaagttgacattccaatctctggaaaaccacttcccaaagtgaccttatcaagagatggtgtcccccttaaggcaaccatgagatttaataccgaaattactgctgagaacctgaccatcaatctcaaagaaagtgttacagctgacgctgggagatatgaaatcactgctgccaactccagtggtacaaccaaagctttcattaacattgttgtgctagacaggcctggtcctccaactggccctgttgttattagtgatataactgaagaaagtgtgactctcaaatgggagccacctaagtatgacggtggaagtcaagttaccaactacattctactcaaaagagaaacaagtactgcagtgtggactgaagtgtctgcaacagttgcaagaaccatgatgaaagtcatgaaactgaccacaggagaagaataccaattccgcatcaaggcagaaaaccgctttggcatcagtgatcatatagattcagcttgtgtgactgtcaaactaccatacacaacacctggaccaccatctacaccatgggtcactaatgttactcgagaaagcatcactgtgggctggcatgaaccagtgtcaaatggaggcagtgcagtcgtaggctatcacctggaaatgaaagacagaaacagtattttatggcaaaaagccaacaaactggtcatccgcacaactcacttcaaagtcacaacaatcagtgctggacttatttatgaattcagggtgtatgcagaaaatgctgctggagttggaaaacctagccatccttctgaaccagtcttggcaattgatgcttgtgaacccccaagaaatgttcgtatcactgatatttcaaagaactctgtcagcctttcatggcaacaaccagctttcgatggaggtagcaagattacaggctacattgttgagagacgtgaccttccagatggcagatggaccaaggccagcttcaccaatgttactgaaactcaattcatcatctctggcttgactcagaattcccagtatgaattccgtgtctttgctaggaatgctgttggttccattagcaatccatctgaggttgtagggcccattacttgcatcgattcttatggtggtcctgtaattgatttgcctctagaatatacagaagttgtcaaatacagagcaggtacatctgtgaagctcagagctggcatttctggcaaacctgcgcctactattgagtggtataaagatgataaagaattacaaaccaatgcactggtgtgtgttgaaaataccacggacctcgcatctatactcatcaaagatgccgatcgccttaatagtggatgctatgaattaaaactaaggaatgccatgggctcagcctcagccaccatcagagtacagatccttgacaaaccaggcccacctggtggaccaattgaatttaagactgtaactgctgagaagatcacccttctctggcggcctccagctgatgatggtggtgcaaaaatcactcactacattgtggaaaagcgtgagacaagccgcgttgtgtggtctatggtgtctgaacatttggaagagtgcatcattacaaccaccaaaattatcaaaggaaatgaatacatcttccgggtccgagccgtgaacaaatatggaattggcgagccactggaatctgattccgttgtagccaagaacgcatttgttacacctgggccaccaggcataccagaagtgacaaagattaccaagaattcgatgactgttgtatggagcaggccaattgcagatggcggtagtgatataagtggctatttccttgaaaaacgagacaagaagagcctaggatggtttaaagtactaaaagagactatccgtgacaccagacaaaaagtaacaggactcacagaaaacagtgactatcaatacagagtttgtgctgtaaacgctgctggacagggtccattttctgaaccatctgaattctacaaagctgctgatcctattgatcctccaggtccacctgctaagataagaatcgcagattcaaccaagtcatccatcacccttggctggagtaagcctgtctatgatgggggcagtgctgttactgggtatgttgtcgagataagacaaggagaggaagaggaatggactactgtctctaccaaaggagaggtcagaactacagaatatgtggtatccaacctgaaacctggagtcaattactacttccgggtatctgctgtaaactgtgctggacaaggagaacctatagaaatgaatgaacctgtacaagctaaagatatacttgaggcaccagagattgacctggatgtggctctcagaacttctgttattgccaaagctggtgaagatgtacaagtgttgattccctttaaaggcagacctccacctactgtcacatggagaaaagatgagaagaatcttggcagtgatgccagatacagcattgaaaacactgattcatcctcattactcaccattcctcaagttactcgcaatgatacaggaaaatatattctcacaatagaaaatggagttggtgaacctaagtcttcaactgtgagtgttaaagtgcttgacacaccagctgcctgccagaaactacaggttaaacatgtttctcgaggcacagtcactttgctctgggatcctcctctcattgatggaggatctccaataattaattatgtcattgaaaagagagatgccaccaagagaacatggtctgtcgtgtcacacaaatgttctagcacatccttcaagctaatagatttgtcggagaagactccattcttcttcagagttcttgcagaaaatgaaattggaattggggaaccctgtgaaactacagagccagtgaaggctgctgaagtaccagctcctatacgtgatctctcaatgaaagactcaacaaagacatctgtcatcctcagctggaccaaacctgactttgatggtggtagcgtcatcacagaatatgttgtagaaaggaaaggtaaaggtgaacagacgtggtcccacgctggcataagtaagacatgtgaaattgaggttagccaacttaaggagcagtcagtcctggagttcagagtgtttgccaaaaatgagaaaggactgagtgatcctgtcactattgggccaattacagtgaaagaacttattattacacctgaagttgacctgtcagatatccctggggcacaagtcactgtgagaattgggcacaatgtgcaccttgaattaccttataagggaaaacccaaaccatccatcagttggctgaaagatggcttgccactgaaagaaagtgaatttgttcgcttcagtaaaactgaaaacaaaattactttgagtattaagaatgccaagaaggagcatggaggaaaatacactgttattcttgataatgcagtgtgtagaattgcagtccccattacagtcatcacccttggcccaccatcaaagcccaaaggacccattcgatttgatgaaatcaaggctgatagtgtcatcctgtcatgggatgtacctgaagataatggaggaggagaaattacttgttacagcatcgagaagcgggaaacttcacaaactaactggaagatggtgtgttcaagtgttgccagaacgactttcaaagttcctaatctagtcaaagatgctgagtaccagtttagagtgagagcagaaaacagatacggagtcagccaaccacttgtctcaagcattattgtggcaaaacaccagttcaggattcctggtcccccaggaaagccagttatatacaatgtgacttctgatggcatgtcactaacttgggatgctccagtttatgatggtggttcagaagttactggattccatgttgaaaagaaagaaagaaatagcatcctctggcaaaaagttaatacatcaccaatctctggaagagaatatagagccactggactggtagaaggtctggattaccaattccgtgtatatgctgaaaattctgctggcctaagctcacctagtgacccaagcaaatttaccttagctgtttctccagtagacccacctggcactcctgactacattgatgtcacccgggaaaccatcacacttaaatggaacccaccattgcgtgatggaggcagtaagattgtgggctatagcattgagaaacggcaaggaaatgaacgctgggtgagatgcaactttactgacgtcagtgaatgtcagtacacagttacaggactcagtcctggggatcgctatgagttcagaataattgcaagaaatgctgttggaactataagcccgccctcacagtcttctggcattattatgacaagagatgaaaatgttccaccaatagtagagtttggccctgaatactttgatggtctcattattaagtccggagagagccttagaattaaagctttggtacaaggaagaccagtgcctcgagtaacttggttcaaagatggagtggaaatcgaaaagaggatgaatatggaaataaccgacgtacttggatccaccagcctatttgttagagatgctactcgggaccatcgtggtgtatacacagtggaagccaaaaatgcatctggttctgcaaaagcagaaattaaagtgaaagtacaagatacaccaggaaaagtagttgggccaataagattcaccaatattactggggagaagatgactctgtggtgggatgccccactcaatgacggttgtgctcccataacccactacatcattgaaaaacgggaaaccagcagacttgcctgggcactaattgaggataaatgtgaagcccaaagttacactgccattaaactaataaacggcaatgaataccaattccgtgtttctgcagttaacaagtttggtgttggcaggccacttgattctgatccagtggttgctcaaatacaatatactgttcctgatgcccctggcattccagaacctagcaacataacaggcaacagcattaccctgacatgggcaaggccagaatcagatggtggcagtgaaattcaacagtatatccttgaaagaagagaaaagaaaagcacaagatgggtaaaagtgatcagcaaacgaccaatctctgaaacaagattcaaagtcactggtctgacagaaggcaatgagtatgaattccatgtcatggctgaaaatgctgcaggagttggacctgcaagtggcatctcaagactcattaaatgtagagagcccgtcaacccaccaggtcctcccacagtggtcaaagtaacagacacatcaaagacaactgtgagcttagaatggtccaaaccagtgtttgatggtggcatggaaataattgggtatattattgaaatgtgtaaggccgacttaggagactggcacaaggtgaatgcagaggcatgtgtgaaaacaagatatacagtcactgatctacaagcaggtgaagaatacaaattccgagttagtgctatcaatggtgctggaaaaggcgacagctgtgaagtgactggcacaattaaagcagttgaccggttaacagctcctgagttagacatagatgcaaacttcaaacagactcatgttgttagagctggggccagtattcgcctcttcattgcctaccaaggtagacctactcctacagctgtgtggagcaaaccagactctaaccttagccttcgggctgatatccatacaacagattccttcagcaccctcactgtggaaaactgcaacagaaatgatgcagggaaatatacccttactgtggaaaacaacagtggtagtaagtcaatcacattcaccgtgaaagtgctagacactccaggcccacctggcccaattaccttcaaagatgtgacccggggatctgctacattgatgtgggatgcccctcttcttgacggtggtgcccgaatccatcattatgtggtagagaaacgagaggcaagtcgccgtagttggcaggttatcagtgaaaaatgcactcgtcagatcttcaaggtcaatgacctggccgaaggtgttccgtactatttccgtgtttctgcagtaaatgagtatggtgttggtgagccctatgaaatgccagaaccaattgtagccacagaacagcctgctccacctaggagacttgatgttgttgatactagcaaatcctccgcagtcttagcttggcttaaacctgaccacgatggaggcagccggatcactggctacctgcttgaaatgagacaaaagggatctgacttctgggttgaagctggtcacaccaaacagctaactttcacagtagagcgtcttgttgagaaaactgaatatgaattccgtgtgaaggccaagaatgatgctggctatagtgaacccagagaagccttctcttctgtcatcattaaggagcctcaaatcgagcccactgctgacctcactggaattaccaatcagcttataacttgcaaagcaggaagcccatttaccattgacgtaccaatcagtggtcgtcctgcccccaaagtaacatggaaactggaagaaatgagacttaaagagacagatcgagtgagcattacaacaacaaaagacagaaccacactgactgtaaaggacagcatgagaggtgactctggaagatacttcttgaccctggaaaatacagctggtgttaaaacatttagcgtcacagttgtggtcattggaaggccaggtccagtaaccggccccattgaggtctcatctgtctcagctgaatcgtgtgtcctgtcatggggagaacctaaagatggaggaggcactgaaattactaattacatagttgaaaagcgtgaatcgggtacaacagcttggcagcttgtcaattccagtgtcaagcgcactcaaattaaagtcactcatctcacaaaatacatggaatattctttccgtgtcagttcagagaacagatttggtgtcagcaaacctctagaatcagcaccaataattgctgaacatccatttgtcccaccaagcgctcctaccagacctgaggtctaccatgtgtctgccaatgccatgtctattcgttgggaagaaccctaccacgatggtggcagtaaaatcattggctactgggttgagaagaaagaacgtaatacaattctttgggtgaaagaaaacaaagtgccatgcttagagtgcaactacaaagtaactggtttagtagaaggactggaatatcagttcagaacttatgcactcaatgctgcaggtgttagcaaggccagcgaagcttcaagacctataatggctcaaaatccagttgatgcaccaggcagaccagaggtgacagatgtcacaagatcaacagtatcactgatttggtctgccccagcgtatgatggaggcagcaaggttgtgggctacatcatagagcgtaagccagtcagtgaggtaggagatggtcgctggctgaagtgcaactacaccattgtatctgacaatttcttcaccgtgactgctctcagtgaaggagacacttatgagttccgtgtgttagccaagaatgcagcaggcgtaattagcaaagggtctgaatctacaggccctgtcacttgccgagatgaatacgctccacccaaagccgaactggatgcccgattacacggtgatctggttaccatcagagcaggttctgatcttgttctggatgctgcagttggtggcaaacctgaacccaaaattatctggaccaaaggagacaaggagctagatctctgtgaaaaagtctctttgcagtatactggcaaacgagcaactgctgtgatcaagttctgtgacagaagtgacagtggaaaatacactttaacagtgaaaaatgccagcgggaccaaggccgtgtctgtcatggtcaaagtgcttgattcccctggcccatgtggaaagctcaccgtcagcagagtaacacaggagaagtgcactttagcctggagccttccgcaggaagacggaggagcagaaatcactcactacatcgtggaaagacgcgagactagcaggctcaactgggtgattgttgaaggcgaatgcccaaccctatcctatgtcgttaccaggctcatcaagaacaatgagtacatattccgagtgagggcagtaaacaaatatggccctggtgtgcctgttgaatcagagccaattgtagccagaaactcattcactattccatcaccacccggcatacctgaagaagttgggactggcaaagagcatatcatcattcagtggacaaaacctgaatctgatggtggcaatgaaatcagcaactacctagtagacaaacgtgagaagaagagcctgcgctggacacgtgtcaacaaagactatgtggtgtatgataccaggctgaaggtgaccagcctgatggagggttgtgattaccagttccgggtgaccgcagtgaatgcagctggtaacagtgagcccagcgaagcttccaacttcatctcatgcagagaaccatcatatacccctggaccaccttctgctccaagagttgtggataccaccaaacacagcattagtttggcatggaccaaacccatgtacgatggtggtactgacattgtaggatatgttctggaaatgcaagagaaggacactgatcagtggtaccgagtgcataccaatgccacaataagaaatactgaattcactgtgccagaccttaaaatgggccagaaatattccttcagagttgctgccgtgaacgtgaagggtatgagcgaatacagcgaatcaattgctgaaattgagcccgtggaaagaatagaaataccagatcttgagcttgcagatgatctaaagaagactgtgaccatcagggctggggcctccttgcgcttgatggtgtctgtatctggaagaccacctcctgtcataacgtggagcaagcagggcattgaccttgcaagccgggcaattattgacaccactgagagctactcattgctaatagtggacaaagttaatcggtacgatgctggaaaatacacaattgaagctgaaaaccaatctggcaagaaatcagcaacagtccttgttaaagtctatgatactcctggtccctgtccttcagtgaaagttaaggaagtatcaagagattctgtgactataacttgggaaattcccacgattgatggtggagctccagtcaacaattacatcgttgagaagcgtgaagctgctatgagagcattcaaaacagtaactaccaaatgcagcaagacactttacagaatttctggacttgtagaaggaaccatgtactatttcagagtgctgccagaaaatatttatggcattggagaaccttgtgaaacatctgatgcagtactggtctcagaagtgcctttggtgcctgcaaagctagaagtggtcgatgtcaccaaatccactgttacccttgcctgggaaaaaccactctacgatggtggtagccgactcactggatatgttctcgaggcctgcaaagctggcacagagagatggatgaaggttgtcaccttaaaacccacagtcctagagcacactgttacttccttaaatgaaggtgaacaatacttatttagaataagggcacaaaatgagaaaggtgtgtcagaaccaagagagactgtcacagccgtgactgtacaagacctcagagtgttgccaacaatcgatctttctacaatgcctcagaagaccatccatgtcccagctggcagaccagtagagctggtgatacctattgctggccgtccacctcctgctgcttcctggttctttgctggttctaaactgagagaatcagagcgtgtcacagttgaaactcacactaaagtagctaaattaaccatccgtgaaaccactatcagagatactggagaatacacacttgaattgaagaatgttaccggaactacttcagaaaccattaaagttatcattcttgacaagcctggtccaccaacaggacctattaagattgatgaaattgatgctacatcaattaccatttcctgggaaccacctgaattggacggtggtgctccactgagtggttatgtggtagaacaacgtgacgctcatcgtccaggatggctgcccgtttctgaatcagtgactaggtccacgtttaagtttaccagactcaccgaaggaaatgagtatgtgttccgtgtggctgcaacaaaccgcttcgggattggctcttacttgcagtctgaggtcatagagtgtcgcagcagcatccgtattcctggacccccagaaacattacagatatttgatgtttcccgtgatggcatgacacttacttggtacccaccagaggatgacggtggctcccaagtgactggatatattgtggagcgcaaagaagtgagagcagatcgatgggtccgtgtaaataaagtacctgtgacaatgacacggtaccgctccactggccttactgaaggcttagaatatgaacaccgtgtcacagccattaatgcaagagggtctgggaaaccaagtcgtccttccaaacccatcgttgccatggatccaattgctcctccaggaaagccacaaaacccaagagttactgatacaacaaggacatcagtctccctggcctggagtgttccagaagatgaaggaggatctaaagtcacaggctacttgattgaaatgcaaaaagtagatcaacatgaatggaccaagtgtaacaccactccaaccaagattcgagagtatactctaacacacctacctcagggtgcagaatacaggttccgcgtcctagcttgtaatgctggtggacctggtgagcctgctgaggtaccaggaacagtcaaagtcactgaaatgcttgaatatcctgattatgaacttgatgaaagataccaagaaggtatctttgtaaggcaaggtggcgtcatcagacttaccataccaatcaaaggaaaaccattcccaatatgtaaatggaccaaggaaggccaggatattagtaagcgtgccatgattgcaacatctgaaacacacactgagcttgtgatcaaagaagcagacaggggtgattctggcacttatgacctggttctggaaaataaatgtggcaagaaggctgtctacatcaaggtcagggtgataggaagtcccaacagtccagaagggccactggaatatgatgacatccaagtccgctctgtgagggtcagctggagacctcctgctgatgatggtggtgctgacatcttaggctacatcctcgagagacgagaagtgcctaaagccgcctggtataccattgattccagagtccgaggtacatctctggtggtaaaaggcctcaaagagaatgtagaataccatttccgtgtttcagcagaaaaccagtttggcataagcaaacccttgaaatctgaggaaccagtcacaccaaaaacaccattgaatcctccagaacctccaagcaatcctccagaagtactcgatgtaaccaagagttctgttagcttgtcctggtcccggcccaaagatgatggtggttctagagtcacaggctactacatcgaacgcaaagagacatccactgacaagtgggtcagacacaacaagactcagatcaccaccacaatgtacactgtcacagggcttgttcccgatgctgagtatcagttccgcatcatcgcacagaatgatgttggcctgagtgagaccagccctgcttctgaaccagttgtttgcaaagatccatttgataaaccaagccaaccaggagaacttgagattctttcaatatccaaagatagtgtcactctacagtgggagaaacctgaatgtgatggtggtaaagaaattcttggatactgggttgaatatagacagtctggagacagtgcctggaagaagagcaataaggaacgtattaaggacaagcaattcacaataggaggtttgctggaagctactgagtatgaattcagggtttttgctgagaatgagactgggctgagcagacctcgcagaactgctatgtctataaagactaaactcacatctggagaggccccaggaatacgcaaagaaatgaaggatgttaccacaaaattgggtgaagctgctcaactctcatgccagattgttggaaggcctcttcctgacattaaatggtacagatttggtaaagagctcatacaaagccggaaatacaaaatgtcttcagatggacgcacacacactcttacagtaatgacagaggaacaggaagatgaaggtgtttatacctgcatagccaccaatgaggttggagaagtagaaaccagtagtaagcttctcctgcaagcaacaccgcagttccatcctggttacccactgaaagagaaatattatggagctgtgggttccacacttcggcttcatgttatgtacattggtcgtccagtacctgccatgacttggttccatggtcagaaacttttgcaaaactcagaaaacattactattgaaaacactgagcactatactcatcttgtcatgaagaatgtccaacgtaagactcatgctgggaaatacaaagtccagctcagcaatgtttttggaacagttgatgccatccttgatgtggaaatacaagataaaccagacaaacctacaggaccaattgtgatcgaagctctattgaagaactccgcagtgatcagctggaaaccacccgcagatgacggaggctcctggatcaccaactatgtggtggaaaaatgtgaggccaaggagggggctgaatggcaattggtgtcttcagccatctcagtgacaacctgtagaattgtgaacctcacagaaaatgctggctattacttccgggtttcagctcagaacactttcggcatcagtgaccctctagaagtgtcctcagttgtgatcattaagagtccatttgaaaagccaggtgctcctggcaaaccaactattactgctgtcacaaaagattcttgtgttgtggcctggaagccacctgccagtgatggaggtgcaaagattagaaattactaccttgagaagcgtgagaagaagcagaataaatggatttctgtgacaacagaagaaattcgagaaactgtcttttcagtgaaaaaccttattgaaggtcttgaatacgagtttcgtgtgaaatgtgaaaatctaggtggggaaagtgaatggagtgaaatatcagaacccatcactcccaaatctgatgtcccaattcaggcaccacactttaaagaggaactgagaaatctaaatgtcagatatcagagcaatgctaccttggtctgcaaagtgactggtcatccaaaacctatcgtcaaatggtacagacaaggcaaagaaatcattgcagatggattaaaatataggattcaagaatttaagggtggctaccaccagctcatcattgcaagtgtcacagatgatgatgccacagtttaccaagtcagagctaccaaccaagggggatctgtgtctggcactgcctccttggaagtggaagttccagctaagatacacttacctaaaactcttgaaggcatgggagcagttcatgctctccgaggtgaagtggtcagcatcaagattcctttcagtggcaaaccagatcctgtgatcacctggcagaaaggacaagatctcattgacaataatggccactaccaagttattgtcacaagatccttcacatcacttgttttccccaatggggtagagagaaaagatgctggtttctatgtggtctgtgctaaaaacagatttggaattgatcagaagacagttgaactggatgtggctgatgttcctgacccacccagaggagtcaaagttagtgatgtctcacgagattctgtcaacttaacatggactgagccagcctctgatggtggcagcaaaatcaccaactacattgttgaaaaatgtgcaactactgcagaaagatggctccgtgtaggacaggcccgagaaacacgttataccgtgatcaacttatttggaaaaacaagttaccagttccgggtaatagctgaaaataaatttggtctgagcaagccttcagagccttcagaaccaaccataaccaaagaagataagaccagagctatgaactatgatgaagaggtagatgaaaccagggaagtctccatgactaaagcatctcactcttcaaccaaggaactctatgagaaatatatgattgctgaagatcttgggcgtggtgagtttggaattgtccatcgttgtgttgaaacatcctcaaagaagacatacatggccaaatttgttaaagtcaaagggactgatcaggttttggtaaagaaggaaatttccattctgaatattgctaggcatagaaacatcttacacctccatgaatcatttgaaagcatggaagaattagttatgatctttgagtttatatcaggacttgacatatttgagcgcattaacacaagtgcttttgaacttaatgaaagagaaattgtaagttatgttcaccaggtctgtgaagcacttcagtttttacacagtcataatattggacactttgacattagaccagaaaatatcatttaccaaaccagaagaagctctaccattaaaatcatagaatttggtcaagcccgtcagctgaaaccaggggacaacttcaggcttctattcactgccccagaatactatgcacctgaagtccaccagcatgatgttgtcagcacagccacagacatgtggtcacttggaacactggtatatgtgctattgagtggtatcaacccattcctggctgaaactaaccaacagatcattgagaatatcatgaatgctgaatatactttcgatgaggaagcattcaaagagattagcattgaagccatggattttgttgaccggttgttagtgaaagagaggaaatctcgcatgacagcatcggaggctctccagcacccatggttgaagcagaagatagaaagagtcagtactaaagttatcagaacattaaaacaccggcgttattaccacaccctgatcaagaaagacctcaacatggttgtgtcagcagcccggatctcctgtggtggtgcaattcgatctcagaagggagtgagtgttgctaaagttaaagtggcatccattgaaattggcccagtttctgggcagataatgcatgcagttggtgaagaaggaggacatgtcaaatatgtatgcaaaattgaaaattatgatcagtctacccaagtgacttggtactttggcgtccgacagctggagaacagtgagaaatacgaaatcacctacgaagatggagtggccatcctctatgtcaaagacattaccaaattagatgatggtacctacagatgcaaagtagtcaatgactatggtgaagacagttcttatgcagagctatttgttaaaggtgtgagagaagtctatgactattactgccgtagaaccatgaagaaaattaagcgcagaacagacacaatgagactcctggaaaggccaccagaatttaccctgcctctctataataagacagcttatgtaggtgaaaatgtccggtttggagtaactataactgtccacccagagcctcatgtaacatggtataaatcaggtcagaaaatcaaaccaggtgacaatgacaagaagtacacatttgagtcagacaagggtctttaccaattaacaatcaacagtgtcactacagatgatgacgctgaatatactgttgtggcaaggaacaaatatggtgaagacagctgtaaagcaaagctgacagtaaccctacacccacctccaacagatagtaccttaagacccatgttcaaaaggttactggcaaatgcagaatgccaagaaggccaaagtgtctgctttgagatcagagtgtctggcatccccccaccaacattaaaatgggagaaagatggtcagccactgtccctcgggcctaacattgaaattatccatgaaggcttggattattatgctctgcacatcagggacactttgcctgaagacacgggttattatagagtcacagccactaacacagctgggtccaccagctgccaggctcacctacaagtggaacgcctgaggtacaagaaacaggaattcaagagtaaggaggagcatgagcgacacgtacaaaaacaaattgacaaaaccctcagaatggctgaaattctttctggaactgaaagtgtaccactgacacaggtagctaaagaggctctgagagaagctgctgtcctttataaaccggctgtaagcaccaagactgtaaaaggggaattcagacttgagatagaagaaaagaaggaggagagaaaactccggatgccttatgatgtaccagagccacgcaagtataagcagactaccatagaagaagaccaacgcatcaagcagttcgtgcccatgtctgacatgaagtggtataaaaagatacgtgatcagtatgaaatgcctgggaaacttgacagagttgtacagaaacgacccaagcgcatccgcctttcaagatgggaacagttctatgtgatgcctcttccacgcattacagatcaatacagacctaaatggcgtattcctaaactgtcccaagatgatcttgagatagtgagaccagcccgccggcgtacaccttctcctgattatgacttttactaccgacctagaagacgttctcttggggacatctctgatgaagaattactcctccccattgatgactacttagcaatgaaaagaacagaggaagagaggctgcgtcttgaagaagagcttgagttaggtttttcagcttcacccccaagtcgaagccctccacactttgagctttctagcctacgttactcttcaccacaagctcatgtcaaggtggaggaaacaagaaaagacttcaggtattcaacctatcacatcccaacgaaggctgaagctagtacaagttatgcagaactgagggaacggcatgcccaggctgcgtacagacagccaaagcaacggcaaagaatcatggctgagagggaggatgaagagttgcttcgcccagttacgaccacccagcatctctcagaatacaaaagcgaacttgacttcatgtcaaaggaggaaaagtctagaaagaaatcaaggcgacaaagagaagtgacagaaataacagaaattgaggaagaatacgaaatctcaaaacatgctcaaagagaatcatcctcatctgcgtctagactactgagacgacggcgctccctgtctccaacttatattgagttaatgaggccagtgtctgagctgatccggtcacgtccacaaccggctgaggaatacgaagatgacacagaaagaaggtcacctactccagagagaactcgcccacgatcccccagccctgtgtctagtgagagatcactctcgagatttgagaggtctgcaagatttgatatcttttccaggtatgagtccatgaaagctgctttaaaaactcagaagacatcagaaaggaagtatgaagttttgagtcagcagcctttcacactggaccatgcccctcgaatcacactgagaatgcgctcgcacagggtaccatgtggccaaaatacacgttttattttaaatgttcagtctaagccaactgccgaggttaaatggtaccacaatggtgtggaactccaagaaagcagtaagattcattacaccaacacgagtggagtcctcaccctggaaattctggactgtcatactgatgacagtggaacctaccgtgctgtgtgcaccaactacaagggcgaagcttctgactatgcaacgttggacgtgacaggaggggattataccacctatgcttcccaacgcagagatgaagaggtccccagatctgttttccctgagctgacaagaacagaggcgtatgctgtttcatcatttaagaaaacatctgagatggaagcttcgtcttctgtcagggaagtgaaatcacagatgacggagacaagggaaagtctctcctcatatgaacactctgcatctgcagaaatgaaaagtgctgcattagaagaaaagtcactggaagaaaaatccacaaccagaaagatcaagacgactttggcagcaagaattctaacaaagccacggtccatgaccgtctacgagggcgagtctgcaaggttttcttgtgacaccgatggtgagccggtaccaactgtgacctggctgcgtaaaggacaagtgctaagtacttctgcccgccaccaagtgaccaccacaaagtacaaatcaacctttgagatctcttcagtccaggcttccgatgagggcaattacagcgtggtggtagaaaacagtgaagggaaacaagaagcagagttcactctgactattcaaaaggccagggtaactgaaaaggctgtgacatcaccaccaagagtcaaatccccagagcctcgggtgaaatccccagaagcagttaagtctccaaaacgagtgaaatctccagaaccttctcacccgaaagccgtatcacccacagagacaaaaccaacaccaacagagaaagttcagcacctcccagtctctgccccaccaaagattactcagttcctgaaagcagaagcttctaaagagattgcaaaactgacctgtgtggttgaaagcagtgtattaagggcaaaagaggtcacctggtataaagatggcaagaaactgaaggaaaatgggcatttccagtttcattattcagcagatggtacctatgagctcaaaatcaataacctcactgaatctgatcaaggagaatatgtttgtgagatttctggtgaaggtggaacgtctaaaaccaacttacaatttatggggcaagcctttaagagtatccatgagaaggtatcaaaaatatcagaaactaagaaatcagatcagaaaaccactgagtcaacagtaaccagaaaaactgaaccaaaagctcctgaaccaatttcctcaaaaccagtaattgttactgggttgcaggatacaactgtttcttcagacagtgttgctaaatttgcagttaaggctactggagaaccccggccaactgccatctggacaaaagatggaaaggccattacacaaggaggtaaatataaactctctgaagacaagggagggttcttcttagaaattcataagactgatacttctgacagtggactttatacttgtacagtaaaaaattcagctggatctgtgtcctctagctgcaaattaacaataaaagctataaaagatactgaggcacagaaagtctctacacaaaagacttctgaaattacacctcagaagaaagctgttgtccaagaggaaatttcccaaaaagccctaaggtctgaagaaattaagatgtcagaggcaaaatctcaagaaaagttagccctcaaagaggaagcttcaaaggttctgatttctgaagaagtcaagaaatcagcagcaacctccctggaaaaatccattgtccatgaggaaatcactaaaacatcacaggcatcagaagaagtcagaactcatgctgagattaaagcattttctactcagatgagcataaacgaaggtcaaagactggttttaaaagccaacattgctggtgccactgatgtgaaatgggtactgaatggcgtagagcttaccaactctgaggagtaccgatatggtgtctcaggcagcgatcagaccctaaccatcaagcaagccagtcacagagatgaaggaatcctcacctgcataagcaaaaccaaggaaggaatcgtcaagtgtcagtatgatttgacactgagcaaagaactctcagatgctccagccttcatctcacagcctagatctcaaaatattaatgaaggacaaaatgttctctttacttgtgaaatcagtggcgagccatcccctgaaatcgaatggtttaaaaacaacctgccaatttctatttcttcaaatgtcagcataagccgctccagaaatgtatactcccttgaaatccgaaatgcatcagtcagcgacagtggaaagtacacaattaaggccaaaaatttccgtggccagtgttcagctacagcttccttaatggtccttcctctagttgaagaaccttccagagaggtagtattgagaacaagtggtgacacaagcttgcaaggaagcttctcgtctcagtcagtccaaatgtctgcctccaagcaggaggcctccttcagcagtttcagcagcagcagtgctagcagcatgactgagatgaaatttgcaagcatgtctgcccaaagcatgtcctccatgcaagagtcctttgtagaaatgagttccagcagctttatgggaatatctaatatgacacaactggaaagctcaactagtaaaatgcttaaagcaggcataagaggaattccgcctaaaattgaagctcttccatctgatatcagcattgatgaaggcaaagttctaacagtagcctgtgctttcacgggtgagcctaccccagaagtaacatggtcctgtggtggaagaaaaatccacagtcaagaacaggggaggttccacattgaaaacacagatgacctgacaaccctgatcatcatggacgtacagaaacaagatggtggactttataccctgagtttagggaatgaatttggatctgactctgccactgtgaatatacatattcgatccatttaagagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacggactaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaatgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatataatacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagttttgtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggagaaagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacatactgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtccacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaatcagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgtcttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaagtgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctgaatagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtattcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgtggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagcaaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaattgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagttataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctcaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7273 -> Molecular function: GO:0002020 [protease binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IMP
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: ISS
            GeneID:7273 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0043621 [protein self-association] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051015 [actin filament binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:7273 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0002576 [platelet degranulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0003300 [cardiac muscle hypertrophy] evidence: IMP
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0007076 [mitotic chromosome condensation] evidence: IEP
            GeneID:7273 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030240 [skeletal muscle thin filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0030241 [skeletal muscle myosin thick filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0035995 [detection of muscle stretch] evidence: TAS
            GeneID:7273 -> Biological process: GO:0043056 [forward locomotion] evidence: IEA
            GeneID:7273 -> Biological process: GO:0045214 [sarcomere organization] evidence: IMP
            GeneID:7273 -> Biological process: GO:0045859 [regulation of protein kinase activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048739 [cardiac muscle fiber development] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048769 [sarcomerogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0050790 [regulation of catalytic activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0051592 [response to calcium ion] evidence: IDA
            GeneID:7273 -> Biological process: GO:0055003 [cardiac myofibril assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0055008 [cardiac muscle tissue morphogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:7273 -> Cellular component: GO:0000794 [condensed nuclear chromosome] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005865 [striated muscle thin filament] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0030018 [Z disc] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IEA
            GeneID:7273 -> Cellular component: GO:0031674 [I band] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_003310 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.