GGRNA Home | Help | Advanced search

2020-10-26 19:39:06, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003098               2345 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens syntrophin, alpha 1 (SNTA1), mRNA.
ACCESSION   NM_003098
VERSION     NM_003098.2  GI:18765742
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2345)
  AUTHORS   Harisseh,R., Chatelier,A., Magaud,C., Deliot,N. and Constantin,B.
  TITLE     Involvement of TRPV2 and SOCE in calcium influx disorder in DMD
            primary human myotubes with a specific contribution of
            alpha1-syntrophin and PLC/PKC in SOCE regulation
  JOURNAL   Am. J. Physiol., Cell Physiol. 304 (9), C881-C894 (2013)
   PUBMED   23426965
  REMARK    GeneRIF: Calcium homeostasis mishandling in Duchenne muscular
            dystrophy myotubes depends on store operated calcium entry under
            the influence alpha1-syntrophin regulation as well as
            TRPV2-dependant cation influx.
REFERENCE   2  (bases 1 to 2345)
  AUTHORS   Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
            and Makielski,J.C.
  TITLE     Digenic inheritance novel mutations in SCN5a and SNTA1 increase
            late I(Na) contributing to LQT syndrome
  JOURNAL   Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
   PUBMED   23376825
  REMARK    GeneRIF: The combined mutations of A261V-SNTA1 plus R800L-SCN5A
            increase the INa current late/peak ratio and time constants of
            current decay.
REFERENCE   3  (bases 1 to 2345)
  AUTHORS   Bhat,H.F., Baba,R.A., Bashir,M., Saeed,S., Kirmani,D., Wani,M.M.,
            Wani,N.A., Wani,K.A. and Khanday,F.A.
  TITLE     Alpha-1-syntrophin protein is differentially expressed in human
            cancers
  JOURNAL   Biomarkers 16 (1), 31-36 (2011)
   PUBMED   21091386
  REMARK    GeneRIF: In contrast to stomach, lung, colon and rectal cancers,
            SNTA1 protein was found to be downregulated in esophageal cancers
            and upregulated in breast cancer.
REFERENCE   4  (bases 1 to 2345)
  AUTHORS   Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
            Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
            Aloisi,F., Petrucci,T.C. and Ambrosini,E.
  TITLE     MLC1 trafficking and membrane expression in astrocytes: role of
            caveolin-1 and phosphorylation
  JOURNAL   Neurobiol. Dis. 37 (3), 581-595 (2010)
   PUBMED   19931615
REFERENCE   5  (bases 1 to 2345)
  AUTHORS   Cheng,J., Van Norstrand,D.W., Medeiros-Domingo,A., Valdivia,C.,
            Tan,B.H., Ye,B., Kroboth,S., Vatta,M., Tester,D.J., January,C.T.,
            Makielski,J.C. and Ackerman,M.J.
  TITLE     Alpha1-syntrophin mutations identified in sudden infant death
            syndrome cause an increase in late cardiac sodium current
  JOURNAL   Circ Arrhythm Electrophysiol 2 (6), 667-676 (2009)
   PUBMED   20009079
  REMARK    GeneRIF: Alpha1-syntrophin mutations identified in sudden infant
            death syndrome cause an increase in late cardiac sodium current.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 2345)
  AUTHORS   Iwata,Y., Pan,Y., Yoshida,T., Hanada,H. and Shigekawa,M.
  TITLE     Alpha1-syntrophin has distinct binding sites for actin and
            calmodulin
  JOURNAL   FEBS Lett. 423 (2), 173-177 (1998)
   PUBMED   9512352
REFERENCE   7  (bases 1 to 2345)
  AUTHORS   Gee,S.H., Madhavan,R., Levinson,S.R., Caldwell,J.H., Sealock,R. and
            Froehner,S.C.
  TITLE     Interaction of muscle and brain sodium channels with multiple
            members of the syntrophin family of dystrophin-associated proteins
  JOURNAL   J. Neurosci. 18 (1), 128-137 (1998)
   PUBMED   9412493
REFERENCE   8  (bases 1 to 2345)
  AUTHORS   Castello,A., Brocheriou,V., Chafey,P., Kahn,A. and Gilgenkrantz,H.
  TITLE     Characterization of the dystrophin-syntrophin interaction using the
            two-hybrid system in yeast
  JOURNAL   FEBS Lett. 383 (1-2), 124-128 (1996)
   PUBMED   8612778
REFERENCE   9  (bases 1 to 2345)
  AUTHORS   Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
            Kunkel,L.M.
  TITLE     The three human syntrophin genes are expressed in diverse tissues,
            have distinct chromosomal locations, and each bind to dystrophin
            and its relatives
  JOURNAL   J. Biol. Chem. 271 (5), 2724-2730 (1996)
   PUBMED   8576247
REFERENCE   10 (bases 1 to 2345)
  AUTHORS   Yang,B., Jung,D., Rafael,J.A., Chamberlain,J.S. and Campbell,K.P.
  TITLE     Identification of alpha-syntrophin binding to syntrophin triplet,
            dystrophin, and utrophin
  JOURNAL   J. Biol. Chem. 270 (10), 4975-4978 (1995)
   PUBMED   7890602
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U40571.1 and AU118614.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Feb 19, 2002 this sequence version replaced gi:4507136.
            
            Summary: Syntrophins are cytoplasmic peripheral membrane scaffold
            proteins that are components of the dystrophin-associated protein
            complex. This gene is a member of the syntrophin gene family and
            encodes the most common syntrophin isoform found in cardiac
            tissues. The N-terminal PDZ domain of this syntrophin protein
            interacts with the C-terminus of the pore-forming alpha subunit
            (SCN5A) of the cardiac sodium channel Nav1.5. This protein also
            associates cardiac sodium channels with the nitric oxide
            synthase-PMCA4b (plasma membrane Ca-ATPase subtype 4b) complex in
            cardiomyocytes. This gene is a susceptibility locus for Long-QT
            syndrome (LQT) - an inherited disorder associated with sudden
            cardiac death from arrhythmia - and sudden infant death syndrome
            (SIDS). This protein also associates with dystrophin and
            dystrophin-related proteins at the neuromuscular junction and
            alters intracellular calcium ion levels in muscle tissue. [provided
            by RefSeq, Jan 2013].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC026215.2, U40571.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2345
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20q11.2"
     gene            1..2345
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="syntrophin, alpha 1"
                     /db_xref="GeneID:6640"
                     /db_xref="HGNC:11167"
                     /db_xref="HPRD:03009"
                     /db_xref="MIM:601017"
     exon            1..582
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    117..119
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="upstream in-frame stop codon"
     CDS             273..1790
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="pro-TGF-alpha cytoplasmic domain-interacting
                     protein 1; acidic alpha 1 syntrophin; syntrophin-1; 59 kDa
                     dystrophin-associated protein A1 acidic component 1;
                     syntrophin, alpha 1 (dystrophin-associated protein A1,
                     59kDa, acidic component)"
                     /codon_start=1
                     /product="alpha-1-syntrophin"
                     /protein_id="NP_003089.1"
                     /db_xref="GI:4507137"
                     /db_xref="CCDS:CCDS13220.1"
                     /db_xref="GeneID:6640"
                     /db_xref="HGNC:11167"
                     /db_xref="HPRD:03009"
                     /db_xref="MIM:601017"
                     /translation="
MASGRRAPRTGLLELRAGAGSGAGGERWQRVLLSLAEDVLTVSPADGDPGPEPGAPREQEPAQLNGAAEPGAGPPQLPEALLLQRRRVTVRKADAGGLGISIKGGRENKMPILISKIFKGLAADQTEALFVGDAILSVNGEDLSSATHDEAVQVLKKTGKEVVLEVKYMKDVSPYFKNSTGGTSVGWDSPPASPLQRQPSSPGPTPRNFSEAKHMSLKMAYVSKRCTPNDPEPRYLEICSADGQDTLFLRAKDEASARSWATAIQAQVNTLTPRVKDELQALLAATSTAGSQDIKQIGWLTEQLPSGGTAPTLALLTEKELLLYLSLPETREALSRPARTAPLIATRLVHSGPSKGSVPYDAELSFALRTGTRHGVDTHLFSVESPQELAAWTRQLVDGCHRAAEGVQEVSTACTWNGRPCSLSVHIDKGFTLWAAEPGAARAVLLRQPFEKLQMSSDDGASLLFLDFGGAEGEIQLDLHSCPKTIVFIIHSFLSAKVTRLGLLA
"
     misc_feature    528..773
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(561..572,576..578,723..728,735..740)
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    837..839
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13424.1); phosphorylation site"
     misc_feature    837..839
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    849..851
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13424.1); phosphorylation site"
     misc_feature    849..851
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03868"
     misc_feature    873..875
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03868"
     misc_feature    1161..1469
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl00273"
                     /db_xref="CDD:206947"
     misc_feature    order(1161..1181,1215..1235,1242..1262,1311..1322,
                     1365..1379,1404..1418,1443..1469)
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /note="PH-like core; other site"
                     /db_xref="CDD:176275"
     misc_feature    1719..1787
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q13424.1);
                     Region: Calmodulin-binding (By similarity)"
     exon            583..768
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     exon            769..973
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     variation       827
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34995247"
     variation       949
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34479952"
     exon            974..1181
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     variation       1100
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35938843"
     exon            1182..1312
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     exon            1313..1509
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     variation       1362
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046815"
     exon            1510..1697
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     exon            1698..2340
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /inference="alignment:Splign:1.39.8"
     variation       1760
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34901081"
     variation       2072
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3171370"
     STS             2145..2297
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /standard_name="RH41835"
                     /db_xref="UniSTS:24593"
     STS             2161..2307
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /standard_name="A006C20"
                     /db_xref="UniSTS:59624"
     STS             2161..2307
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /standard_name="G32321"
                     /db_xref="UniSTS:116914"
     STS             2181..2330
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /standard_name="D20S724"
                     /db_xref="UniSTS:53376"
     variation       2243
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3177492"
     polyA_signal    2301..2306
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
     polyA_site      2340
                     /gene="SNTA1"
                     /gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
cccttctgacccaccccgctaggtagtcccacacggcggccctcggctcccgggccccgccccggcctcctgcatttgcccgaggccccctccccagcactggccacaccccagggtagccccgcccccagagctcctcccccagcggccggggtagggtggcggctggcccagccgggcccccgctgccctctgccctgggcgcttggtcggagcgggctgggcaaagcgggacagggcgagcgcggcggcccgggggctcggaggcgaagatggcgtccggcaggcgcgccccgcgcaccgggctgctggagctgcgcgccggggcgggctcgggggccggcggcgagcgatggcagcgggtgctgctgagtctggcggaggacgtgctgaccgtgagccccgccgacggcgaccctggtcccgagcccggcgctccgcgggagcaggagcccgcgcagctcaacggcgccgcggagccgggcgccgggcccccgcagctgccagaggcgctactgctccagcggcgccgcgtgacggtgcgcaaggccgacgccggtgggctgggcatcagcatcaaaggcggccgggagaacaagatgcctattctcatttccaagatcttcaagggattggcagctgaccagacagaggccctttttgtgggggatgccatcctgtctgtgaatggggaagacttgtcctctgctacccatgatgaggcggtgcaggtcctcaagaagacaggcaaggaggtggtgctggaggtcaagtatatgaaggacgtctcaccgtatttcaagaactctactggtgggacctcggtcggctgggactcacctcctgcctcaccccttcagcggcagccttcctcccctggccccacaccccggaacttcagcgaggccaaacacatgtccttgaagatggcatatgtctcgaagaggtgcacccccaatgacccggagcccaggtatctggagatctgctcggcagatggtcaagacaccctcttcctgagggccaaggatgaggctagtgcgaggtcgtgggcgactgccatccaagcccaggtcaatactctgacgccgcgggtcaaggatgagctgcaggcactgttggcagccaccagcacagctgggagccaggacatcaagcagattggctggctaactgagcagctgcccagtgggggcacagcccccaccctggccctgctaactgaaaaggaactgctcctctacttgtctctccccgagacccgcgaggccctgagccggccagcccgtactgccccactcatcgccaccagactggtgcactcaggcccctccaagggctcagtgccctacgatgcagagctctcttttgccctgcgcacgggcacgcgtcacggtgtggacactcacctgttcagcgtggagtcaccgcaggagctggctgcctggacccgccagcttgtggatggctgtcaccgggccgccgagggtgtgcaggaggtgtctacagcctgcacgtggaatgggcgtccctgcagcctgtctgtgcacatcgacaagggcttcacactgtgggcggctgagccaggtgcagcccgagctgtgctcctgcgacagcccttcgagaagctgcagatgtcttcagatgacggtgccagtctccttttcctggattttggaggtgctgaaggcgagatccagctggacctgcactcgtgtcccaaaaccatagtcttcatcatccactccttcctgtcggccaaagtcacccgcctcgggctgttggcctagaagtcgccggatgcactagccctgaagaggggtgtccatgacatggcctgagctgggcctccaccgactgcctgctcacccctgggctgagggaagggagaggagaggaacaagggcctccgaaaccccaaccctgagggagactggattggtcttggggcccaggacccagacgcaggacagagtggactctgcctgtgatggggtggccttcctgctgcccccctccaccagtgccttttgcagagagatattttgtgtacacagaagccattccgagtctgggacctgcccctgtgcggatcctgaccccagccaacagctgagctgccgggcctcctcgaggcccctaagccacccccagaggtcccatctgaagctggagtaccctggggtcagcagcaagagaaagaagaggagattttctgtttgtttttcccctcagccctgccaccgtggggagtctggtttttctcttcatcctgtctctctcctccttactcttggataaataaacagcctgtgagcacacaggcagcccggcccagtgaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6640 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:6640 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:6640 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IEA
            GeneID:6640 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
            GeneID:6640 -> Biological process: GO:0003117 [regulation of vasoconstriction by circulating norepinephrine] evidence: IEA
            GeneID:6640 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:6640 -> Biological process: GO:0007528 [neuromuscular junction development] evidence: IEA
            GeneID:6640 -> Cellular component: GO:0005622 [intracellular] evidence: IDA
            GeneID:6640 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:6640 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
            GeneID:6640 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:6640 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA
            GeneID:6640 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.