Home |
Help |
Advanced search
2024-04-26 04:49:44, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003015 1883 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens secreted frizzled-related protein 5 (SFRP5), mRNA.
ACCESSION NM_003015
VERSION NM_003015.3 GI:188528608
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1883)
AUTHORS Hu,W., Li,L., Yang,M., Luo,X., Ran,W., Liu,D., Xiong,Z., Liu,H. and
Yang,G.
TITLE Circulating Sfrp5 is a signature of obesity-related metabolic
disorders and is regulated by glucose and liraglutide in humans
JOURNAL J. Clin. Endocrinol. Metab. 98 (1), 290-298 (2013)
PUBMED 23185036
REMARK GeneRIF: Circulating Sfrp5 is likely to play a major role in
insulin resistance in humans.
REFERENCE 2 (bases 1 to 1883)
AUTHORS Zhao,C., Ma,H., Bu,X., Wang,W. and Zhang,N.
TITLE SFRP5 inhibits gastric epithelial cell migration induced by
macrophage-derived Wnt5a
JOURNAL Carcinogenesis 34 (1), 146-152 (2013)
PUBMED 23054609
REMARK GeneRIF: findings suggest that epithelium-derived SFRP5 may play a
probable defensive role in impeding gastric cancer progression,
characteristically by inhibiting GEC migration induced by
macrophage-derived Wnt5a via JNK signaling activation
REFERENCE 3 (bases 1 to 1883)
AUTHORS Zhu,J., Wang,Y., Duan,J., Bai,H., Wang,Z., Wei,L., Zhao,J.,
Zhuo,M., Wang,S., Yang,L., An,T., Wu,M. and Wang,J.
TITLE DNA Methylation status of Wnt antagonist SFRP5 can predict the
response to the EGFR-tyrosine kinase inhibitor therapy in non-small
cell lung cancer
JOURNAL J. Exp. Clin. Cancer Res. 31, 80 (2012)
PUBMED 23009178
REMARK GeneRIF: Patients with unmethylated SFRP5 are more likely to
benefit from EGFR-TKI therapy.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1883)
AUTHORS Schulte,D.M., Muller,N., Neumann,K., Oberhauser,F., Faust,M.,
Gudelhofer,H., Brandt,B., Krone,W. and Laudes,M.
TITLE Pro-inflammatory wnt5a and anti-inflammatory sFRP5 are
differentially regulated by nutritional factors in obese human
subjects
JOURNAL PLoS ONE 7 (2), E32437 (2012)
PUBMED 22384249
REMARK GeneRIF: Pro-inflammatory wnt5a and anti-inflammatory sFRP5 are
differentially regulated by nutritional factors in obese human
subjects
REFERENCE 5 (bases 1 to 1883)
AUTHORS Kinoshita,T., Nomoto,S., Kodera,Y., Koike,M., Fujiwara,M. and
Nakao,A.
TITLE Decreased expression and aberrant hypermethylation of the SFRP
genes in human gastric cancer
JOURNAL Hepatogastroenterology 58 (107-108), 1051-1056 (2011)
PUBMED 21830441
REMARK GeneRIF: significant decrease in the expression of SFRP1 and SFRP5
was observed in gastric cancer compared with corresponding normal
gastric tissues
REFERENCE 6 (bases 1 to 1883)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
REFERENCE 7 (bases 1 to 1883)
AUTHORS Chang,J.T., Esumi,N., Moore,K., Li,Y., Zhang,S., Chew,C.,
Goodman,B., Rattner,A., Moody,S., Stetten,G., Campochiaro,P.A. and
Zack,D.J.
TITLE Cloning and characterization of a secreted frizzled-related protein
that is expressed by the retinal pigment epithelium
JOURNAL Hum. Mol. Genet. 8 (4), 575-583 (1999)
PUBMED 10072424
REFERENCE 8 (bases 1 to 1883)
AUTHORS Hu,E., Zhu,Y., Fredrickson,T., Barnes,M., Kelsell,D., Beeley,L. and
Brooks,D.
TITLE Tissue restricted expression of two human Frzbs in preadipocytes
and pancreas
JOURNAL Biochem. Biophys. Res. Commun. 247 (2), 287-293 (1998)
PUBMED 9642118
REMARK Erratum:[Biochem Biophys Res Commun 1998 Jul 30;248(3):941-3]
REFERENCE 9 (bases 1 to 1883)
AUTHORS Melkonyan,H.S., Chang,W.C., Shapiro,J.P., Mahadevappa,M.,
Fitzpatrick,P.A., Kiefer,M.C., Tomei,L.D. and Umansky,S.R.
TITLE SARPs: a family of secreted apoptosis-related proteins
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 94 (25), 13636-13641 (1997)
PUBMED 9391078
REFERENCE 10 (bases 1 to 1883)
AUTHORS Rattner,A., Hsieh,J.C., Smallwood,P.M., Gilbert,D.J.,
Copeland,N.G., Jenkins,N.A. and Nathans,J.
TITLE A family of secreted proteins contains homology to the
cysteine-rich ligand-binding domain of frizzled receptors
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 94 (7), 2859-2863 (1997)
PUBMED 9096311
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL358938.8 and BC050435.1.
On May 17, 2008 this sequence version replaced gi:8400734.
Summary: Secreted frizzled-related protein 5 (SFRP5) is a member of
the SFRP family that contains a cysteine-rich domain homologous to
the putative Wnt-binding site of Frizzled proteins. SFRPs act as
soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be
involved in determining the polarity of photoreceptor cells in the
retina. SFRP5 is highly expressed in the retinal pigment
epithelium, and moderately expressed in the pancreas. [provided by
RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF017988.1, AF117758.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025083 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-186 AL358938.8 45394-45579 c
187-1447 BC050435.1 144-1404
1448-1883 AL358938.8 40331-40766 c
FEATURES Location/Qualifiers
source 1..1883
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q24.1"
gene 1..1883
/gene="SFRP5"
/gene_synonym="SARP3"
/note="secreted frizzled-related protein 5"
/db_xref="GeneID:6425"
/db_xref="HGNC:10779"
/db_xref="MIM:604158"
exon 1..695
/gene="SFRP5"
/gene_synonym="SARP3"
/inference="alignment:Splign:1.39.8"
CDS 167..1120
/gene="SFRP5"
/gene_synonym="SARP3"
/note="secreted apoptosis related protein 3; FRP-1b;
SARP-3; sFRP-5; frizzled-related protein 1b; secreted
apoptosis-related protein 3"
/codon_start=1
/product="secreted frizzled-related protein 5 precursor"
/protein_id="NP_003006.2"
/db_xref="GI:188528609"
/db_xref="CCDS:CCDS7472.1"
/db_xref="GeneID:6425"
/db_xref="HGNC:10779"
/db_xref="MIM:604158"
/translation="
MRAAAAGGGVRTAALALLLGALHWAPARCEEYDYYGWQAEPLHGRSYSKPPQCLDIPADLPLCHTVGYKRMRLPNLLEHESLAEVKQQASSWLPLLAKRCHSDTQVFLCSLFAPVCLDRPIYPCRSLCEAVRAGCAPLMEAYGFPWPEMLHCHKFPLDNDLCIAVQFGHLPATAPPVTKICAQCEMEHSADGLMEQMCSSDFVVKMRIKEIKIENGDRKLIGAQKKKKLLKPGPLKRKDTKRLVLHMKNGAGCPCPQLDSLAGSFLVMGRKVDGQLLLMAVYRWDKKNKEMKFAVKFMFSYPCSLYYPFFYGAAEPH
"
sig_peptide 167..253
/gene="SFRP5"
/gene_synonym="SARP3"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 305..685
/gene="SFRP5"
/gene_synonym="SARP3"
/note="Cysteine-rich domain of the secreted
frizzled-related protein 5 (SFRP5), a regulator of Wnt
activity; Region: CRD_SFRP5; cd07444"
/db_xref="CDD:143553"
misc_feature order(350..352,356..364,368..376)
/gene="SFRP5"
/gene_synonym="SARP3"
/note="putative Wnt binding site [polypeptide binding];
other site"
/db_xref="CDD:143553"
misc_feature 698..1075
/gene="SFRP5"
/gene_synonym="SARP3"
/note="NTR domain, Secreted frizzled-related protein
(Sfrp) 1-like subfamily; composed of proteins similar to
human Sfrp1, Sfrp2 and Sfrp5. Sfrps are soluble proteins
containing an NTR domain C-terminal to a cysteine-rich
Frizzled domain. They show diverse...; Region:
NTR_Sfrp1_like; cd03580"
/db_xref="CDD:58636"
variation 274
/gene="SFRP5"
/gene_synonym="SARP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:34203191"
STS 633..775
/gene="SFRP5"
/gene_synonym="SARP3"
/standard_name="Sfrp5"
/db_xref="UniSTS:471846"
STS 636..731
/gene="SFRP5"
/gene_synonym="SARP3"
/standard_name="Sfrp5"
/db_xref="UniSTS:525512"
exon 696..773
/gene="SFRP5"
/gene_synonym="SARP3"
/inference="alignment:Splign:1.39.8"
exon 774..1883
/gene="SFRP5"
/gene_synonym="SARP3"
/inference="alignment:Splign:1.39.8"
variation 818
/gene="SFRP5"
/gene_synonym="SARP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:35379499"
STS 1329..1745
/gene="SFRP5"
/gene_synonym="SARP3"
/standard_name="RH71469"
/db_xref="UniSTS:89638"
variation 1723
/gene="SFRP5"
/gene_synonym="SARP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:2039826"
polyA_signal 1862..1867
/gene="SFRP5"
/gene_synonym="SARP3"
polyA_site 1883
/gene="SFRP5"
/gene_synonym="SARP3"
ORIGIN
agtcggggcgcccgcagcgcaggctgccacccacctgggcgacctccgcggcggcggcggcggcggctgggtagagtcagggccgggggcgcacgccggaacacctgggccgccgggcaccgagcgtcggggggctgcgcggcgcgcacctggagagggcgcagccatgcgggcggcggcggcgggggggggcgtgcggacggccgcgctggcgctgctgctgggggcgctgcactgggcgccggcgcgctgcgaggagtacgactactatggctggcaggccgagccgctgcacggccgctcctactccaagccgccgcagtgccttgacatccctgccgacctgccgctctgccacacggtgggctacaagcgcatgcggctgcccaacctgctggagcacgagagcctggccgaagtgaagcagcaggcgagcagctggctgccgctgctggccaagcgctgccactcggatacgcaggtcttcctgtgctcgctctttgcgcccgtctgtctcgaccggcccatctacccgtgccgctcgctgtgcgaggccgtgcgcgccggctgcgcgccgctcatggaggcctacggcttcccctggcctgagatgctgcactgccacaagttccccctggacaacgacctctgcatcgccgtgcagttcgggcacctgcccgccaccgcgcctccagtgaccaagatctgcgcccagtgtgagatggagcacagtgctgacggcctcatggagcagatgtgctccagtgactttgtggtcaaaatgcgcatcaaggagatcaagatagagaatggggaccggaagctgattggagcccagaaaaagaagaagctgctcaagccgggccccctgaagcgcaaggacaccaagcggctggtgctgcacatgaagaatggcgcgggctgcccctgcccacagctggacagcctggcgggcagcttcctggtcatgggccgcaaagtggatggacagctgctgctcatggccgtctaccgctgggacaagaagaataaggagatgaagtttgcagtcaaattcatgttctcctacccctgctccctctactaccctttcttctacggggcggcagagccccactgaagggcactcctccttgccctgccagctgtgccttgcttgccctctggccccgccccaacttccaggctgacccggccctactggagggtgttttcacgaatgttgttactggcacaaggcctaagggatgggcacggagcccaggctgtcctttttgacccaggggtcctggggtccctgggatgttgggcttcctctctcaggagcagggcttcttcatctgggtgaagacctcagggtctcagaaagtaggcaggggaggagagggtaagggaaaggtggaggggctcagggcaccctgaggcggaggtttcagagtagaaggtggtgtcagctccagctcccctctgtcggtggtggggcctcaccttgaagagggaagtctcaatattaggctaagctatttgggaaagttctccccaccgcccctgtacgcgtcatcctagccccccttaggaaaggagttagggtctcagtgcctccagccacaccccctgccttccccagcttgcccatttccctgccccaaggcccagagctccccccagactggagagcaagcccagcccagcctcggcatagacccccttctggtccgcccgcggctcgattcccgggattcattcctcagcctctgcttctcccttttatcccaataagttattgctactgctgtgaggccataggtactagacaaccaatacatgcagggttgggttttctaatttttttaactttttaattaaatcaaagaaaacaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6425 -> Molecular function: GO:0017147 [Wnt-protein binding] evidence: IBA
GeneID:6425 -> Molecular function: GO:0030165 [PDZ domain binding] evidence: IBA
GeneID:6425 -> Molecular function: GO:0042813 [Wnt-activated receptor activity] evidence: IBA
GeneID:6425 -> Biological process: GO:0001944 [vasculature development] evidence: IBA
GeneID:6425 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:6425 -> Biological process: GO:0007163 [establishment or maintenance of cell polarity] evidence: TAS
GeneID:6425 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:6425 -> Biological process: GO:0007420 [brain development] evidence: IBA
GeneID:6425 -> Biological process: GO:0007601 [visual perception] evidence: TAS
GeneID:6425 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IMP
GeneID:6425 -> Biological process: GO:0008406 [gonad development] evidence: IBA
GeneID:6425 -> Biological process: GO:0009653 [anatomical structure morphogenesis] evidence: TAS
GeneID:6425 -> Biological process: GO:0009790 [embryo development] evidence: IBA
GeneID:6425 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
GeneID:6425 -> Biological process: GO:0035414 [negative regulation of catenin import into nucleus] evidence: IMP
GeneID:6425 -> Biological process: GO:0036342 [post-anal tail morphogenesis] evidence: IEA
GeneID:6425 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: IMP
GeneID:6425 -> Biological process: GO:0043508 [negative regulation of JUN kinase activity] evidence: IEA
GeneID:6425 -> Biological process: GO:0048546 [digestive tract morphogenesis] evidence: IEA
GeneID:6425 -> Biological process: GO:0051898 [negative regulation of protein kinase B signaling cascade] evidence: IMP
GeneID:6425 -> Biological process: GO:0060028 [convergent extension involved in axis elongation] evidence: IEA
GeneID:6425 -> Biological process: GO:0090090 [negative regulation of canonical Wnt receptor signaling pathway] evidence: IMP
GeneID:6425 -> Biological process: GO:0090179 [planar cell polarity pathway involved in neural tube closure] evidence: IEA
GeneID:6425 -> Biological process: GO:2000041 [negative regulation of planar cell polarity pathway involved in axis elongation] evidence: IEA
GeneID:6425 -> Biological process: GO:2000057 [negative regulation of Wnt receptor signaling pathway involved in digestive tract morphogenesis] evidence: IMP
GeneID:6425 -> Cellular component: GO:0005615 [extracellular space] evidence: TAS
GeneID:6425 -> Cellular component: GO:0005737 [cytoplasm] evidence: IBA
GeneID:6425 -> Cellular component: GO:0005886 [plasma membrane] evidence: IBA
GeneID:6425 -> Cellular component: GO:0042995 [cell projection] evidence: IKR
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.