2024-04-24 07:52:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003010 3752 bp mRNA linear PRI 15-JUN-2013 DEFINITION Homo sapiens mitogen-activated protein kinase kinase 4 (MAP2K4), mRNA. ACCESSION NM_003010 VERSION NM_003010.2 GI:24497520 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3752) AUTHORS Lai,L., Song,Y., Liu,Y., Chen,Q., Han,Q., Chen,W., Pan,T., Zhang,Y., Cao,X. and Wang,Q. TITLE MicroRNA-92a negatively regulates Toll-like receptor (TLR)-triggered inflammatory response in macrophages by targeting MKK4 kinase JOURNAL J. Biol. Chem. 288 (11), 7956-7967 (2013) PUBMED 23355465 REMARK GeneRIF: MicroRNA-92a negatively regulates Toll-like receptor (TLR)-triggered inflammatory response in macrophages by targeting MKK4 kinase REFERENCE 2 (bases 1 to 3752) AUTHORS Shao,N., Wang,Y., Lu,K., Jiang,W.Y., Li,Q., Wang,N., Feng,N.H. and Hua,L.X. TITLE Role of the functional MKK4 promoter variant (-1304T>G) in a decreased risk of prostate cancer: case-control study and meta-analysis JOURNAL J. Cancer Res. Clin. Oncol. 138 (9), 1531-1539 (2012) PUBMED 22526163 REMARK GeneRIF: Results suggest that the functional -1304G variant in the MKK4 promoter decreases the risk of PCa by increasing the promoter activity. REFERENCE 3 (bases 1 to 3752) AUTHORS Matsumoto,T., Kinoshita,T., Kirii,Y., Tada,T. and Yamano,A. TITLE Crystal and solution structures disclose a putative transient state of mitogen-activated protein kinase kinase 4 JOURNAL Biochem. Biophys. Res. Commun. 425 (2), 195-200 (2012) PUBMED 22828509 REMARK GeneRIF: Crystal structures combined with small-angle X-ray scattering experiments revealed that the apo form of non-phosphorylated MAP2K4 (npMAP2K4) exists in a transient state which has a longer conformation compared with the typical kinase folding. REFERENCE 4 (bases 1 to 3752) AUTHORS Hawkes,W.C. and Alkan,Z. TITLE Delayed cell cycle progression in selenoprotein W-depleted cells is regulated by a mitogen-activated protein kinase kinase 4-p38/c-Jun NH2-terminal kinase-p53 pathway JOURNAL J. Biol. Chem. 287 (33), 27371-27379 (2012) PUBMED 22730327 REMARK GeneRIF: SEPW1 silencing increases MKK4, which activates p38gamma, p38delta, and JNK2 to phosphorylate p53 on Ser-33 and cause a transient G(1) arrest. REFERENCE 5 (bases 1 to 3752) AUTHORS Hart,A.B., Engelhardt,B.E., Wardle,M.C., Sokoloff,G., Stephens,M., de Wit,H. and Palmer,A.A. TITLE Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13) JOURNAL PLoS ONE 7 (8), E42646 (2012) PUBMED 22952603 REFERENCE 6 (bases 1 to 3752) AUTHORS Gale,N.W., Holland,S.J., Valenzuela,D.M., Flenniken,A., Pan,L., Ryan,T.E., Henkemeyer,M., Strebhardt,K., Hirai,H., Wilkinson,D.G., Pawson,T., Davis,S. and Yancopoulos,G.D. TITLE Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis JOURNAL Neuron 17 (1), 9-19 (1996) PUBMED 8755474 REFERENCE 7 (bases 1 to 3752) AUTHORS Salmeron,A., Ahmad,T.B., Carlile,G.W., Pappin,D., Narsimhan,R.P. and Ley,S.C. TITLE Activation of MEK-1 and SEK-1 by Tpl-2 proto-oncoprotein, a novel MAP kinase kinase kinase JOURNAL EMBO J. 15 (4), 817-826 (1996) PUBMED 8631303 REFERENCE 8 (bases 1 to 3752) AUTHORS Lin,A., Minden,A., Martinetto,H., Claret,F.X., Lange-Carter,C., Mercurio,F., Johnson,G.L. and Karin,M. TITLE Identification of a dual specificity kinase that activates the Jun kinases and p38-Mpk2 JOURNAL Science 268 (5208), 286-290 (1995) PUBMED 7716521 REFERENCE 9 (bases 1 to 3752) AUTHORS Derijard,B., Raingeaud,J., Barrett,T., Wu,I.H., Han,J., Ulevitch,R.J. and Davis,R.J. TITLE Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms JOURNAL Science 267 (5198), 682-685 (1995) PUBMED 7839144 REMARK Erratum:[Science 1995 Jul 7;269(5220):17] REFERENCE 10 (bases 1 to 3752) AUTHORS Yan,M., Dai,T., Deak,J.C., Kyriakis,J.M., Zon,L.I., Woodgett,J.R. and Templeton,D.J. TITLE Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1 JOURNAL Nature 372 (6508), 798-800 (1994) PUBMED 7997270 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from L36870.1, AA293365.1 and BC036032.1. On Nov 3, 2002 this sequence version replaced gi:4506888. Summary: This gene encodes a dual specificity protein kinase that belongs to the Ser/Thr protein kinase family. This kinase is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. It has been shown to activate MAPK8/JNK1, MAPK9/JNK2, and MAPK14/p38, but not MAPK1/ERK2 or MAPK3/ERK3. This kinase is phosphorylated, and thus activated by MAP3K1/MEKK. The knockout studies in mice suggested the roles of this kinase in mediating survival signal in T cell development, as well as in the organogenesis of liver. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC036032.1, BC060764.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025082, ERS025083 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. FEATURES Location/Qualifiers source 1..3752 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="17" /map="17p12" gene 1..3752 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="mitogen-activated protein kinase kinase 4" /db_xref="GeneID:6416" /db_xref="HGNC:6844" /db_xref="HPRD:03213" /db_xref="MIM:601335" exon 1..184 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 3 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="" /replace="c" /db_xref="dbSNP:370540710" variation 41 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:371308400" variation 61 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:62060968" CDS 70..1269 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /EC_number="2.7.12.2" /note="MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; JNK activating kinase 1; SAPK/ERK kinase 1; MAPK/ERK kinase 4; JNK-activated kinase 1; MEK 4; MAPKK 4; JNK-activating kinase 1; SAPK kinase 1; stress-activated protein kinase kinase 1" /codon_start=1 /product="dual specificity mitogen-activated protein kinase kinase 4" /protein_id="NP_003001.1" /db_xref="GI:4506889" /db_xref="CCDS:CCDS11162.1" /db_xref="GeneID:6416" /db_xref="HGNC:6844" /db_xref="HPRD:03213" /db_xref="MIM:601335" /translation="
MAAPSPSGGGGSGGGSGSGTPGPVGSPAPGHPAVSSMQGKRKALKLNFANPPFKSTARFTLNPNPTGVQNPHIERLRTHSIESSGKLKISPEQHWDFTAEDLKDLGEIGRGAYGSVNKMVHKPSGQIMAVKRIRSTVDEKEQKQLLMDLDVVMRSSDCPYIVQFYGALFREGDCWICMELMSTSFDKFYKYVYSVLDDVIPEEILGKITLATVKALNHLKENLKIIHRDIKPSNILLDRSGNIKLCDFGISGQLVDSIAKTRDAGCRPYMAPERIDPSASRQGYDVRSDVWSLGITLYELATGRFPYPKWNSVFDQLTQVVKGDPPQLSNSEEREFSPSFINFVNLCLTKDESKRPKYKELLKHPFILMYEERAVEVACYVCKILDQMPATPSSPMYVD
" misc_feature 178..225 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P45985.1); Region: D domain" misc_feature 202..207 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="Cleavage, by anthrax lethal factor; propagated from UniProtKB/Swiss-Prot (P45985.1); cleavage site" misc_feature 241..246 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="Cleavage, by anthrax lethal factor; propagated from UniProtKB/Swiss-Prot (P45985.1); cleavage site" misc_feature 307..309 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01261" misc_feature 337..339 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P45985.1); phosphorylation site" misc_feature 358..1224 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="Catalytic domain of the dual-specificity Protein Kinase, MAP kinase kinase 4; Region: PKc_MKK4; cd06616" /db_xref="CDD:132947" misc_feature 376..1170 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220" /db_xref="CDD:197582" misc_feature order(391..405,409..411,415..417,454..456,460..462, 553..555,601..612,616..621,625..630,754..756,760..771, 775..777,808..810,817..819,856..867,871..873,964..966, 991..993) /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="active site" /db_xref="CDD:132947" misc_feature order(391..405,409..411,415..417,454..456,460..462, 553..555,601..612,616..621,625..630,760..762,766..771, 775..777,808..810) /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:132947" misc_feature order(400..405,754..756,760..768,817..819,856..867, 871..873,964..966,991..993) /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:132947" misc_feature 805..873 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /note="activation loop (A-loop); other site" /db_xref="CDD:132947" misc_feature 838..840 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by MAP3K; propagated from UniProtKB/Swiss-Prot (P45985.1); phosphorylation site" misc_feature 838..840 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03213" misc_feature 850..852 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by MAP3K; propagated from UniProtKB/Swiss-Prot (P45985.1); phosphorylation site" misc_feature 850..852 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03213" misc_feature 1159..1230 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P45985.1); Region: DVD domain" variation 115 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:17855590" exon 185..287 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 194 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:111801039" variation 216 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:113748639" variation 227 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:372872972" variation 272 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:201981451" exon 288..462 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 295 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:377490722" variation 303 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:370348659" variation 408 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:374744100" variation 441 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:148203118" variation 444 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:55763083" variation 458 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:77267737" exon 463..582 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 469 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:375500789" exon 583..702 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 641 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:150905259" variation 645 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:374022234" exon 703..754 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" exon 755..882 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 859 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:200798818" variation 861 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:138304516" variation 867 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:76726054" exon 883..960 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 889 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:56102360" variation 957 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:377585343" exon 961..1109 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 971 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:144008624" variation 1017 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:202076088" variation 1023 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:374357599" variation 1029 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:368291515" variation 1047 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:147290941" variation 1082 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:371746849" variation 1083 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:373999106" variation 1091 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:367710581" variation 1094 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:191244765" STS 1098..1290 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /standard_name="RH70575" /db_xref="UniSTS:74809" exon 1110..1155 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" variation 1116 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:55794822" exon 1156..3743 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /inference="alignment:Splign:1.39.8" STS 1167..2053 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /standard_name="MAP2K4_908" /db_xref="UniSTS:277468" variation 1192 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:367662793" variation 1200 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:55924570" variation 1218 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:144754357" variation 1273 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:201971628" variation 1290 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:189817203" variation 1319 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:368292817" variation 1320 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:376888511" variation 1338 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:182465459" variation 1357 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:139724158" variation 1372 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="t" /db_xref="dbSNP:185329765" variation 1470 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:190190304" variation 1670 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:1049438" variation 1718 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:146597820" variation 1719 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:183470579" variation 1823 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:188410287" variation 1871 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:193245128" variation 1917 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:141440676" variation 1974 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:1049439" variation 1985 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:28921113" variation 1994..1995 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="" /replace="g" /db_xref="dbSNP:28921114" variation 2005 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="t" /db_xref="dbSNP:184089088" variation 2035 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:11555725" variation 2066 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:59832266" variation 2074 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:186704791" variation 2089 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:201362372" variation 2125 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:191563418" variation 2223 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:183860741" variation 2368 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:188576778" variation 2391 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:192717367" variation 2440 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="" /replace="t" /db_xref="dbSNP:35163626" variation 2455 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:373075028" variation 2484 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:1049441" variation 2495 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:1049442" variation 2531 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:377467531" variation 2550 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:1049443" variation 2597 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:4792219" variation 2607 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:140706208" variation 2701 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:150125305" variation 2710 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:185127839" variation 2728 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:138715568" variation 2781 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:190166554" variation 2834 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:182288643" variation 2866 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:35027510" variation 2945 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:142822302" variation 3040 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:189374285" variation 3051 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:180737708" variation 3067 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:1049444" variation 3068 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="c" /db_xref="dbSNP:1049445" variation 3224 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="t" /db_xref="dbSNP:1803981" variation 3226 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="g" /db_xref="dbSNP:374613560" variation 3315 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:185090127" variation 3406 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:377631607" variation 3451 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="g" /replace="t" /db_xref="dbSNP:146989618" STS 3496..3690 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /standard_name="A003B48" /db_xref="UniSTS:36273" STS 3540..3713 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /standard_name="RH12704" /db_xref="UniSTS:43438" variation 3583 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="a" /replace="g" /db_xref="dbSNP:28921115" variation 3583 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:199658174" variation 3660 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /replace="c" /replace="t" /db_xref="dbSNP:28921116" polyA_signal 3720..3725 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" polyA_site 3743 /gene="MAP2K4" /gene_synonym="JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1" /experiment="experimental evidence, no additional details recorded" ORIGIN
ggccgtgcgagaggccgagcttgctgcattgcagccgccgcggcgccgctcggctcttcactcccaacaatggcggctccgagcccgagcggcggcggcggctccgggggcggcagcggcagcggcacccccggccccgtagggtccccggcgccaggccacccggccgtcagcagcatgcagggtaaacgcaaagcactgaagttgaattttgcaaatccacctttcaaatctacagcaaggtttactctgaatcccaatcctacaggagttcaaaacccacacatagagagactgagaacacacagcattgagtcatcaggaaaactgaagatctcccctgaacaacactgggatttcactgcagaggacttgaaagaccttggagaaattggacgaggagcttatggttctgtcaacaaaatggtccacaaaccaagtgggcaaataatggcagttaaaagaattcggtcaacagtggatgaaaaagaacaaaaacaacttcttatggatttggatgtagtaatgcggagtagtgattgcccatacattgttcagttttatggtgcactcttcagagagggtgactgttggatctgtatggaactcatgtctacctcgtttgataagttttacaaatatgtatatagtgtattagatgatgttattccagaagaaattttaggcaaaatcactttagcaactgtgaaagcactaaaccacttaaaagaaaacttgaaaattattcacagagatatcaaaccttccaatattcttctggacagaagtggaaatattaagctctgtgacttcggcatcagtggacagcttgtggactctattgccaagacaagagatgctggctgtaggccatacatggcacctgaaagaatagacccaagcgcatcacgacaaggatatgatgtccgctctgatgtctggagtttggggatcacattgtatgagttggccacaggccgatttccttatccaaagtggaatagtgtatttgatcaactaacacaagtcgtgaaaggagatcctccgcagctgagtaattctgaggaaagggaattctccccgagtttcatcaactttgtcaacttgtgccttacgaaggatgaatccaaaaggccaaagtataaagagcttctgaaacatccctttattttgatgtatgaagaacgtgccgttgaggtcgcatgctatgtttgtaaaatcctggatcaaatgccagctactcccagctctcccatgtatgtcgattgatatcgctgctacatcagactctagaaaaaagggctgagaggaagcaagacgtaaagaattttcatcccgtatcacagtgtttttattgctcgcccagacaccatgtgcaataagattggtgttcgtttccatcatgtctgtatactcctgtcacctagaacgtgcatccttgtaatacctgattgatcacacagtgttagtgctggtcagagagacctcatcctgctcttttgtgatgaacatattcatgaaatgtggaagtcagtacgatcaagttgttgactgtgattagatcacatcttaaattcatttctagactcaaaacctggagatgcagctactggaatggtgttttgtcagacttccaaatcctggaaggacacagtgatgaatgtactatgtctgaacatagaaactcgggcttgagtgagaagagcttgcacagccaacgagacacattgccttctggagctgggagacaaaggaggaatttactttcttcaccaagtgcaatagattactgatgtgatattctgttgctttacagttacagttgatgtttggggatcgatgtgctcagccaaatttcctgtttgaaatatcatgttaaattagaatgaatttatctttaccaaaaaccatgttgcgttcaaagaggtgaacattaaaatatagagacaggacagaatgtgttcttttctcctttaccagtcctatttttcaatgggaagactcaggagtctgccacttgtcaaagaaggtgctgatcctaagaatttttcattctcagaattcggtgtgctgccaacttgatgttccacctgccacaaaccaccaggactgaaagaagaaaacagtacagaaggcaaagtttacagatgtttttaattctagtattttatctggaacaacttgtagcagctatatatttccccttggtcccaagcctgatactttagccatcataactcactaacagggagaagtagctagtagcaatgtgccttgattgattagataaagatttctagtaggcagcaaaagaccaaatctcagttgtttgcttcttgccatcactggtccaggtcttcagtttccgaatctctttcccttcccctgtggtctattgtcgctatgtgacttgcgcttaatccaatattttgccttttttctatatcaaaaaacctttacagttagcagggatgttccttaccaaggatttttagccccaaatctctcatattcgctagtgtttaaaaggctaagaatagtggggcccagccgatgtggtaggtgataaagaggcatcttttctagagacacattggaccagatgaggatccgaaacggcagcctttacgttcatcacctgctagaacctctcgtagtccatcaccatttcttggcattggaattctactggaaaaaaatacaaaaagcaaaacaaaaccctcagcactgttacaagaggccatttaagtatcttgtgcttcttcacttacccattagccaggttctcattaggttttgcttgggcctccctggcactgaaccttaggctttgtatgacagtgaagcagcactgtgagtggttcaagcacactggaatataaaacagtcatggcctgagatgcaggtgatgccattacagaaccaaatcgtggcacgtattgctgtgtctcctctcagagtgacagtcataaatactgtcaaacaataaagggagaatggtgctgtttaaagtcacatccctgtaaattgcagaattcaaaagtgattatctctttgatctacttgcctcatttccctatcttctcccccacggtatcctaaactttagacttcccactgttctgaaaggagacattgctctatgtctgccttcgaccacagcaagccatcatcctccattgctcccggggactcaagaggaatctgtttctctgctgtcaacttcccatctggctcagcatagggtcactttgccattatgcaaatggagataaaagcaattctgactgtccaggagctaatctgaccgttctattgtgtggatgaccacataagaaggcaattttagtgtattaatcatagattattataaactataaacttaagggcaaggagtttattacaatgtatctttattaaaacaaaagggtgtatagtgttcacaaactgtgaaaatagtgtaagaactgtacattgtgagctctggttatttttctcttgtaccatagaaaaatgtataaaaattatcaaaaagctaatgtgcagggatattgccttatttgtctgtaaaaaatggagctcagtaacataactgcttcttggagctttggaatattttatcctgtattcttgtttgaattcctcctctatttaagatatatacatggaatcgaagtgtttatgtaatagttctatccttttgcctgcaggtcagttgtaataaatctaggatgtgatgatgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:6416 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS GeneID:6416 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA GeneID:6416 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA GeneID:6416 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:6416 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:6416 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:6416 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:6416 -> Biological process: GO:0007254 [JNK cascade] evidence: TAS GeneID:6416 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS GeneID:6416 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:6416 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS GeneID:6416 -> Biological process: GO:0071260 [cellular response to mechanical stimulus] evidence: IEP GeneID:6416 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:6416 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_003001 -> EC 2.7.12.2
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.