Home |
Help |
Advanced search
2024-04-19 08:52:42, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002865 3812 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript
variant 1, mRNA.
ACCESSION NM_002865
VERSION NM_002865.2 GI:336391091
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3812)
AUTHORS de Barsy,M., Jamet,A., Filopon,D., Nicolas,C., Laloux,G.,
Rual,J.F., Muller,A., Twizere,J.C., Nkengfac,B., Vandenhaute,J.,
Hill,D.E., Salcedo,S.P., Gorvel,J.P., Letesson,J.J. and De Bolle,X.
TITLE Identification of a Brucella spp. secreted effector specifically
interacting with human small GTPase Rab2
JOURNAL Cell. Microbiol. 13 (7), 1044-1058 (2011)
PUBMED 21501366
REMARK GeneRIF: The authors identified a specific interaction between the
human small GTPase Rab2 and a Brucella spp. protein named RicA.
REFERENCE 2 (bases 1 to 3812)
AUTHORS Buffa,L., Fuchs,E., Pietropaolo,M., Barr,F. and Solimena,M.
TITLE ICA69 is a novel Rab2 effector regulating ER-Golgi trafficking in
insulinoma cells
JOURNAL Eur. J. Cell Biol. 87 (4), 197-209 (2008)
PUBMED 18187231
REMARK GeneRIF: ICA69 as a novel Rab2 effector and its role in regulating
the early transport of insulin secretory granule proteins
REFERENCE 3 (bases 1 to 3812)
AUTHORS Dong,C. and Wu,G.
TITLE Regulation of anterograde transport of adrenergic and angiotensin
II receptors by Rab2 and Rab6 GTPases
JOURNAL Cell. Signal. 19 (11), 2388-2399 (2007)
PUBMED 17716866
REMARK GeneRIF: These data demonstrate that Rab2 and Rab6 differentially
influence anterograde transport and signaling of GPCRs.
REFERENCE 4 (bases 1 to 3812)
AUTHORS Chi,A., Valencia,J.C., Hu,Z.Z., Watabe,H., Yamaguchi,H.,
Mangini,N.J., Huang,H., Canfield,V.A., Cheng,K.C., Yang,F., Abe,R.,
Yamagishi,S., Shabanowitz,J., Hearing,V.J., Wu,C., Appella,E. and
Hunt,D.F.
TITLE Proteomic and bioinformatic characterization of the biogenesis and
function of melanosomes
JOURNAL J. Proteome Res. 5 (11), 3135-3144 (2006)
PUBMED 17081065
REFERENCE 5 (bases 1 to 3812)
AUTHORS Eathiraj,S., Pan,X., Ritacco,C. and Lambright,D.G.
TITLE Structural basis of family-wide Rab GTPase recognition by
rabenosyn-5
JOURNAL Nature 436 (7049), 415-419 (2005)
PUBMED 16034420
REFERENCE 6 (bases 1 to 3812)
AUTHORS de Leeuw,H.P., Koster,P.M., Calafat,J., Janssen,H., van
Zonneveld,A.J., van Mourik,J.A. and Voorberg,J.
TITLE Small GTP-binding proteins in human endothelial cells
JOURNAL Br. J. Haematol. 103 (1), 15-19 (1998)
PUBMED 9792283
REFERENCE 7 (bases 1 to 3812)
AUTHORS Tisdale,E.J. and Balch,W.E.
TITLE Rab2 is essential for the maturation of pre-Golgi intermediates
JOURNAL J. Biol. Chem. 271 (46), 29372-29379 (1996)
PUBMED 8910601
REFERENCE 8 (bases 1 to 3812)
AUTHORS Khosravi-Far,R., Lutz,R.J., Cox,A.D., Conroy,L., Bourne,J.R.,
Sinensky,M., Balch,W.E., Buss,J.E. and Der,C.J.
TITLE Isoprenoid modification of rab proteins terminating in CC or CXC
motifs
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (14), 6264-6268 (1991)
PUBMED 1648736
REFERENCE 9 (bases 1 to 3812)
AUTHORS Zahraoui,A., Touchot,N., Chardin,P. and Tavitian,A.
TITLE The human Rab genes encode a family of GTP-binding proteins related
to yeast YPT1 and SEC4 products involved in secretion
JOURNAL J. Biol. Chem. 264 (21), 12394-12401 (1989)
PUBMED 2501306
REFERENCE 10 (bases 1 to 3812)
AUTHORS Tachibana,K., Umezawa,A., Kato,S. and Takano,T.
TITLE Nucleotide sequence of a new YPT1-related human cDNA which belongs
to the ras gene superfamily
JOURNAL Nucleic Acids Res. 16 (21), 10368 (1988)
PUBMED 3057444
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA648682.1, X12953.1,
AC068389.10 and AW301641.1.
On Jun 18, 2011 this sequence version replaced gi:4506364.
Summary: The protein encoded by this gene belongs to the Rab
family, members of which are small molecular weight guanosine
triphosphatases (GTPases) that contain highly conserved domains
involved in GTP binding and hydrolysis. The Rabs are membrane-bound
proteins, involved in vesicular fusion and trafficking. This
protein is a resident of pre-Golgi intermediates, and is required
for protein transport from the endoplasmic reticulum (ER) to the
Golgi complex. Alternatively spliced transcript variants encoding
different isoforms have been found for this gene. [provided by
RefSeq, Oct 2011].
Transcript Variant: This variant (1) represents the predominant
transcript and encodes the longer isoform (a).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X12953.1, BC008929.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-90 DA648682.1 3-92
91-1238 X12953.1 1-1148
1239-2127 AC068389.10 53096-53984 c
2128-3353 AC068389.10 51870-53095 c
3354-3812 AW301641.1 1-459 c
FEATURES Location/Qualifiers
source 1..3812
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q12.1"
gene 1..3812
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="RAB2A, member RAS oncogene family"
/db_xref="GeneID:5862"
/db_xref="HGNC:9763"
/db_xref="HPRD:01539"
/db_xref="MIM:179509"
exon 1..344
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 8
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:13248794"
variation 35
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:188897877"
variation 71
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377019145"
variation 180
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11544472"
variation 238
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:79202491"
variation 269
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370633697"
misc_feature 284..286
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="upstream in-frame stop codon"
CDS 299..937
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="isoform a is encoded by transcript variant 1; RAB2,
member RAS oncogene family; ras-related protein Rab-2A;
small GTP binding protein RAB2A"
/codon_start=1
/product="ras-related protein Rab-2A isoform a"
/protein_id="NP_002856.1"
/db_xref="GI:4506365"
/db_xref="CCDS:CCDS6175.1"
/db_xref="GeneID:5862"
/db_xref="HGNC:9763"
/db_xref="HPRD:01539"
/db_xref="MIM:179509"
/translation="
MAYAYLFKYIIIGDTGVGKSCLLLQFTDKRFQPVHDLTIGVEFGARMITIDGKQIKLQIWDTAGQESFRSITRSYYRGAAGALLVYDITRRDTFNHLTTWLEDARQHSNSNMVIMLIGNKSDLESRREVKKEEGEAFAREHGLIFMETSAKTASNVEEAFINTAKEIYEKIQEGVFDINNEANGIKIGPQHAATNATHAGNQGGQQAGGGCC
"
misc_feature 299..355
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P61019.1);
Region: Required for interaction with PRKCI"
misc_feature 305..808
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab GTPase family 2 (Rab2); Region: Rab2; cd01866"
/db_xref="CDD:206658"
misc_feature 305..322
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab subfamily motif 1 (RabSF1); other site"
/db_xref="CDD:206658"
misc_feature 335..358
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G1 box; other site"
/db_xref="CDD:206658"
misc_feature order(344..361,395..397,653..658,662..664,743..751)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="GTP/Mg2+ binding site [chemical binding]; other
site"
/db_xref="CDD:206658"
misc_feature order(359..394,401..409)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab subfamily motif 2 (RabSF2); other site"
/db_xref="CDD:206658"
misc_feature order(389..391,404..430)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Switch I region; other site"
/db_xref="CDD:206658"
misc_feature 401..427
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P61019.1);
Region: Effector region (By similarity)"
misc_feature order(404..406,416..439,458..460,464..466)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="putative GEF interaction site [polypeptide
binding]; other site"
/db_xref="CDD:206658"
misc_feature 410..412
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G2 box; other site"
/db_xref="CDD:206658"
misc_feature order(413..415,419..427,470..472,476..478,497..502,
509..511,521..523,527..538,797..799)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="putative effector interaction site; other site"
/db_xref="CDD:206658"
misc_feature order(413..418,422..424,476..481,500..502,506..508,
512..520)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="putative GDI interaction site [polypeptide
binding]; other site"
/db_xref="CDD:206658"
misc_feature 413..427
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab family motif 1 (RabF1); other site"
/db_xref="CDD:206658"
misc_feature 464..478
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab family motif 2 (RabF2); other site"
/db_xref="CDD:206658"
misc_feature 479..490
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G3 box; other site"
/db_xref="CDD:206658"
misc_feature order(488..490,494..526)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Switch II region; other site"
/db_xref="CDD:206658"
misc_feature 497..514
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab family motif 3 (RabF3); other site"
/db_xref="CDD:206658"
misc_feature 521..535
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab family motif 4 (RabF4); other site"
/db_xref="CDD:206658"
misc_feature 548..565
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab family motif 5 (RabF5); other site"
/db_xref="CDD:206658"
misc_feature 629..646
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab subfamily motif 3 (RabSF3); other site"
/db_xref="CDD:206658"
misc_feature 653..664
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G4 box; other site"
/db_xref="CDD:206658"
misc_feature 743..751
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G5 box; other site"
/db_xref="CDD:206658"
misc_feature 791..808
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rab subfamily motif 4 (RabSF4); other site"
/db_xref="CDD:206658"
variation 307
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373226742"
exon 345..416
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 346
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138440036"
variation 413
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11544474"
exon 417..484
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 427
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368402545"
exon 485..567
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 522
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11544470"
exon 568..660
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 574
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375530419"
exon 661..772
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 685
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:141013917"
variation 727
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370866047"
variation 728
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199581780"
exon 773..841
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
exon 842..3812
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
STS 845..979
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="STS-R00195"
/db_xref="UniSTS:16383"
STS 850..980
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RH70011"
/db_xref="UniSTS:5095"
variation 925
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370628676"
variation 926
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374486741"
STS 928..1425
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RAB2_2543"
/db_xref="UniSTS:280950"
STS 946..1221
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1929"
/db_xref="UniSTS:76818"
variation 964
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:367660654"
variation 965
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201836844"
variation 982
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368529941"
polyA_signal 1084..1089
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_site 1109
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 1200
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:183524386"
variation 1281
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:187759374"
variation 1303
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:76823768"
variation 1330..1331
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace=""
/replace="tt"
/db_xref="dbSNP:200305948"
variation 1365
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:41272433"
variation 1468
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:370058692"
variation 1569
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:113877343"
variation 1606
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374973250"
variation 1708
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79502934"
variation 1831
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77133934"
STS 1897..2048
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1899"
/db_xref="UniSTS:22645"
STS 1897..2020
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RH92689"
/db_xref="UniSTS:92717"
variation 1976..1977
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace=""
/replace="a"
/db_xref="dbSNP:35329667"
STS 1990..2095
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1405E"
/db_xref="UniSTS:151199"
variation 2010
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140580809"
polyA_signal 2019..2024
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 2037
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:7413"
polyA_site 2048
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_signal 2147..2152
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_site 2167
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 2276
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369628178"
variation 2318
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373337569"
variation 2411
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:12544487"
variation 2453
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:78628010"
variation 2504
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:629268"
variation 2580
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:150407587"
variation 2613
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79970848"
variation 2734
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:649634"
variation 2803
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138129268"
variation 2830
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:192628540"
variation 2888
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75837686"
variation 2976
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2930041"
STS 3002..3252
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1613"
/db_xref="UniSTS:79309"
variation 3022
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:149557425"
variation 3026
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:9437"
variation 3070
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:118165570"
variation 3074
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:75974140"
STS 3078..3262
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1394E"
/db_xref="UniSTS:45049"
variation 3190
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:186973869"
polyA_signal 3235..3240
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3254
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145073984"
polyA_site 3264
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3312
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:76705987"
variation 3318
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:652422"
variation 3332
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:138862634"
variation 3356
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374444619"
variation 3403
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142611281"
variation 3410
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:113076295"
variation 3416
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:191757602"
variation 3430
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:113490250"
variation 3499
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:184729393"
variation 3673
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:116372466"
variation 3707
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:189591638"
variation 3716
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:181704218"
polyA_signal 3774..3779
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3787
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:185297839"
polyA_site 3805
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3812
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:664796"
ORIGIN
tttcctccggcggcgccggcggccgcagaacttccgggtcggcgcggaggcggggcggaggcgccgcggcggctgttattgttcggctgggctcggtcgggcgctgtctccctcggctctgcgggtgtcagttcgtccggcttcctcacagcccctcactcccggcggctgacagcagcagcggcggcggcgggcggcgcctggcgtttcgaggctgagcggcaccggggttggggcgcggaggaggagcagcagcgggaggaggagccgtgtgccctggcactgagcggccgcggccatggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgttggtaaatcatgcttattgctacagtttacagacaagaggtttcagccagtgcatgaccttactattggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagatatgggatacggcagggcaagaatcctttcgttccatcacaaggtcgtattacagaggtgcagcaggagctttactagtttacgatattacacggagagatacattcaaccacttgacaacctggttagaagatgcccgccagcattccaattccaacatggtcattatgcttattggaaataaaagtgatttagaatctagaagagaagtaaaaaaagaagaaggtgaagcttttgcacgagaacatggactcatcttcatggaaacgtctgctaagactgcttccaatgtagaagaggcatttattaatacagcaaaagaaatttatgaaaaaattcaagaaggagtctttgacattaataatgaggcaaatggcattaaaattggccctcagcatgctgctaccaatgcaacacatgcaggcaatcagggaggacagcaggctgggggcggctgctgttgagtctgtttttactgtctagctgcccaacggggcctactcacttattctttcaccccctctcctcctgctcagctgagacatgaaactatttgaaatggctttatgtcacagaagactttaatccgtcaaattcttgtataactttgaataaatggttaatgttcacttaaaagacagattttggagattgtattcatatctatttgcatttgatttctaggtcaattgatgtgattatttttgttaaatgttgtcttgtgcccttaactacgaactgaattgtattaaacactacaaagtcatcttgagtattttaaatcggtttgtgtagttaggtttcccaacatctgtggttacctaatgtttaatattatagaactgtcctcagaaactttgtcaattttcacggctataaggaaacagaaggactcttttaattctgtatttatcatttactttctgtatatatagtttaataacctgcttgggtgtaatttgccaagcttgaattctttaatgcatttgcataaattctatactgtttagagcttaaagctacagaagcattgttaggaattgcttggacactgaattttaaactttttgacattgttaacaagcatgttcatcttttcttgtcactagtccaagaaaaatatgcttaatgtatattacaaaggctttgtatatgttaacctgttttaatgccaaaagtttgctttgtccacaatttccttaagacctcttcagaaagggatttgtttgccttaatgaatactgttgggaaaaaacacagtataatgagtgaaaagggcagaagcaagaaatttctacatcttagcgactccaagaagaatgagtatccacatttagatggcacattatgaggactttaatctttccttaaacacaataatgttttcttttttcttttattcacatgatttctaagtatatttttcatgcaggacagtttttcaaccttgatgtacagtgactgtgtaaaatttttctttcagtggcaacctctataatctttaaaatatggtgagcatcttgtctgttttgaaggggatatgacaataaatctatcagatggaaaatcctgttacaaagtagaaaagctttagtaatttactcagtgtggtggttttatcctttttttctttttctcccttggtctataatgaaattgttacagcagtgcaaaataaaatcctatgtataaaagtgttctttttttttattatgaccacctcttttttaatgtatttttagtccacttacagcttttacatgggtttaagcatgttttttaaaagggtcagaatggttaacactcaaccctttttaaaaattttgctaaaatgcgacaaatctcaccatactgaaattatttttgttgatggtgtaagcagtgtaagcaagtgttttctcctgaactagcacaaaagcacttatgcctgaaagaaagcataaagaagttctaactctgaaactaactactttcatttcgctcatggccttcaactttctacaggtcttccctgaagattcagcagtactctctcaaaggtttgacagtactcttgtgggaaatcaccaaatgctgtcatagttttgttttaactgtctccttgagggcagagggaagggtgagagaaaatctgttttcatgggtatttgtagtacagcctttttttctttcaagtggctgtatcaaattcactggtcttactaatcactgtctttaccagtgagtacaaaaagttaaggcaactaggacaggtactgctctataccaagaagagaatgattctttggaaattgttatttttaagcttctgttaatttttccagaagtttagtgcgtttcttttccatactttctcccctaattcttttatttgaagaagagaacttaatggcaaataaacaacaaaccaggacatgcattttaataccctaaggaaaaatggaaccctcaaatataactcctcccacaaccaccctaatgtgcctcagtctggggcagcaggtggacttctcaatagttcttttccacattctctacaaatcacatctaccgttaaggaatatgttatgaatcctttctgttaattgagaaagcaatgttattgtctgtgatttccagtctttgctcattttattatccctgtcaaataatgtaatattggtacctgcagttgaatttgtaatattgtaattgaatttttagttgatcttcgatcagtttttatagcatctatggacatagaaaatcagtcactgaaaaaaataaacacagctttcaatgtctcactcaacatgtaacattcaaaattgtgatcttcataaagacattgttaccattcgtcttgcaaatttaagacaactgaatgaaaagccaattttttgaaagaatgtggcatataattagatatacaactgaaacaggatatacaactgcatacaatttgtttttaatgatattttaaaatagcctgttagcaggaaaatagtccctatttatctgctaatggtcaaaaagagttaggatataaatcgtaccaaaatgtttccaatcactcagaaaaactgattcatgtctggctttgcaacaccttaaacatttattctgtcatagatagtaaagccccatctcagtttatttagtcctgaggttggcagcatggggtttgactatatgagctaaaagatacacaaagagataacgctgtttcataataaacaggaattgactatacaaataggtaaaccagcatatctacctgtatttctcagagtttagatgtgtgctttatgtttacattaaaataaagcctaacgccacagtagatcatctcatactgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5862 -> Molecular function: GO:0003924 [GTPase activity] evidence: IDA
GeneID:5862 -> Molecular function: GO:0005525 [GTP binding] evidence: IDA
GeneID:5862 -> Molecular function: GO:0019003 [GDP binding] evidence: IDA
GeneID:5862 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: IDA
GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: TAS
GeneID:5862 -> Biological process: GO:0006888 [ER to Golgi vesicle-mediated transport] evidence: TAS
GeneID:5862 -> Biological process: GO:0007264 [small GTPase mediated signal transduction] evidence: IEA
GeneID:5862 -> Biological process: GO:0015031 [protein transport] evidence: IEA
GeneID:5862 -> Cellular component: GO:0000139 [Golgi membrane] evidence: TAS
GeneID:5862 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA
GeneID:5862 -> Cellular component: GO:0033116 [endoplasmic reticulum-Golgi intermediate compartment membrane] evidence: IEA
GeneID:5862 -> Cellular component: GO:0042470 [melanosome] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.