2024-04-20 04:05:01, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002865 3812 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 1, mRNA. ACCESSION NM_002865 VERSION NM_002865.2 GI:336391091 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3812) AUTHORS de Barsy,M., Jamet,A., Filopon,D., Nicolas,C., Laloux,G., Rual,J.F., Muller,A., Twizere,J.C., Nkengfac,B., Vandenhaute,J., Hill,D.E., Salcedo,S.P., Gorvel,J.P., Letesson,J.J. and De Bolle,X. TITLE Identification of a Brucella spp. secreted effector specifically interacting with human small GTPase Rab2 JOURNAL Cell. Microbiol. 13 (7), 1044-1058 (2011) PUBMED 21501366 REMARK GeneRIF: The authors identified a specific interaction between the human small GTPase Rab2 and a Brucella spp. protein named RicA. REFERENCE 2 (bases 1 to 3812) AUTHORS Buffa,L., Fuchs,E., Pietropaolo,M., Barr,F. and Solimena,M. TITLE ICA69 is a novel Rab2 effector regulating ER-Golgi trafficking in insulinoma cells JOURNAL Eur. J. Cell Biol. 87 (4), 197-209 (2008) PUBMED 18187231 REMARK GeneRIF: ICA69 as a novel Rab2 effector and its role in regulating the early transport of insulin secretory granule proteins REFERENCE 3 (bases 1 to 3812) AUTHORS Dong,C. and Wu,G. TITLE Regulation of anterograde transport of adrenergic and angiotensin II receptors by Rab2 and Rab6 GTPases JOURNAL Cell. Signal. 19 (11), 2388-2399 (2007) PUBMED 17716866 REMARK GeneRIF: These data demonstrate that Rab2 and Rab6 differentially influence anterograde transport and signaling of GPCRs. REFERENCE 4 (bases 1 to 3812) AUTHORS Chi,A., Valencia,J.C., Hu,Z.Z., Watabe,H., Yamaguchi,H., Mangini,N.J., Huang,H., Canfield,V.A., Cheng,K.C., Yang,F., Abe,R., Yamagishi,S., Shabanowitz,J., Hearing,V.J., Wu,C., Appella,E. and Hunt,D.F. TITLE Proteomic and bioinformatic characterization of the biogenesis and function of melanosomes JOURNAL J. Proteome Res. 5 (11), 3135-3144 (2006) PUBMED 17081065 REFERENCE 5 (bases 1 to 3812) AUTHORS Eathiraj,S., Pan,X., Ritacco,C. and Lambright,D.G. TITLE Structural basis of family-wide Rab GTPase recognition by rabenosyn-5 JOURNAL Nature 436 (7049), 415-419 (2005) PUBMED 16034420 REFERENCE 6 (bases 1 to 3812) AUTHORS de Leeuw,H.P., Koster,P.M., Calafat,J., Janssen,H., van Zonneveld,A.J., van Mourik,J.A. and Voorberg,J. TITLE Small GTP-binding proteins in human endothelial cells JOURNAL Br. J. Haematol. 103 (1), 15-19 (1998) PUBMED 9792283 REFERENCE 7 (bases 1 to 3812) AUTHORS Tisdale,E.J. and Balch,W.E. TITLE Rab2 is essential for the maturation of pre-Golgi intermediates JOURNAL J. Biol. Chem. 271 (46), 29372-29379 (1996) PUBMED 8910601 REFERENCE 8 (bases 1 to 3812) AUTHORS Khosravi-Far,R., Lutz,R.J., Cox,A.D., Conroy,L., Bourne,J.R., Sinensky,M., Balch,W.E., Buss,J.E. and Der,C.J. TITLE Isoprenoid modification of rab proteins terminating in CC or CXC motifs JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (14), 6264-6268 (1991) PUBMED 1648736 REFERENCE 9 (bases 1 to 3812) AUTHORS Zahraoui,A., Touchot,N., Chardin,P. and Tavitian,A. TITLE The human Rab genes encode a family of GTP-binding proteins related to yeast YPT1 and SEC4 products involved in secretion JOURNAL J. Biol. Chem. 264 (21), 12394-12401 (1989) PUBMED 2501306 REFERENCE 10 (bases 1 to 3812) AUTHORS Tachibana,K., Umezawa,A., Kato,S. and Takano,T. TITLE Nucleotide sequence of a new YPT1-related human cDNA which belongs to the ras gene superfamily JOURNAL Nucleic Acids Res. 16 (21), 10368 (1988) PUBMED 3057444 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA648682.1, X12953.1, AC068389.10 and AW301641.1. On Jun 18, 2011 this sequence version replaced gi:4506364. Summary: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. Transcript Variant: This variant (1) represents the predominant transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X12953.1, BC008929.2 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-90 DA648682.1 3-92 91-1238 X12953.1 1-1148 1239-2127 AC068389.10 53096-53984 c 2128-3353 AC068389.10 51870-53095 c 3354-3812 AW301641.1 1-459 c FEATURES Location/Qualifiers source 1..3812 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q12.1" gene 1..3812 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="RAB2A, member RAS oncogene family" /db_xref="GeneID:5862" /db_xref="HGNC:9763" /db_xref="HPRD:01539" /db_xref="MIM:179509" exon 1..344 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 8 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:13248794" variation 35 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:188897877" variation 71 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:377019145" variation 180 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:11544472" variation 238 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:79202491" variation 269 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370633697" misc_feature 284..286 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="upstream in-frame stop codon" CDS 299..937 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="isoform a is encoded by transcript variant 1; RAB2, member RAS oncogene family; ras-related protein Rab-2A; small GTP binding protein RAB2A" /codon_start=1 /product="ras-related protein Rab-2A isoform a" /protein_id="NP_002856.1" /db_xref="GI:4506365" /db_xref="CCDS:CCDS6175.1" /db_xref="GeneID:5862" /db_xref="HGNC:9763" /db_xref="HPRD:01539" /db_xref="MIM:179509" /translation="
MAYAYLFKYIIIGDTGVGKSCLLLQFTDKRFQPVHDLTIGVEFGARMITIDGKQIKLQIWDTAGQESFRSITRSYYRGAAGALLVYDITRRDTFNHLTTWLEDARQHSNSNMVIMLIGNKSDLESRREVKKEEGEAFAREHGLIFMETSAKTASNVEEAFINTAKEIYEKIQEGVFDINNEANGIKIGPQHAATNATHAGNQGGQQAGGGCC
" misc_feature 299..355 /gene="RAB2A" /gene_synonym="LHX; RAB2" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P61019.1); Region: Required for interaction with PRKCI" misc_feature 305..808 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab GTPase family 2 (Rab2); Region: Rab2; cd01866" /db_xref="CDD:206658" misc_feature 305..322 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab subfamily motif 1 (RabSF1); other site" /db_xref="CDD:206658" misc_feature 335..358 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G1 box; other site" /db_xref="CDD:206658" misc_feature order(344..361,395..397,653..658,662..664,743..751) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="GTP/Mg2+ binding site [chemical binding]; other site" /db_xref="CDD:206658" misc_feature order(359..394,401..409) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab subfamily motif 2 (RabSF2); other site" /db_xref="CDD:206658" misc_feature order(389..391,404..430) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Switch I region; other site" /db_xref="CDD:206658" misc_feature 401..427 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P61019.1); Region: Effector region (By similarity)" misc_feature order(404..406,416..439,458..460,464..466) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="putative GEF interaction site [polypeptide binding]; other site" /db_xref="CDD:206658" misc_feature 410..412 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G2 box; other site" /db_xref="CDD:206658" misc_feature order(413..415,419..427,470..472,476..478,497..502, 509..511,521..523,527..538,797..799) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="putative effector interaction site; other site" /db_xref="CDD:206658" misc_feature order(413..418,422..424,476..481,500..502,506..508, 512..520) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="putative GDI interaction site [polypeptide binding]; other site" /db_xref="CDD:206658" misc_feature 413..427 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab family motif 1 (RabF1); other site" /db_xref="CDD:206658" misc_feature 464..478 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab family motif 2 (RabF2); other site" /db_xref="CDD:206658" misc_feature 479..490 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G3 box; other site" /db_xref="CDD:206658" misc_feature order(488..490,494..526) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Switch II region; other site" /db_xref="CDD:206658" misc_feature 497..514 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab family motif 3 (RabF3); other site" /db_xref="CDD:206658" misc_feature 521..535 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab family motif 4 (RabF4); other site" /db_xref="CDD:206658" misc_feature 548..565 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab family motif 5 (RabF5); other site" /db_xref="CDD:206658" misc_feature 629..646 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab subfamily motif 3 (RabSF3); other site" /db_xref="CDD:206658" misc_feature 653..664 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G4 box; other site" /db_xref="CDD:206658" misc_feature 743..751 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G5 box; other site" /db_xref="CDD:206658" misc_feature 791..808 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rab subfamily motif 4 (RabSF4); other site" /db_xref="CDD:206658" variation 307 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:373226742" exon 345..416 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 346 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:138440036" variation 413 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:11544474" exon 417..484 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 427 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:368402545" exon 485..567 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 522 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:11544470" exon 568..660 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 574 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:375530419" exon 661..772 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 685 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:141013917" variation 727 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370866047" variation 728 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:199581780" exon 773..841 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" exon 842..3812 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" STS 845..979 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="STS-R00195" /db_xref="UniSTS:16383" STS 850..980 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RH70011" /db_xref="UniSTS:5095" variation 925 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370628676" variation 926 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374486741" STS 928..1425 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RAB2_2543" /db_xref="UniSTS:280950" STS 946..1221 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1929" /db_xref="UniSTS:76818" variation 964 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:367660654" variation 965 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:201836844" variation 982 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:368529941" polyA_signal 1084..1089 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_site 1109 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 1200 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:183524386" variation 1281 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="c" /db_xref="dbSNP:187759374" variation 1303 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:76823768" variation 1330..1331 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="" /replace="tt" /db_xref="dbSNP:200305948" variation 1365 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:41272433" variation 1468 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:370058692" variation 1569 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:113877343" variation 1606 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374973250" variation 1708 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:79502934" variation 1831 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:77133934" STS 1897..2048 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1899" /db_xref="UniSTS:22645" STS 1897..2020 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RH92689" /db_xref="UniSTS:92717" variation 1976..1977 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="" /replace="a" /db_xref="dbSNP:35329667" STS 1990..2095 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1405E" /db_xref="UniSTS:151199" variation 2010 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:140580809" polyA_signal 2019..2024 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 2037 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:7413" polyA_site 2048 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_signal 2147..2152 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_site 2167 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 2276 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:369628178" variation 2318 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:373337569" variation 2411 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:12544487" variation 2453 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:78628010" variation 2504 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:629268" variation 2580 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:150407587" variation 2613 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:79970848" variation 2734 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:649634" variation 2803 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:138129268" variation 2830 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:192628540" variation 2888 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:75837686" variation 2976 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:2930041" STS 3002..3252 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1613" /db_xref="UniSTS:79309" variation 3022 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:149557425" variation 3026 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:9437" variation 3070 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="c" /db_xref="dbSNP:118165570" variation 3074 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:75974140" STS 3078..3262 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1394E" /db_xref="UniSTS:45049" variation 3190 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:186973869" polyA_signal 3235..3240 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3254 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:145073984" polyA_site 3264 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3312 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:76705987" variation 3318 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:652422" variation 3332 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:138862634" variation 3356 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374444619" variation 3403 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:142611281" variation 3410 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:113076295" variation 3416 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:191757602" variation 3430 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:113490250" variation 3499 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:184729393" variation 3673 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:116372466" variation 3707 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:189591638" variation 3716 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:181704218" polyA_signal 3774..3779 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3787 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:185297839" polyA_site 3805 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3812 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:664796" ORIGIN
tttcctccggcggcgccggcggccgcagaacttccgggtcggcgcggaggcggggcggaggcgccgcggcggctgttattgttcggctgggctcggtcgggcgctgtctccctcggctctgcgggtgtcagttcgtccggcttcctcacagcccctcactcccggcggctgacagcagcagcggcggcggcgggcggcgcctggcgtttcgaggctgagcggcaccggggttggggcgcggaggaggagcagcagcgggaggaggagccgtgtgccctggcactgagcggccgcggccatggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgttggtaaatcatgcttattgctacagtttacagacaagaggtttcagccagtgcatgaccttactattggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagatatgggatacggcagggcaagaatcctttcgttccatcacaaggtcgtattacagaggtgcagcaggagctttactagtttacgatattacacggagagatacattcaaccacttgacaacctggttagaagatgcccgccagcattccaattccaacatggtcattatgcttattggaaataaaagtgatttagaatctagaagagaagtaaaaaaagaagaaggtgaagcttttgcacgagaacatggactcatcttcatggaaacgtctgctaagactgcttccaatgtagaagaggcatttattaatacagcaaaagaaatttatgaaaaaattcaagaaggagtctttgacattaataatgaggcaaatggcattaaaattggccctcagcatgctgctaccaatgcaacacatgcaggcaatcagggaggacagcaggctgggggcggctgctgttgagtctgtttttactgtctagctgcccaacggggcctactcacttattctttcaccccctctcctcctgctcagctgagacatgaaactatttgaaatggctttatgtcacagaagactttaatccgtcaaattcttgtataactttgaataaatggttaatgttcacttaaaagacagattttggagattgtattcatatctatttgcatttgatttctaggtcaattgatgtgattatttttgttaaatgttgtcttgtgcccttaactacgaactgaattgtattaaacactacaaagtcatcttgagtattttaaatcggtttgtgtagttaggtttcccaacatctgtggttacctaatgtttaatattatagaactgtcctcagaaactttgtcaattttcacggctataaggaaacagaaggactcttttaattctgtatttatcatttactttctgtatatatagtttaataacctgcttgggtgtaatttgccaagcttgaattctttaatgcatttgcataaattctatactgtttagagcttaaagctacagaagcattgttaggaattgcttggacactgaattttaaactttttgacattgttaacaagcatgttcatcttttcttgtcactagtccaagaaaaatatgcttaatgtatattacaaaggctttgtatatgttaacctgttttaatgccaaaagtttgctttgtccacaatttccttaagacctcttcagaaagggatttgtttgccttaatgaatactgttgggaaaaaacacagtataatgagtgaaaagggcagaagcaagaaatttctacatcttagcgactccaagaagaatgagtatccacatttagatggcacattatgaggactttaatctttccttaaacacaataatgttttcttttttcttttattcacatgatttctaagtatatttttcatgcaggacagtttttcaaccttgatgtacagtgactgtgtaaaatttttctttcagtggcaacctctataatctttaaaatatggtgagcatcttgtctgttttgaaggggatatgacaataaatctatcagatggaaaatcctgttacaaagtagaaaagctttagtaatttactcagtgtggtggttttatcctttttttctttttctcccttggtctataatgaaattgttacagcagtgcaaaataaaatcctatgtataaaagtgttctttttttttattatgaccacctcttttttaatgtatttttagtccacttacagcttttacatgggtttaagcatgttttttaaaagggtcagaatggttaacactcaaccctttttaaaaattttgctaaaatgcgacaaatctcaccatactgaaattatttttgttgatggtgtaagcagtgtaagcaagtgttttctcctgaactagcacaaaagcacttatgcctgaaagaaagcataaagaagttctaactctgaaactaactactttcatttcgctcatggccttcaactttctacaggtcttccctgaagattcagcagtactctctcaaaggtttgacagtactcttgtgggaaatcaccaaatgctgtcatagttttgttttaactgtctccttgagggcagagggaagggtgagagaaaatctgttttcatgggtatttgtagtacagcctttttttctttcaagtggctgtatcaaattcactggtcttactaatcactgtctttaccagtgagtacaaaaagttaaggcaactaggacaggtactgctctataccaagaagagaatgattctttggaaattgttatttttaagcttctgttaatttttccagaagtttagtgcgtttcttttccatactttctcccctaattcttttatttgaagaagagaacttaatggcaaataaacaacaaaccaggacatgcattttaataccctaaggaaaaatggaaccctcaaatataactcctcccacaaccaccctaatgtgcctcagtctggggcagcaggtggacttctcaatagttcttttccacattctctacaaatcacatctaccgttaaggaatatgttatgaatcctttctgttaattgagaaagcaatgttattgtctgtgatttccagtctttgctcattttattatccctgtcaaataatgtaatattggtacctgcagttgaatttgtaatattgtaattgaatttttagttgatcttcgatcagtttttatagcatctatggacatagaaaatcagtcactgaaaaaaataaacacagctttcaatgtctcactcaacatgtaacattcaaaattgtgatcttcataaagacattgttaccattcgtcttgcaaatttaagacaactgaatgaaaagccaattttttgaaagaatgtggcatataattagatatacaactgaaacaggatatacaactgcatacaatttgtttttaatgatattttaaaatagcctgttagcaggaaaatagtccctatttatctgctaatggtcaaaaagagttaggatataaatcgtaccaaaatgtttccaatcactcagaaaaactgattcatgtctggctttgcaacaccttaaacatttattctgtcatagatagtaaagccccatctcagtttatttagtcctgaggttggcagcatggggtttgactatatgagctaaaagatacacaaagagataacgctgtttcataataaacaggaattgactatacaaataggtaaaccagcatatctacctgtatttctcagagtttagatgtgtgctttatgtttacattaaaataaagcctaacgccacagtagatcatctcatactgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5862 -> Molecular function: GO:0003924 [GTPase activity] evidence: IDA GeneID:5862 -> Molecular function: GO:0005525 [GTP binding] evidence: IDA GeneID:5862 -> Molecular function: GO:0019003 [GDP binding] evidence: IDA GeneID:5862 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: IDA GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: TAS GeneID:5862 -> Biological process: GO:0006888 [ER to Golgi vesicle-mediated transport] evidence: TAS GeneID:5862 -> Biological process: GO:0007264 [small GTPase mediated signal transduction] evidence: IEA GeneID:5862 -> Biological process: GO:0015031 [protein transport] evidence: IEA GeneID:5862 -> Cellular component: GO:0000139 [Golgi membrane] evidence: TAS GeneID:5862 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA GeneID:5862 -> Cellular component: GO:0033116 [endoplasmic reticulum-Golgi intermediate compartment membrane] evidence: IEA GeneID:5862 -> Cellular component: GO:0042470 [melanosome] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.