Home |
Help |
Advanced search
2024-04-19 09:29:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002817 1757 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit,
non-ATPase, 13 (PSMD13), transcript variant 1, mRNA.
ACCESSION NM_002817
VERSION NM_002817.3 GI:157502192
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1757)
AUTHORS Gieger,C., Radhakrishnan,A., Cvejic,A., Tang,W., Porcu,E.,
Pistis,G., Serbanovic-Canic,J., Elling,U., Goodall,A.H.,
Labrune,Y., Lopez,L.M., Magi,R., Meacham,S., Okada,Y., Pirastu,N.,
Sorice,R., Teumer,A., Voss,K., Zhang,W., Ramirez-Solis,R.,
Bis,J.C., Ellinghaus,D., Gogele,M., Hottenga,J.J., Langenberg,C.,
Kovacs,P., O'Reilly,P.F., Shin,S.Y., Esko,T., Hartiala,J.,
Kanoni,S., Murgia,F., Parsa,A., Stephens,J., van der Harst,P.,
Ellen van der Schoot,C., Allayee,H., Attwood,A., Balkau,B.,
Bastardot,F., Basu,S., Baumeister,S.E., Biino,G., Bomba,L.,
Bonnefond,A., Cambien,F., Chambers,J.C., Cucca,F., D'Adamo,P.,
Davies,G., de Boer,R.A., de Geus,E.J., Doring,A., Elliott,P.,
Erdmann,J., Evans,D.M., Falchi,M., Feng,W., Folsom,A.R.,
Frazer,I.H., Gibson,Q.D., Glazer,N.L., Hammond,C.,
Hartikainen,A.L., Heckbert,S.R., Hengstenberg,C., Hersch,M.,
Illig,T., Loos,R.J., Jolley,J., Khaw,K.T., Kuhnel,B.,
Kyrtsonis,M.C., Lagou,V., Lloyd-Jones,H., Lumley,T., Mangino,M.,
Maschio,A., Mateo Leach,I., McKnight,B., Memari,Y., Mitchell,B.D.,
Montgomery,G.W., Nakamura,Y., Nauck,M., Navis,G., Nothlings,U.,
Nolte,I.M., Porteous,D.J., Pouta,A., Pramstaller,P.P., Pullat,J.,
Ring,S.M., Rotter,J.I., Ruggiero,D., Ruokonen,A., Sala,C.,
Samani,N.J., Sambrook,J., Schlessinger,D., Schreiber,S.,
Schunkert,H., Scott,J., Smith,N.L., Snieder,H., Starr,J.M.,
Stumvoll,M., Takahashi,A., Tang,W.H., Taylor,K., Tenesa,A., Lay
Thein,S., Tonjes,A., Uda,M., Ulivi,S., van Veldhuisen,D.J.,
Visscher,P.M., Volker,U., Wichmann,H.E., Wiggins,K.L.,
Willemsen,G., Yang,T.P., Hua Zhao,J., Zitting,P., Bradley,J.R.,
Dedoussis,G.V., Gasparini,P., Hazen,S.L., Metspalu,A., Pirastu,M.,
Shuldiner,A.R., Joost van Pelt,L., Zwaginga,J.J., Boomsma,D.I.,
Deary,I.J., Franke,A., Froguel,P., Ganesh,S.K., Jarvelin,M.R.,
Martin,N.G., Meisinger,C., Psaty,B.M., Spector,T.D., Wareham,N.J.,
Akkerman,J.W., Ciullo,M., Deloukas,P., Greinacher,A., Jupe,S.,
Kamatani,N., Khadake,J., Kooner,J.S., Penninger,J., Prokopenko,I.,
Stemple,D., Toniolo,D., Wernisch,L., Sanna,S., Hicks,A.A.,
Rendon,A., Ferreira,M.A., Ouwehand,W.H. and Soranzo,N.
TITLE New gene functions in megakaryopoiesis and platelet formation
JOURNAL Nature 480 (7376), 201-208 (2011)
PUBMED 22139419
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1757)
AUTHORS Bellizzi,D., Dato,S., Cavalcante,P., Covello,G., Di Cianni,F.,
Passarino,G., Rose,G. and De Benedictis,G.
TITLE Characterization of a bidirectional promoter shared between two
human genes related to aging: SIRT3 and PSMD13
JOURNAL Genomics 89 (1), 143-150 (2007)
PUBMED 17059877
REMARK GeneRIF: The SIRT3 5' flanking region encompasses the PSMD13 gene
encoding the p40.5 regulator subunit of the 26S proteasome.
REFERENCE 3 (bases 1 to 1757)
AUTHORS Gandhi,T.K., Zhong,J., Mathivanan,S., Karthick,L., Chandrika,K.N.,
Mohan,S.S., Sharma,S., Pinkert,S., Nagaraju,S., Periaswamy,B.,
Mishra,G., Nandakumar,K., Shen,B., Deshpande,N., Nayak,R.,
Sarker,M., Boeke,J.D., Parmigiani,G., Schultz,J., Bader,J.S. and
Pandey,A.
TITLE Analysis of the human protein interactome and comparison with
yeast, worm and fly interaction datasets
JOURNAL Nat. Genet. 38 (3), 285-293 (2006)
PUBMED 16501559
REFERENCE 4 (bases 1 to 1757)
AUTHORS Listovsky,T., Oren,Y.S., Yudkovsky,Y., Mahbubani,H.M., Weiss,A.M.,
Lebendiker,M. and Brandeis,M.
TITLE Mammalian Cdh1/Fzr mediates its own degradation
JOURNAL EMBO J. 23 (7), 1619-1626 (2004)
PUBMED 15029244
REFERENCE 5 (bases 1 to 1757)
AUTHORS Bouwmeester,T., Bauch,A., Ruffner,H., Angrand,P.O., Bergamini,G.,
Croughton,K., Cruciat,C., Eberhard,D., Gagneur,J., Ghidelli,S.,
Hopf,C., Huhse,B., Mangano,R., Michon,A.M., Schirle,M., Schlegl,J.,
Schwab,M., Stein,M.A., Bauer,A., Casari,G., Drewes,G., Gavin,A.C.,
Jackson,D.B., Joberty,G., Neubauer,G., Rick,J., Kuster,B. and
Superti-Furga,G.
TITLE A physical and functional map of the human TNF-alpha/NF-kappa B
signal transduction pathway
JOURNAL Nat. Cell Biol. 6 (2), 97-105 (2004)
PUBMED 14743216
REMARK Erratum:[Nat Cell Biol. 2004 May;6(5):465]
REFERENCE 6 (bases 1 to 1757)
AUTHORS Simon,J.H., Gaddis,N.C., Fouchier,R.A. and Malim,M.H.
TITLE Evidence for a newly discovered cellular anti-HIV-1 phenotype
JOURNAL Nat. Med. 4 (12), 1397-1400 (1998)
PUBMED 9846577
REFERENCE 7 (bases 1 to 1757)
AUTHORS Madani,N. and Kabat,D.
TITLE An endogenous inhibitor of human immunodeficiency virus in human
lymphocytes is overcome by the viral Vif protein
JOURNAL J. Virol. 72 (12), 10251-10255 (1998)
PUBMED 9811770
REFERENCE 8 (bases 1 to 1757)
AUTHORS Hori,T., Kato,S., Saeki,M., DeMartino,G.N., Slaughter,C.A.,
Takeuchi,J., Toh-e,A. and Tanaka,K.
TITLE cDNA cloning and functional analysis of p28 (Nas6p) and p40.5
(Nas7p), two novel regulatory subunits of the 26S proteasome
JOURNAL Gene 216 (1), 113-122 (1998)
PUBMED 9714768
REFERENCE 9 (bases 1 to 1757)
AUTHORS Seeger,M., Ferrell,K., Frank,R. and Dubiel,W.
TITLE HIV-1 tat inhibits the 20 S proteasome and its 11 S
regulator-mediated activation
JOURNAL J. Biol. Chem. 272 (13), 8145-8148 (1997)
PUBMED 9079628
REFERENCE 10 (bases 1 to 1757)
AUTHORS Coux,O., Tanaka,K. and Goldberg,A.L.
TITLE Structure and functions of the 20S and 26S proteasomes
JOURNAL Annu. Rev. Biochem. 65, 801-847 (1996)
PUBMED 8811196
REMARK Review article
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC136475.7, AB009398.1 and AA931044.1.
On Sep 25, 2007 this sequence version replaced gi:28872727.
Summary: The 26S proteasome is a multicatalytic proteinase complex
with a highly ordered structure composed of 2 complexes, a 20S core
and a 19S regulator. The 20S core is composed of 4 rings of 28
non-identical subunits; 2 rings are composed of 7 alpha subunits
and 2 rings are composed of 7 beta subunits. The 19S regulator is
composed of a base, which contains 6 ATPase subunits and 2
non-ATPase subunits, and a lid, which contains up to 10 non-ATPase
subunits. Proteasomes are distributed throughout eukaryotic cells
at a high concentration and cleave peptides in an
ATP/ubiquitin-dependent process in a non-lysosomal pathway. An
essential function of a modified proteasome, the immunoproteasome,
is the processing of class I MHC peptides. This gene encodes a
non-ATPase subunit of the 19S regulator. Two transcripts encoding
different isoforms have been described. [provided by RefSeq, Jul
2008].
Transcript Variant: This variant (1) encodes the longer isoform
(1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF083245.1, AB009398.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-173 AC136475.7 21352-21524
174-1754 AB009398.1 1-1581
1755-1757 AA931044.1 1-3 c
FEATURES Location/Qualifiers
source 1..1757
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11p15.5"
gene 1..1757
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/note="proteasome (prosome, macropain) 26S subunit,
non-ATPase, 13"
/db_xref="GeneID:5719"
/db_xref="HGNC:9558"
/db_xref="MIM:603481"
exon 1..337
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 4
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:519592"
variation 27
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:182895690"
variation 64
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:2272563"
misc_feature 168..170
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/note="upstream in-frame stop codon"
variation 184
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:149034138"
variation 195
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="g"
/replace="t"
/db_xref="dbSNP:200286876"
variation 201
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="t"
/db_xref="dbSNP:188150985"
variation 215
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:369344513"
variation 223
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:12293349"
CDS 243..1373
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/note="isoform 1 is encoded by transcript variant 1; 26S
proteasome subunit p40.5; 26S proteasome regulatory
subunit S11; 26S proteasome non-ATPase regulatory subunit
13; 26S proteasome regulatory subunit p40.5; 26S
proteasome regulatory subunit RPN9"
/codon_start=1
/product="26S proteasome non-ATPase regulatory subunit 13
isoform 1"
/protein_id="NP_002808.3"
/db_xref="GI:157502193"
/db_xref="CCDS:CCDS7692.1"
/db_xref="GeneID:5719"
/db_xref="HGNC:9558"
/db_xref="MIM:603481"
/translation="
MKDVPGFLQQSQNSGPGQPAVWHRLEELYTKKLWHQLTLQVLDFVQDPCFAQGDGLIKLYENFISEFEHRVNPLSLVEIILHVVRQMTDPNVALTFLEKTREKVKSSDEAVILCKTAIGALKLNIGDLQVTKETIEDVEEMLNNLPGVTSVHSRFYDLSSKYYQTIGNHASYYKDALRFLGCVDIKDLPVSEQQERAFTLGLAGLLGEGVFNFGELLMHPVLESLRNTDRQWLIDTLYAFNSGNVERFQTLKTAWGQQPDLAANEAQLLRKIQLLCLMEMTFTRPANHRQLTFEEIAKSAKITVNEVELLVMKALSVGLVKGSIDEVDKRVHMTWVQPRVLDLQQIKGMKDRLEFWCTDVKSMEMLVEHQAHDILT
"
misc_feature 1041..1310
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/note="PCI/PINT associated module; Region: PAM;
smart00753"
/db_xref="CDD:197859"
misc_feature 1134..1136
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (Q9UNM6.2); acetylation site"
variation 267
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/db_xref="dbSNP:138214549"
variation 275
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:141263892"
variation 280
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045288"
variation 288
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:201217300"
variation 294
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/db_xref="dbSNP:373557814"
variation 326
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="g"
/db_xref="dbSNP:370974834"
exon 338..416
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
exon 417..451
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
exon 452..507
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 458
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:1128320"
variation 462
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:1128321"
variation 488
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:1128322"
exon 508..551
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 543
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:372391905"
variation 544
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:376432155"
exon 552..638
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 582
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:138068479"
variation 618
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:372085323"
exon 639..810
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 642
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:372670379"
variation 646
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:369255716"
variation 651
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201907126"
variation 669
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:143016806"
variation 691
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:28927679"
variation 692
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:372417183"
variation 702
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:190227821"
variation 703
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:370025144"
variation 739
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:140294264"
variation 740
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:142720939"
variation 749
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:147375021"
variation 751
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:200598221"
variation 774
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:148437656"
exon 811..890
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 839
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:142225853"
variation 845
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:200046358"
variation 853
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:1794108"
variation 855
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:1794109"
variation 861
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:151305149"
variation 864
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:368844853"
variation 890
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:139390743"
exon 891..1016
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 894
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:146649608"
variation 905
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201372160"
variation 920
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:375739010"
variation 931
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:141198412"
variation 975
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:369505967"
variation 982
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:184893349"
variation 986
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="g"
/db_xref="dbSNP:201506453"
variation 1002
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:145020061"
variation 1013
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:377054047"
exon 1017..1079
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 1034
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="g"
/replace="t"
/db_xref="dbSNP:372280734"
variation 1038
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:370394564"
exon 1080..1160
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 1139
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:145743654"
exon 1161..1277
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 1163
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:372551194"
variation 1185
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:371873059"
variation 1250
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201183554"
exon 1278..1757
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/inference="alignment:Splign:1.39.8"
variation 1296
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:148960827"
variation 1316
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:143526107"
variation 1338
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/db_xref="dbSNP:199698555"
variation 1362
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:200373903"
variation 1377
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:192467588"
variation 1389
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:12065"
variation 1390
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:200513693"
variation 1397
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="g"
/db_xref="dbSNP:372882483"
variation 1422
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:6540"
variation 1506
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:1045405"
variation 1507
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:111603100"
variation 1508
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:2948222"
variation 1551
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="g"
/replace="t"
/db_xref="dbSNP:184828985"
variation 1557
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="g"
/replace="t"
/db_xref="dbSNP:7116231"
variation 1591
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1045502"
STS 1594..1732
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/standard_name="STS-T99644"
/db_xref="UniSTS:62372"
variation 1611
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:372259956"
variation 1614
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:3817635"
variation 1624
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:6541"
variation 1641
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:369873779"
variation 1661
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2948223"
variation 1696
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="c"
/db_xref="dbSNP:186582362"
variation 1697
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:368198844"
variation 1710
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:113652939"
variation 1714
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="t"
/db_xref="dbSNP:6542"
variation 1715
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045577"
variation 1729
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
/replace="c"
/replace="g"
/db_xref="dbSNP:1801807"
polyA_signal 1734..1739
/gene="PSMD13"
/gene_synonym="HSPC027; p40.5; Rpn9; S11"
ORIGIN
tttgacgcctcaatggcacagccaagtgcgcgggaagtgggctgcaaacgccggagagttttgtccggagcgcagagacgcgctgtaaccgagcaaccagcggggcccgcccccggcctgctacggcgctcccagcctgccccgcgccgctcggcgccggaagtgagtgagcatttccggcagccatccccgcggtgctgacatcccggttgttcttctgtgccgggggtcttcctgctgtcatgaaggacgtaccgggcttcctacagcagagccagaactccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagctttatgaaaactttatcagtgaatttgaacacagggtgaaccctttgtccctcgtggaaatcattcttcatgtagttagacagatgactgatcctaatgtggctcttacttttctggaaaagactcgtgagaaggtgaaaagtagtgatgaggcagtgatcctgtgtaaaacagcaattggagctctaaaattaaacatcggggacctacaggttacaaaggaaacaattgaagatgttgaagaaatgctcaacaaccttcctggtgtgacatcggttcacagtcgtttctatgatctctccagtaaatactatcaaacaatcggaaaccacgcgtcctactacaaagatgctctgcggtttttgggctgtgttgacatcaaggatctaccagtgtctgagcagcaggagagagccttcacgctggggctagcaggacttctcggcgagggagtttttaactttggagaactcctcatgcaccctgtgctggagtccctgaggaatactgaccggcagtggctgattgacaccctctatgccttcaacagtggcaacgtagagcggttccagactctgaagactgcctggggccagcagcctgatttagcagctaatgaagcccagcttctgaggaaaattcagttgttgtgcctcatggagatgactttcacacgacctgccaatcacagacaactcacttttgaagaaattgccaaaagtgctaaaatcacagtgaatgaggtggagcttctggtgatgaaggccctttcggtggggctggtgaaaggcagtatagacgaggtggacaaacgagtccacatgacctgggtgcagccccgagtgttggatttgcaacagatcaagggaatgaaggaccgcctggagttctggtgcacggatgtgaagagcatggagatgctggtggagcaccaggcccatgacatcctcacctagggccccctggttccccgtcgtgtctcctttgactcacctgagagaggcgtttgcagccaatgaagctggctgctcagacggtcgacattgaatttgggtgggggttgggatcctgtctgaagtacagactgttcttgctctaaaaacaggactgtccctgatgggagccaggccacagggaggaggcttctttgtgggtctctcctgcagagggtgggggtctcagggtcttaggtgatacgggagagaaagaacgtgccaggcaggaggccccctgaagtctgtgtactccgaggtggatctccatccccatccacctgtacggacatcttttccgttgcggtttgagaatgttcctataataaacccctctgctttgttctt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5719 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:5719 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:5719 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5719 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:5719 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
GeneID:5719 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
GeneID:5719 -> Biological process: GO:0007127 [meiosis I] evidence: IEA
GeneID:5719 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:5719 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:5719 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
GeneID:5719 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5719 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5719 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5719 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5719 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS
GeneID:5719 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5719 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5719 -> Cellular component: GO:0005838 [proteasome regulatory particle] evidence: IEA
GeneID:5719 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.