Home |
Help |
Advanced search
2024-04-25 20:22:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002810 1332 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit,
non-ATPase, 4 (PSMD4), mRNA.
ACCESSION NM_002810
VERSION NM_002810.2 GI:78000204
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1332)
AUTHORS Rani,N., Aichem,A., Schmidtke,G., Kreft,S.G. and Groettrup,M.
TITLE FAT10 and NUB1L bind to the VWA domain of Rpn10 and Rpn1 to enable
proteasome-mediated proteolysis
JOURNAL Nat Commun 3, 749 (2012)
PUBMED 22434192
REMARK GeneRIF: identified the VWA domain of hRpn10 as a receptor for
ubiquitin-like proteins within the 26S proteasome and elucidated
how FAT10 mediates efficient proteolysis by the proteasome
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1332)
AUTHORS Shaughnessy,J.D. Jr., Qu,P., Usmani,S., Heuck,C.J., Zhang,Q.,
Zhou,Y., Tian,E., Hanamura,I., van Rhee,F., Anaissie,E.,
Epstein,J., Nair,B., Stephens,O., Williams,R., Waheed,S.,
Alsayed,Y., Crowley,J. and Barlogie,B.
TITLE Pharmacogenomics of bortezomib test-dosing identifies
hyperexpression of proteasome genes, especially PSMD4, as novel
high-risk feature in myeloma treated with Total Therapy 3
JOURNAL Blood 118 (13), 3512-3524 (2011)
PUBMED 21628408
REMARK GeneRIF: Both higher PSMD4 expression levels and higher 1q21 copy
numbers affected clinical outcome adversely.
REFERENCE 3 (bases 1 to 1332)
AUTHORS Elangovan,M., Oh,C., Sukumaran,L., Wojcik,C. and Yoo,Y.J.
TITLE Functional differences between two major ubiquitin receptors in the
proteasome; S5a and hRpn13
JOURNAL Biochem. Biophys. Res. Commun. 396 (2), 425-428 (2010)
PUBMED 20417181
REMARK GeneRIF: results suggest that there is different substrate
specificity between S5a and hRpn13 at the level of delivery and S5a
may be the major docking site for ERAD substrates.
REFERENCE 4 (bases 1 to 1332)
AUTHORS Safadi,S.S. and Shaw,G.S.
TITLE Differential interaction of the E3 ligase parkin with the
proteasomal subunit S5a and the endocytic protein Eps15
JOURNAL J. Biol. Chem. 285 (2), 1424-1434 (2010)
PUBMED 19875440
REMARK GeneRIF: parkin Ubld uses differential surfaces to recruit UIM
regions from the S5a proteasomal subunit compared with Eps15
involved in cell signaling.
REFERENCE 5 (bases 1 to 1332)
AUTHORS Zhang,N., Wang,Q., Ehlinger,A., Randles,L., Lary,J.W., Kang,Y.,
Haririnia,A., Storaska,A.J., Cole,J.L., Fushman,D. and Walters,K.J.
TITLE Structure of the s5a:k48-linked diubiquitin complex and its
interactions with rpn13
JOURNAL Mol. Cell 35 (3), 280-290 (2009)
PUBMED 19683493
REMARK GeneRIF: The binding of S5a to K48-linked diubiquitin is defined at
an atomic level resolution.
REFERENCE 6 (bases 1 to 1332)
AUTHORS Seeger,M., Ferrell,K., Frank,R. and Dubiel,W.
TITLE HIV-1 tat inhibits the 20 S proteasome and its 11 S
regulator-mediated activation
JOURNAL J. Biol. Chem. 272 (13), 8145-8148 (1997)
PUBMED 9079628
REFERENCE 7 (bases 1 to 1332)
AUTHORS Ferrell,K., Deveraux,Q., van Nocker,S. and Rechsteiner,M.
TITLE Molecular cloning and expression of a multiubiquitin chain binding
subunit of the human 26S protease
JOURNAL FEBS Lett. 381 (1-2), 143-148 (1996)
PUBMED 8641424
REFERENCE 8 (bases 1 to 1332)
AUTHORS Coux,O., Tanaka,K. and Goldberg,A.L.
TITLE Structure and functions of the 20S and 26S proteasomes
JOURNAL Annu. Rev. Biochem. 65, 801-847 (1996)
PUBMED 8811196
REMARK Review article
REFERENCE 9 (bases 1 to 1332)
AUTHORS Johansson,E., Lonnroth,I., Lange,S., Jonson,I., Jennische,E. and
Lonnroth,C.
TITLE Molecular cloning and expression of a pituitary gland protein
modulating intestinal fluid secretion
JOURNAL J. Biol. Chem. 270 (35), 20615-20620 (1995)
PUBMED 7657640
REFERENCE 10 (bases 1 to 1332)
AUTHORS Lonnroth,I. and Lange,S.
TITLE Purification and characterization of the antisecretory factor: a
protein in the central nervous system and in the gut which inhibits
intestinal hypersecretion induced by cholera toxin
JOURNAL Biochim. Biophys. Acta 883 (1), 138-144 (1986)
PUBMED 3524692
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U24704.1 and AL391069.11.
This sequence is a reference standard in the RefSeqGene project.
On Oct 21, 2005 this sequence version replaced gi:5292160.
Summary: The 26S proteasome is a multicatalytic proteinase complex
with a highly ordered structure composed of 2 complexes, a 20S core
and a 19S regulator. The 20S core is composed of 4 rings of 28
non-identical subunits; 2 rings are composed of 7 alpha subunits
and 2 rings are composed of 7 beta subunits. The 19S regulator is
composed of a base, which contains 6 ATPase subunits and 2
non-ATPase subunits, and a lid, which contains up to 10 non-ATPase
subunits. Proteasomes are distributed throughout eukaryotic cells
at a high concentration and cleave peptides in an
ATP/ubiquitin-dependent process in a non-lysosomal pathway. An
essential function of a modified proteasome, the immunoproteasome,
is the processing of class I MHC peptides. This gene encodes one of
the non-ATPase subunits of the 19S regulator lid. Pseudogenes have
been identified on chromosomes 10 and 21. [provided by RefSeq, Jul
2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U24704.1, BC072008.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1313 U24704.1 1-1313
1314-1332 AL391069.11 4416-4434
FEATURES Location/Qualifiers
source 1..1332
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q21.3"
gene 1..1332
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/note="proteasome (prosome, macropain) 26S subunit,
non-ATPase, 4"
/db_xref="GeneID:5710"
/db_xref="HGNC:9561"
/db_xref="HPRD:03386"
/db_xref="MIM:601648"
exon 1..88
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 58
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="g"
/replace="t"
/db_xref="dbSNP:376865448"
CDS 63..1196
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/note="S5a/antisecretory factor protein; antisecretory
factor 1; angiocidin; RPN10 homolog; multiubiquitin
chain-binding protein; 26S proteasome regulatory subunit
S5A"
/codon_start=1
/product="26S proteasome non-ATPase regulatory subunit 4"
/protein_id="NP_002801.1"
/db_xref="GI:5292161"
/db_xref="CCDS:CCDS991.1"
/db_xref="GeneID:5710"
/db_xref="HGNC:9561"
/db_xref="HPRD:03386"
/db_xref="MIM:601648"
/translation="
MVLESTMVCVDNSEYMRNGDFLPTRLQAQQDAVNIVCHSKTRSNPENNVGLITLANDCEVLTTLTPDTGRILSKLHTVQPKGKITFCTGIRVAHLALKHRQGKNHKMRIIAFVGSPVEDNEKDLVKLAKRLKKEKVNVDIINFGEEEVNTEKLTAFVNTLNGKDGTGSHLVTVPPGPSLADALISSPILAGEGGAMLGLGASDFEFGVDPSADPELALALRVSMEEQRQRQEEEARRAAAASAAEAGIATTGTEDSDDALLKMTISQQEFGRTGLPDLSSMTEEEQIAYAMQMSLQGAEFGQAESADIDASSAMDTSEPAKEEDDYDVMQDPEFLQSVLENLPGVDPNNEAIRNAMGSLASQATKDGKKDKKEEDKK
"
misc_feature 63..623
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/note="26S proteasome plays a major role in eukaryotic
protein breakdown, especially for ubiquitin-tagged
proteins. It is an ATP-dependent protease responsible for
the bulk of non-lysosomal proteolysis in eukaryotes, often
using covalent modification of...; Region:
VWA_26S_proteasome_subunit; cd01452"
/db_xref="CDD:238729"
misc_feature order(93..95,99..101,249..251)
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/note="partial signature motif; other site"
/db_xref="CDD:238729"
misc_feature 693..752
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P55036.1);
Region: UIM 1"
misc_feature 708..722
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P55036.1);
Region: Essential for ubiquitin-binding"
misc_feature 810..812
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 858..860
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P55036.1); phosphorylation site"
misc_feature 858..860
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 906..965
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P55036.1);
Region: UIM 2"
misc_feature 921..935
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P55036.1);
Region: Essential for ubiquitin-binding"
misc_feature 1134..1136
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P55036.1); phosphorylation site"
misc_feature 1143..1145
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P55036.1); phosphorylation site"
exon 89..229
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 101
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:200077868"
variation 127
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:372433800"
variation 140
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:375634881"
variation 159
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:201730638"
variation 207
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="g"
/db_xref="dbSNP:201739700"
variation 218
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="c"
/db_xref="dbSNP:146444512"
exon 230..344
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 240
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:201585317"
variation 245
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:151089424"
variation 291
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:368815128"
variation 305
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:150267583"
variation 336
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:186973011"
variation 338
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="g"
/db_xref="dbSNP:139032841"
exon 345..431
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 391
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:144567844"
exon 432..500
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 451
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:369420046"
variation 461
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:144515450"
variation 475
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:148029660"
variation 480
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:147198219"
variation 481
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:373571268"
variation 485
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:144527399"
exon 501..716
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 539
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:61732647"
variation 540
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:371400877"
variation 569
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="g"
/replace="t"
/db_xref="dbSNP:374663507"
variation 587
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:113378677"
variation 589
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:185570531"
exon 717..825
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 735..736
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace=""
/replace="a"
/db_xref="dbSNP:34045693"
variation 757
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:201606359"
variation 768
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:376375221"
variation 784
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056406"
variation 791
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:373625649"
variation 812
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:41269696"
variation 818
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="g"
/db_xref="dbSNP:146853280"
exon 826..957
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 876
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:181572831"
variation 896
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:368431425"
variation 918
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="c"
/db_xref="dbSNP:201653325"
exon 958..1025
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 959
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="g"
/replace="t"
/db_xref="dbSNP:1134743"
variation 966
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:200986011"
variation 970
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:370062097"
variation 974
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:140690758"
STS 991..1120
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/standard_name="SHGC-52120"
/db_xref="UniSTS:30285"
variation 1013
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:7489"
variation 1024
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:376648335"
exon 1026..1332
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/inference="alignment:Splign:1.39.8"
variation 1058
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="c"
/db_xref="dbSNP:1802788"
STS 1066..1274
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/standard_name="RH26962"
/db_xref="UniSTS:92327"
variation 1090
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="g"
/db_xref="dbSNP:4922"
variation 1097
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:11430"
STS 1121..1238
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/standard_name="RH36413"
/db_xref="UniSTS:71539"
variation 1128
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:201794751"
variation 1160
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:140075955"
variation 1175
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:181354180"
variation 1180
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1064203"
variation 1182
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:201262155"
variation 1223
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="g"
/replace="t"
/db_xref="dbSNP:185955158"
variation 1266
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
/replace="a"
/replace="g"
/db_xref="dbSNP:147117956"
polyA_signal 1294..1299
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
polyA_site 1332
/gene="PSMD4"
/gene_synonym="AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A"
ORIGIN
aattggaggagttgttgttaggccgtcccggagacccggtcgggagggaggaaggtggcaagatggtgttggaaagcactatggtgtgtgtggacaacagtgagtatatgcggaatggagacttcttacccaccaggctgcaggcccagcaggatgctgtcaacatagtttgtcattcaaagacccgcagcaaccctgagaacaacgtgggccttatcacactggctaatgactgtgaagtgctgaccacactcaccccagacactggccgtatcctgtccaagctacatactgtccaacccaagggcaagatcaccttctgcacgggcatccgcgtggcccatctggctctgaagcaccgacaaggcaagaatcacaagatgcgcatcattgcctttgtgggaagcccagtggaggacaatgagaaggatctggtgaaactggctaaacgcctcaagaaggagaaagtaaatgttgacattatcaattttggggaagaggaggtgaacacagaaaagctgacagcctttgtaaacacgttgaatggcaaagatggaaccggttctcatctggtgacagtgcctcctgggcccagtttggctgatgctctcatcagttctccgattttggctggtgaaggtggtgccatgctgggtcttggtgccagtgactttgaatttggagtagatcccagtgctgatcctgagctggccttggcccttcgtgtatctatggaagagcagcggcagcggcaggaggaggaggcccggcgggcagctgcagcttctgctgctgaggccgggattgctacgactgggactgaagactcagacgatgccctgctgaagatgaccatcagccagcaagagtttggccgcactgggcttcctgacctaagcagtatgactgaggaagagcagattgcttatgccatgcagatgtccctgcagggagcagagtttggccaggcggaatcagcagacattgatgccagctcagctatggacacatctgagccagccaaggaggaggatgattacgacgtgatgcaggaccccgagttccttcagagtgtcctagagaacctcccaggtgtggatcccaacaatgaagccattcgaaatgctatgggctccctggcctcccaggccaccaaggacggcaagaaggacaagaaggaggaagacaagaagtgagactggagggaaagggtagctgagtctgcttaggggactgcatgggaagcacggaatatagggttagatgtgtgttatctgtaaccattacagcctaaataaagcttggcaactttttttccttttttgcttcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5710 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5710 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:5710 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:5710 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5710 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:5710 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
GeneID:5710 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
GeneID:5710 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:5710 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:5710 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
GeneID:5710 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5710 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5710 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5710 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5710 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS
GeneID:5710 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5710 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5710 -> Cellular component: GO:0008540 [proteasome regulatory particle, base subcomplex] evidence: IEA
GeneID:5710 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.