2024-04-20 14:02:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002807 3329 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 (PSMD1), transcript variant 1, mRNA. ACCESSION NM_002807 VERSION NM_002807.3 GI:300388181 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3329) AUTHORS Zhang,L., Hu,J.J. and Gong,F. TITLE MG132 inhibition of proteasome blocks apoptosis induced by severe DNA damage JOURNAL Cell Cycle 10 (20), 3515-3518 (2011) PUBMED 22031102 REMARK GeneRIF: The 26S proteasome plays a key role in promoting apoptosis induced by high doses of UV irradiation. REFERENCE 2 (bases 1 to 3329) AUTHORS Lee,S.H., Park,Y., Yoon,S.K. and Yoon,J.B. TITLE Osmotic stress inhibits proteasome by p38 MAPK-dependent phosphorylation JOURNAL J. Biol. Chem. 285 (53), 41280-41289 (2010) PUBMED 21044959 REMARK GeneRIF: p38 MAPK negatively regulates the proteasome activity by phosphorylating Thr-273 of Rpn2 REFERENCE 3 (bases 1 to 3329) AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B, Yusuf S, Gerstein HC, Engert JC and Anand S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 4 (bases 1 to 3329) AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M, Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ, Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S, Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD, Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE and Hingorani AD. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 3329) AUTHORS da Fonseca,P.C. and Morris,E.P. TITLE Structure of the human 26S proteasome: subunit radial displacements open the gate into the proteolytic core JOURNAL J. Biol. Chem. 283 (34), 23305-23314 (2008) PUBMED 18534977 REMARK GeneRIF: analysis of how subunit radial displacements open the gate into the proteolytic core in the human 26S proteasome REFERENCE 6 (bases 1 to 3329) AUTHORS Simon,J.H., Gaddis,N.C., Fouchier,R.A. and Malim,M.H. TITLE Evidence for a newly discovered cellular anti-HIV-1 phenotype JOURNAL Nat. Med. 4 (12), 1397-1400 (1998) PUBMED 9846577 REFERENCE 7 (bases 1 to 3329) AUTHORS Madani,N. and Kabat,D. TITLE An endogenous inhibitor of human immunodeficiency virus in human lymphocytes is overcome by the viral Vif protein JOURNAL J. Virol. 72 (12), 10251-10255 (1998) PUBMED 9811770 REFERENCE 8 (bases 1 to 3329) AUTHORS Seeger,M., Ferrell,K., Frank,R. and Dubiel,W. TITLE HIV-1 tat inhibits the 20 S proteasome and its 11 S regulator-mediated activation JOURNAL J. Biol. Chem. 272 (13), 8145-8148 (1997) PUBMED 9079628 REFERENCE 9 (bases 1 to 3329) AUTHORS Yokota,K., Kagawa,S., Shimizu,Y., Akioka,H., Tsurumi,C., Noda,C., Fujimuro,M., Yokosawa,H., Fujiwara,T., Takahashi,E., Ohba,M., Yamasaki,M., DeMartino,G.N., Slaughter,C.A., Toh-e,A. and Tanaka,K. TITLE CDNA cloning of p112, the largest regulatory subunit of the human 26s proteasome, and functional analysis of its yeast homologue, sen3p JOURNAL Mol. Biol. Cell 7 (6), 853-870 (1996) PUBMED 8816993 REFERENCE 10 (bases 1 to 3329) AUTHORS Coux,O., Tanaka,K. and Goldberg,A.L. TITLE Structure and functions of the 20S and 26S proteasomes JOURNAL Annu. Rev. Biochem. 65, 801-847 (1996) PUBMED 8811196 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA385817.1, BC094720.1, AC009407.8 and AA169719.1. On Jul 9, 2010 this sequence version replaced gi:25777599. Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes the largest non-ATPase subunit of the 19S regulator lid, which is responsible for substrate recognition and binding. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2010]. Transcript Variant: This variant (1) is the longest transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC094720.1, D44466.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-14 DA385817.1 1-14 15-3026 BC094720.1 1-3012 3027-3033 AC009407.8 156343-156349 3034-3298 AC009407.8 158163-158427 3299-3329 AA169719.1 1-31 c FEATURES Location/Qualifiers source 1..3329 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q37.1" gene 1..3329 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="proteasome (prosome, macropain) 26S subunit, non-ATPase, 1" /db_xref="GeneID:5707" /db_xref="HGNC:9554" /db_xref="HPRD:10169" exon 1..178 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 9 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:12469096" variation 43 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:374992564" misc_feature 85..87 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="upstream in-frame stop codon" variation 92 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:77415113" variation 113 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="t" /db_xref="dbSNP:186537455" CDS 163..3024 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="isoform 1 is encoded by transcript variant 1; 26S proteasome non-ATPase regulatory subunit 1; 26S proteasome subunit p112; 26S proteasome regulatory subunit S1; 26S proteasome regulatory subunit RPN2" /codon_start=1 /product="26S proteasome non-ATPase regulatory subunit 1 isoform 1" /protein_id="NP_002798.2" /db_xref="GI:25777600" /db_xref="CCDS:CCDS2482.1" /db_xref="GeneID:5707" /db_xref="HGNC:9554" /db_xref="HPRD:10169" /translation="
MITSAAGIISLLDEDEPQLKEFALHKLNAVVNDFWAEISESVDKIEVLYEDEGFRSRQFAALVASKVFYHLGAFEESLNYALGAGDLFNVNDNSEYVETIIAKCIDHYTKQCVENADLPEGEKKPIDQRLEGIVNKMFQRCLDDHKYKQAIGIALETRRLDVFEKTILESNDVPGMLAYSLKLCMSLMQNKQFRNKVLRVLVKIYMNLEKPDFINVCQCLIFLDDPQAVSDILEKLVKEDNLLMAYQICFDLYESASQQFLSSVIQNLRTVGTPIASVPGSTNTGTVPGSEKDSDSMETEEKTSSAFVGKTPEASPEPKDQTLKMIKILSGEMAIELHLQFLIRNNNTDLMILKNTKDAVRNSVCHTATVIANSFMHCGTTSDQFLRDNLEWLARATNWAKFTATASLGVIHKGHEKEALQLMATYLPKDTSPGSAYQEGGGLYALGLIHANHGGDIIDYLLNQLKNASNDIVRHGGSLGLGLAAMGTARQDVYDLLKTNLYQDDAVTGEAAGLALGLVMLGSKNAQAIEDMVGYAQETQHEKILRGLAVGIALVMYGRMEEADALIESLCRDKDPILRRSGMYTVAMAYCGSGNNKAIRRLLHVAVSDVNDDVRRAAVESLGFILFRTPEQCPSVVSLLSESYNPHVRYGAAMALGICCAGTGNKEAINLLEPMTNDPVNYVRQGALIASALIMIQQTEITCPKVNQFRQLYSKVINDKHDDVMAKFGAILAQGILDAGGHNVTISLQSRTGHTHMPSVVGVLVFTQFWFWFPLSHFLSLAYTPTCVIGLNKDLKMPKVQYKSNCKPSTFAYPAPLEVPKEKEKEKVSTAVLSITAKAKKKEKEKEKKEEEKMEVDEAEKKEEKEKKKEPEPNFQLLDNPARVMPAQLKVLTMPETCRYQPFKPLSIGGIIILKDTSEDIEELVEPVAAHGPKIEEEEQEPEPPEPFEYIDD
" misc_feature 979..981 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q99460.2); phosphorylation site" misc_feature 979..981 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1030..1032 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q99460.2); phosphorylation site" misc_feature 1075..1077 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1090..1092 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q99460.2); acetylation site" misc_feature 1093..1095 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q99460.2); phosphorylation site" misc_feature 1093..1095 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1105..1107 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q99460.2); phosphorylation site" misc_feature 1105..1107 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1369..1470 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 1" misc_feature 1483..1584 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 2" misc_feature 1483..1584 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="Proteasome/cyclosome repeat; Region: PC_rep; pfam01851" /db_xref="CDD:145164" misc_feature 1588..1692 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 3" misc_feature 1693..1797 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 4" misc_feature 1801..1902 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 5" misc_feature <1843..2031 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="HEAT repeats; Region: HEAT_2; pfam13646" /db_xref="CDD:205823" misc_feature 1903..2010 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 6" misc_feature 1966..2232 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="HEAT repeats; Region: HEAT_2; pfam13646" /db_xref="CDD:205823" misc_feature 2011..2109 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 7" misc_feature 2113..2217 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 8" misc_feature 2113..2217 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /note="Proteasome/cyclosome repeat; Region: PC_rep; pfam01851" /db_xref="CDD:145164" misc_feature 2218..2340 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 9" misc_feature 2347..2445 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99460.2); Region: PC 10" exon 179..222 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" exon 223..296 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 285 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:146184522" exon 297..466 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 415 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:1042974" variation 427 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="t" /db_xref="dbSNP:369643502" variation 428 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:201791497" exon 467..672 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 495 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:148284057" variation 535 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="c" /db_xref="dbSNP:201274207" variation 613 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:200311253" variation 634 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:372475021" variation 646 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:140671888" variation 653 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="c" /db_xref="dbSNP:75044156" exon 673..816 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 713 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:193207787" variation 743 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:371110831" variation 765 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:150858671" variation 806 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:148804491" exon 817..1043 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 819 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:367794379" variation 870 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:139078310" variation 897 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:147551981" variation 968 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:140288102" variation 1008 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:371662857" exon 1044..1104 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1049 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:189385491" variation 1057 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="t" /db_xref="dbSNP:77972953" variation 1058 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:145607583" variation 1100 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:113593155" exon 1105..1233 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1163 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:375669050" variation 1168 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:78959779" variation 1183 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:113771661" variation 1213 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:143534193" variation 1219 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:140570911" exon 1234..1322 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1263 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:138367156" variation 1269 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:374861728" variation 1283 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:369257039" variation 1308 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:180963792" exon 1323..1401 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" STS 1342..1441 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /standard_name="PSMD1" /db_xref="UniSTS:512658" variation 1361 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="c" /db_xref="dbSNP:78677083" exon 1402..1575 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1485 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="c" /db_xref="dbSNP:138925802" variation 1525 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:144761621" variation 1563 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:377482540" variation 1564 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:369229316" exon 1576..1687 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1630 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:201769528" exon 1688..1884 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1729 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:375642888" variation 1736 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:199791094" variation 1756 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:202079241" variation 1763 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:1803433" variation 1767 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:140092851" variation 1838 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:13408366" variation 1855 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:201874783" variation 1877 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:151148079" exon 1885..1980 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1893 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:145132698" variation 1949 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:144805413" exon 1981..2045 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 1983 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:141306258" variation 2011 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:200827781" exon 2046..2160 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2065 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="t" /db_xref="dbSNP:201091048" variation 2066 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:149050271" variation 2068 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:185969599" variation 2106 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:141525864" variation 2107 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:148049341" exon 2161..2277 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2185 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:201118764" variation 2193 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:373710327" variation 2247 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:150554194" variation 2274 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:200218090" exon 2278..2380 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2293 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="g" /db_xref="dbSNP:375559893" variation 2315 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:142822864" variation 2349 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:140861367" variation 2353 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:189389369" exon 2381..2550 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" exon 2551..2643 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2574 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:192635082" variation 2583 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:377693091" variation 2598 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:35852025" variation 2616 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:14686" variation 2617 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:371303865" variation 2626 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:148578790" variation 2632 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:17352860" exon 2644..2730 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2645 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="g" /replace="t" /db_xref="dbSNP:35578214" variation 2709 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:115889584" exon 2731..2877 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2774 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:375200885" variation 2810 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:140293496" variation 2818 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:75847014" variation 2862 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:149102064" exon 2878..3033 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 2884 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:148285878" variation 2902 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:1043022" variation 2906 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="t" /db_xref="dbSNP:1803432" variation 3027 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:6749" STS 3031..3196 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /standard_name="RH36032" /db_xref="UniSTS:26992" exon 3034..3326 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /inference="alignment:Splign:1.39.8" variation 3034 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:147107380" STS 3087..3180 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /standard_name="D2S1672E" /db_xref="UniSTS:150707" STS 3088..3180 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /standard_name="D2S1525E" /db_xref="UniSTS:39887" STS 3101..3225 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /standard_name="SGC31713" /db_xref="UniSTS:2873" variation 3130 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:138685132" variation 3131 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="c" /replace="t" /db_xref="dbSNP:142690475" variation 3179 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" /replace="a" /replace="g" /db_xref="dbSNP:1803434" polyA_signal 3285..3290 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" polyA_site 3326 /gene="PSMD1" /gene_synonym="P112; Rpn2; S1" ORIGIN
ggggtcctggcgagaagcgagccggcggcctgaggaggcgactgactgagcagcgcacccggggagcaaggaggcgcggtgaactgagcggcccctgagctgacagatacactgcgcagctggaacggcgagcgagccgacgggcgagtgaggggcgcagccatgatcacctcggccgctggaattatttctcttctggatgaagatgaaccacagcttaaggaatttgcactacacaaattgaatgcagttgttaatgacttctgggcagaaatttccgagtccgtagacaaaatagaggttttatacgaagatgaaggtttccggagtcggcagtttgcagccttagtggcatctaaagtattttatcacctgggggcttttgaggagtctctgaattatgctcttggagcaggggacctcttcaatgtcaatgataactctgaatatgtggaaactattatagcaaaatgcattgatcactacaccaaacaatgtgtggaaaatgcagatttgcctgaaggagaaaaaaaaccaattgaccagagattggaaggcatcgtaaataaaatgttccagcgatgtctagatgatcacaagtataaacaggctattggcattgctctggagacacgaagactggacgtctttgaaaagaccatactggagtcgaatgatgtcccaggaatgttagcttatagccttaagctctgcatgtctttaatgcagaataaacagtttcggaataaagtactaagagttctagttaaaatctacatgaacttggagaaacctgatttcatcaatgtttgtcagtgcttaattttcttagatgatcctcaggctgtgagtgatatcttagagaaactggtaaaggaagacaacctcctgatggcatatcagatttgttttgatttgtatgaaagtgctagccagcagtttttgtcatctgtaatccagaatcttcgaactgttggcacccctattgcttctgtgcctggatccactaatacgggtactgttccgggatcagagaaagacagtgactcgatggaaacagaagaaaagacaagcagtgcatttgtaggaaagacaccagaagccagtccagagcctaaggaccagactttgaaaatgattaaaattttaagtggtgaaatggctattgagttacatctgcagttcttaatacgaaacaataatacagacctcatgattctaaaaaacacaaaggatgcagtacggaattctgtatgtcatactgcaaccgttatagcaaactcttttatgcactgtgggacaaccagtgaccagtttcttagagataatttggaatggttagccagagccactaactgggcaaaatttactgctacagccagtttgggtgtaattcataagggtcatgaaaaagaagcattacagttaatggcaacataccttcccaaggatacttctccaggatcagcctatcaggaaggtggaggtctctatgcactaggtcttattcatgccaatcatggtggtgatataattgactatctgcttaatcagcttaagaacgccagcaatgatatcgttagacacggtggcagtctgggccttggtttggcagccatgggaactgcacgtcaagatgtttatgatttgctaaaaacaaacctttatcaggatgatgcagtaacaggggaagcagctggcctggccctaggtttggttatgttgggctctaaaaatgctcaggctattgaggacatggttggttatgcacaagaaactcaacatgagaagattctgcgtggtcttgcagttggcatagctttagtaatgtatgggaggatggaagaggctgatgctctcattgaatctctctgtcgtgacaaggacccaattcttcgaaggtctggaatgtatactgtagccatggcttattgtggctctggtaacaacaaagcaattcgacgcctgctacatgttgctgtaagtgatgttaatgatgatgtcaggagggcagcagtagaatcacttgggttcattctattcagaacccctgaacagtgcccaagtgttgtctctttgttgtcagagagttacaaccctcatgtgcgctacggagctgcaatggccttggggatatgctgtgctggtacaggaaacaaggaagccattaatttgctagaaccaatgacaaacgaccccgtgaactacgtgaggcaaggggcactcatagcttcagctctcatcatgatccagcagactgaaatcacttgtccaaaggtgaatcagttcagacagctgtattccaaagtcatcaatgataagcatgatgatgtcatggccaagtttggcgctattctggcccagggcatactggatgcaggtggtcataatgtcacaatctccttgcagtccaggactgggcatactcatatgccttctgtggttggcgtccttgtatttacccagttttggttctggtttcctctttcacacttcctgtcattggcttatacccctacctgtgtcattggccttaacaaggacttaaagatgccgaaagttcagtataaatcgaactgtaaaccatccacatttgcatatcctgcccctctggaagtaccaaaagaaaaagaaaaggaaaaggtttctactgctgtattatctataactgccaaggctaaaaagaaggaaaaagaaaaggaaaaaaaggaggaggagaaaatggaagtggatgaggcagagaaaaaggaggaaaaagagaagaaaaaagaacctgagccaaacttccagttattggataacccagcccgagttatgcctgcccagcttaaggtcctaaccatgccggagacctgtagataccagcctttcaaaccactctctattggaggcatcatcattctgaaggataccagtgaagacattgaggagctggtggaacctgtggcagcacatggcccaaaaatcgaggaggaggaacaagagccagaacccccagaaccatttgagtatattgatgattaagggccagaggatctcacttgcttatctgaagaagattgtccaggctcatattgggaatgcttatgaggaaattcatgccgagacctgctattcaatgcatgtatcgttgcctctgcactgacctgaagaaccctgtctccaagtctttggttgaagagaagatatatgactgttgagtgtgctctttcacagaacttggttttcaaataaatataagatctccagatggacaagacatttgtttttcagcctgggtttttaataaatgtatctaatcctccccacaccatgaaatgcctaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5707 -> Molecular function: GO:0030234 [enzyme regulator activity] evidence: IEA GeneID:5707 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS GeneID:5707 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS GeneID:5707 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:5707 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS GeneID:5707 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS GeneID:5707 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:5707 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS GeneID:5707 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:5707 -> Biological process: GO:0016032 [viral process] evidence: TAS GeneID:5707 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0042176 [regulation of protein catabolic process] evidence: IEA GeneID:5707 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS GeneID:5707 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS GeneID:5707 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS GeneID:5707 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:5707 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5707 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5707 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5707 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS GeneID:5707 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:5707 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:5707 -> Cellular component: GO:0005838 [proteasome regulatory particle] evidence: TAS GeneID:5707 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.