Home |
Help |
Advanced search
2024-04-20 18:36:33, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002806 1599 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6
(PSMC6), mRNA.
ACCESSION NM_002806
VERSION NM_002806.3 GI:195539394
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1599)
AUTHORS Wang,Q., Li,C., Zhang,Q., Wang,T., Li,J., Guan,W., Yu,J., Liang,M.
and Li,D.
TITLE Interactions of SARS coronavirus nucleocapsid protein with the host
cell proteasome subunit p42
JOURNAL Virol. J. 7, 99 (2010)
PUBMED 20478047
REMARK GeneRIF: N protein of SARS Coronavirus interacts with the host cell
proteasome subunit p42.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1599)
AUTHORS Kaneko,T., Hamazaki,J., Iemura,S., Sasaki,K., Furuyama,K.,
Natsume,T., Tanaka,K. and Murata,S.
TITLE Assembly pathway of the Mammalian proteasome base subcomplex is
mediated by multiple specific chaperones
JOURNAL Cell 137 (5), 914-925 (2009)
PUBMED 19490896
REFERENCE 3 (bases 1 to 1599)
AUTHORS Gandhi,T.K., Zhong,J., Mathivanan,S., Karthick,L., Chandrika,K.N.,
Mohan,S.S., Sharma,S., Pinkert,S., Nagaraju,S., Periaswamy,B.,
Mishra,G., Nandakumar,K., Shen,B., Deshpande,N., Nayak,R.,
Sarker,M., Boeke,J.D., Parmigiani,G., Schultz,J., Bader,J.S. and
Pandey,A.
TITLE Analysis of the human protein interactome and comparison with
yeast, worm and fly interaction datasets
JOURNAL Nat. Genet. 38 (3), 285-293 (2006)
PUBMED 16501559
REFERENCE 4 (bases 1 to 1599)
AUTHORS Oh,J.H., Yang,J.O., Hahn,Y., Kim,M.R., Byun,S.S., Jeon,Y.J.,
Kim,J.M., Song,K.S., Noh,S.M., Kim,S., Yoo,H.S., Kim,Y.S. and
Kim,N.S.
TITLE Transcriptome analysis of human gastric cancer
JOURNAL Mamm. Genome 16 (12), 942-954 (2005)
PUBMED 16341674
REFERENCE 5 (bases 1 to 1599)
AUTHORS Listovsky,T., Oren,Y.S., Yudkovsky,Y., Mahbubani,H.M., Weiss,A.M.,
Lebendiker,M. and Brandeis,M.
TITLE Mammalian Cdh1/Fzr mediates its own degradation
JOURNAL EMBO J. 23 (7), 1619-1626 (2004)
PUBMED 15029244
REFERENCE 6 (bases 1 to 1599)
AUTHORS Tipler,C.P., Hutchon,S.P., Hendil,K., Tanaka,K., Fishel,S. and
Mayer,R.J.
TITLE Purification and characterization of 26S proteasomes from human and
mouse spermatozoa
JOURNAL Mol. Hum. Reprod. 3 (12), 1053-1060 (1997)
PUBMED 9464850
REFERENCE 7 (bases 1 to 1599)
AUTHORS Seeger,M., Ferrell,K., Frank,R. and Dubiel,W.
TITLE HIV-1 tat inhibits the 20 S proteasome and its 11 S
regulator-mediated activation
JOURNAL J. Biol. Chem. 272 (13), 8145-8148 (1997)
PUBMED 9079628
REFERENCE 8 (bases 1 to 1599)
AUTHORS Fujiwara,T., Watanabe,T.K., Tanaka,K., Slaughter,C.A. and
DeMartino,G.N.
TITLE cDNA cloning of p42, a shared subunit of two proteasome regulatory
proteins, reveals a novel member of the AAA protein family
JOURNAL FEBS Lett. 387 (2-3), 184-188 (1996)
PUBMED 8674546
REFERENCE 9 (bases 1 to 1599)
AUTHORS DeMartino,G.N., Proske,R.J., Moomaw,C.R., Strong,A.A., Song,X.,
Hisamatsu,H., Tanaka,K. and Slaughter,C.A.
TITLE Identification, purification, and characterization of a
PA700-dependent activator of the proteasome
JOURNAL J. Biol. Chem. 271 (6), 3112-3118 (1996)
PUBMED 8621709
REFERENCE 10 (bases 1 to 1599)
AUTHORS Coux,O., Tanaka,K. and Goldberg,A.L.
TITLE Structure and functions of the 20S and 26S proteasomes
JOURNAL Annu. Rev. Biochem. 65, 801-847 (1996)
PUBMED 8811196
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BM788029.1, BC005390.1 and
BP384173.1.
On Aug 2, 2008 this sequence version replaced gi:24430159.
Summary: The 26S proteasome is a multicatalytic proteinase complex
with a highly ordered structure composed of 2 complexes, a 20S core
and a 19S regulator. The 20S core is composed of 4 rings of 28
non-identical subunits; 2 rings are composed of 7 alpha subunits
and 2 rings are composed of 7 beta subunits. The 19S regulator is
composed of a base, which contains 6 ATPase subunits and 2
non-ATPase subunits, and a lid, which contains up to 10 non-ATPase
subunits. Proteasomes are distributed throughout eukaryotic cells
at a high concentration and cleave peptides in an
ATP/ubiquitin-dependent process in a non-lysosomal pathway. An
essential function of a modified proteasome, the immunoproteasome,
is the processing of class I MHC peptides. This gene encodes one of
the ATPase subunits, a member of the triple-A family of ATPases
which have a chaperone-like activity. Pseudogenes have been
identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC005390.1, AF006305.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-22 BM788029.1 1-22
23-1295 BC005390.1 1-1273
1296-1599 BP384173.1 198-501
FEATURES Location/Qualifiers
source 1..1599
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q22.1"
gene 1..1599
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="proteasome (prosome, macropain) 26S subunit,
ATPase, 6"
/db_xref="GeneID:5706"
/db_xref="HGNC:9553"
/db_xref="MIM:602708"
CDS 1..1212
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="proteasome subunit p42; 26S protease regulatory
subunit S10B; conserved ATPase domain protein 44;
proteasome 26S subunit ATPase 6; 26S proteasome AAA-ATPase
subunit RPT4"
/codon_start=1
/product="26S protease regulatory subunit 10B"
/protein_id="NP_002797.3"
/db_xref="GI:195539395"
/db_xref="CCDS:CCDS9710.2"
/db_xref="GeneID:5706"
/db_xref="HGNC:9553"
/db_xref="MIM:602708"
/translation="
MAIPGIPYERRLLIMADPRDKALQDYRKKLLEHKEIDGRLKELREQLKELTKQYEKSENDLKALQSVGQIVGEVLKQLTEEKFIVKATNGPRYVVGCRRQLDKSKLKPGTRVALDMTTLTIMRYLPREVDPLVYNMSHEDPGNVSYSEIGGLSEQIRELREVIELPLTNPELFQRVGIIPPKGCLLYGPPGTGKTLLARAVASQLDCNFLKVVSSSIVDKYIGESARLIREMFNYARDHQPCIIFMDEIDAIGGRRFSEGTSADREIQRTLMELLNQMDGFDTLHRVKMIMATNRPDTLDPALLRPGRLDRKIHIDLPNEQARLDILKIHAGPITKHGEIDYEAIVKLSDGFNGADLRNVCTEAGMFAIRADHDFVVQEDFMKAVRKVADSKKLESKLDYKPV
"
misc_feature 52..1203
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="ATP-dependent 26S proteasome regulatory subunit
[Posttranslational modification, protein turnover,
chaperones]; Region: RPT1; COG1222"
/db_xref="CDD:224143"
misc_feature 448..951
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="The AAA+ (ATPases Associated with a wide variety of
cellular Activities) superfamily represents an ancient
group of ATPases belonging to the ASCE (for additional
strand, catalytic E) division of the P-loop NTPase fold.
The ASCE division also includes ABC; Region: AAA; cd00009"
/db_xref="CDD:99707"
misc_feature 562..585
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="Walker A motif; other site"
/db_xref="CDD:99707"
misc_feature order(565..588,739..741,880..882)
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:99707"
misc_feature 727..744
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="Walker B motif; other site"
/db_xref="CDD:99707"
misc_feature 922..924
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/note="arginine finger; other site"
/db_xref="CDD:99707"
exon 1..127
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
STS 19..1246
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/db_xref="UniSTS:492522"
variation 25
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:140545868"
variation 34
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371829618"
variation 37
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/db_xref="dbSNP:376129677"
variation 39
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199988613"
variation 48
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:371262723"
variation 52
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:142367793"
variation 79
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:151244912"
variation 87
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140470588"
exon 128..207
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
exon 208..247
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
exon 248..300
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
exon 301..368
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
STS 331..551
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/standard_name="RH68060"
/db_xref="UniSTS:86604"
variation 339
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145411984"
exon 369..483
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 378
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142500784"
variation 383
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:11545962"
variation 440
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1803069"
variation 453
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201438649"
exon 484..571
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 558
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:77074605"
exon 572..633
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 576
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373990232"
variation 588
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/db_xref="dbSNP:139274031"
exon 634..757
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 687
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369964973"
variation 701
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377094174"
variation 702
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:192140484"
exon 758..819
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
exon 820..940
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 885
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142048477"
variation 893
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369082655"
variation 901
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143101806"
variation 910
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/db_xref="dbSNP:61734473"
variation 912
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:186172977"
variation 918
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:148193630"
exon 941..1021
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 993
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="c"
/db_xref="dbSNP:373313044"
variation 1004
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="g"
/db_xref="dbSNP:141153483"
exon 1022..1093
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 1033
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150366196"
variation 1047
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138145785"
variation 1068
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="t"
/db_xref="dbSNP:369530713"
exon 1094..1593
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/inference="alignment:Splign:1.39.8"
variation 1166
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="c"
/db_xref="dbSNP:368977300"
variation 1167
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376852434"
variation 1219
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373582468"
variation 1228
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:376392749"
STS 1233..1445
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/standard_name="RH80771"
/db_xref="UniSTS:89556"
STS 1235..1484
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/standard_name="G43615"
/db_xref="UniSTS:95049"
variation 1242
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183298362"
variation 1296
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:6696"
variation 1354
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3732"
variation 1400
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:372491271"
variation 1412
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:375808474"
variation 1435
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:188746268"
STS 1442..1590
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/standard_name="D14S1297"
/db_xref="UniSTS:82789"
variation 1562
/gene="PSMC6"
/gene_synonym="CADP44; p42; P44; SUG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149524978"
ORIGIN
atggccattcccggcatcccctatgagagacggcttctcatcatggcggaccctagagataaggcgcttcaggactaccgcaagaagttgcttgaacacaaggagatcgacggccgtcttaaggagttaagggaacaattaaaagaacttaccaagcagtatgaaaagtctgaaaatgatctgaaggccctacagagtgttgggcagatcgtgggtgaagtgcttaaacagttaactgaagaaaaattcattgttaaagctaccaatggaccaagatatgttgtgggttgtcgtcgacagcttgacaaaagtaagctgaagccaggaacaagagttgctttggatatgactacactaactatcatgagatatttgccgagagaggtggatccactggtttataacatgtctcatgaggaccctgggaatgtttcttattctgagattggagggctatcagaacagatccgggaattaagagaggtgatagaattacctcttacaaacccagagttatttcagcgtgtaggaataatacctccaaaaggctgtttgttatatggaccaccaggtacgggaaaaacactcttggcacgagccgttgctagccagctggactgcaatttcttaaaggttgtatctagttctattgtagacaagtacattggtgaaagtgctcgtttgatcagagaaatgtttaattatgctagagatcatcaaccatgcatcatttttatggatgaaatagatgctattggtggtcgtcggttttctgagggtacttcagctgacagagagattcagagaacgttaatggagttactgaatcaaatggatggatttgatactctgcatagagttaaaatgatcatggctacaaacagaccagatacactggatcctgctttgctgcgtccaggaagattagatagaaaaatacatattgatttgccaaatgaacaagcaagattagacatactgaaaatccatgcaggtcccattacaaagcatggtgaaatagattatgaagcaattgtgaagctttcggatggctttaatggagcagatctgagaaatgtttgtactgaagcaggtatgttcgcaattcgtgctgatcatgattttgtagtacaggaagacttcatgaaagcagtcagaaaagtggctgattctaagaagctggagtctaaattggactacaaacctgtgtaatttactgtaagatttttgatggctgcatgacagatgttggcttattgtaaaaataaagttaaagaaaataatgtatgtattggtaatgatgtcattaaaagtatatgaataaaaatatgagtaacatcataaaaattagtaattcaacttttaagatacagaagaaatttgtatgtttgttaaagttgcatttattgcagcaagttacaaagggaaagtgttgaagcttttcatatttgctgcgtgagcattttgtaaaatattgaaagtggtttgagatagtggtataagaaagcatttcttatgacttattttgtatcatttgttttcctcatctaaaaagttgaataaaatctgtttgattcagttctcctacatataaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5706 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5706 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:5706 -> Molecular function: GO:0016887 [ATPase activity] evidence: TAS
GeneID:5706 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: NAS
GeneID:5706 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:5706 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:5706 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5706 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:5706 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
GeneID:5706 -> Biological process: GO:0006200 [ATP catabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: IC
GeneID:5706 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
GeneID:5706 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:5706 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:5706 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
GeneID:5706 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5706 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5706 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5706 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5706 -> Cellular component: GO:0000502 [proteasome complex] evidence: IDA
GeneID:5706 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:5706 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5706 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:5706 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:5706 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5706 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:5706 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.