Home |
Help |
Advanced search
2024-04-26 06:40:59, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002787 1466 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 2
(PSMA2), mRNA.
ACCESSION NM_002787
VERSION NM_002787.4 GI:156071494
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1466)
AUTHORS Chen,Y.X., Wang,W.P., Zhang,P.Y., Zhang,W.G., Liu,J. and Ma,X.R.
TITLE [Expression of genes psma6 and slc25a4 in patients with acute
monocytic leukemia]
JOURNAL Zhongguo Shi Yan Xue Ye Xue Za Zhi 17 (5), 1168-1173 (2009)
PUBMED 19840444
REMARK GeneRIF: The expression level of psma6 in AML-M5 patients with
complete remission was higher than that in AML-M5 patients without
remission.
REFERENCE 2 (bases 1 to 1466)
AUTHORS Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z.,
Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S.,
McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J.,
Dunham,I., Hill,D.E. and Vidal,M.
TITLE hORFeome v3.1: a resource of human open reading frames representing
over 10,000 human genes
JOURNAL Genomics 89 (3), 307-315 (2007)
PUBMED 17207965
REFERENCE 3 (bases 1 to 1466)
AUTHORS Zhan,X. and Desiderio,D.M.
TITLE Nitroproteins from a human pituitary adenoma tissue discovered with
a nitrotyrosine affinity column and tandem mass spectrometry
JOURNAL Anal. Biochem. 354 (2), 279-289 (2006)
PUBMED 16777052
REFERENCE 4 (bases 1 to 1466)
AUTHORS Leong,W.F. and Chow,V.T.
TITLE Transcriptomic and proteomic analyses of rhabdomyosarcoma cells
reveal differential cellular gene expression in response to
enterovirus 71 infection
JOURNAL Cell. Microbiol. 8 (4), 565-580 (2006)
PUBMED 16548883
REFERENCE 5 (bases 1 to 1466)
AUTHORS Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
TITLE Immunoaffinity profiling of tyrosine phosphorylation in cancer
cells
JOURNAL Nat. Biotechnol. 23 (1), 94-101 (2005)
PUBMED 15592455
REFERENCE 6 (bases 1 to 1466)
AUTHORS Okumura,K., Nogami,M., Taguchi,H., Hisamatsu,H. and Tanaka,K.
TITLE The genes for the alpha-type HC3 (PMSA2) and beta-type HC5 (PMSB1)
subunits of human proteasomes map to chromosomes 6q27 and 7p12-p13
by fluorescence in situ hybridization
JOURNAL Genomics 27 (2), 377-379 (1995)
PUBMED 7558012
REFERENCE 7 (bases 1 to 1466)
AUTHORS Kristensen,P., Johnsen,A.H., Uerkvitz,W., Tanaka,K. and Hendil,K.B.
TITLE Human proteasome subunits from 2-dimensional gels identified by
partial sequencing
JOURNAL Biochem. Biophys. Res. Commun. 205 (3), 1785-1789 (1994)
PUBMED 7811265
REMARK Erratum:[Biochem Biophys Res Commun. 1995 Feb 27;207(3):1059. PMID:
7864893]
REFERENCE 8 (bases 1 to 1466)
AUTHORS Tamura,T., Osaka,F., Kawamura,Y., Higuti,T., Ishida,N.,
Nothwang,H.G., Tsurumi,C., Tanaka,K. and Ichihara,A.
TITLE Isolation and characterization of alpha-type HC3 and beta-type HC5
subunit genes of human proteasomes
JOURNAL J. Mol. Biol. 244 (1), 117-124 (1994)
PUBMED 7966316
REFERENCE 9 (bases 1 to 1466)
AUTHORS DeMartino,G.N., Orth,K., McCullough,M.L., Lee,L.W., Munn,T.Z.,
Moomaw,C.R., Dawson,P.A. and Slaughter,C.A.
TITLE The primary structures of four subunits of the human,
high-molecular-weight proteinase, macropain (proteasome), are
distinct but homologous
JOURNAL Biochim. Biophys. Acta 1079 (1), 29-38 (1991)
PUBMED 1888762
REFERENCE 10 (bases 1 to 1466)
AUTHORS Tamura,T., Lee,D.H., Osaka,F., Fujiwara,T., Shin,S., Chung,C.H.,
Tanaka,K. and Ichihara,A.
TITLE Molecular cloning and sequence analysis of cDNAs for five major
subunits of human proteasomes (multi-catalytic proteinase
complexes)
JOURNAL Biochim. Biophys. Acta 1089 (1), 95-102 (1991)
PUBMED 2025653
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC010132.5.
On Aug 16, 2007 this sequence version replaced gi:45359861.
Summary: The proteasome is a multicatalytic proteinase complex with
a highly ordered ring-shaped 20S core structure. The core structure
is composed of 4 rings of 28 non-identical subunits; 2 rings are
composed of 7 alpha subunits and 2 rings are composed of 7 beta
subunits. Proteasomes are distributed throughout eukaryotic cells
at a high concentration and cleave peptides in an
ATP/ubiquitin-dependent process in a non-lysosomal pathway. An
essential function of a modified proteasome, the immunoproteasome,
is the processing of class I MHC peptides. This gene encodes a
member of the peptidase T1A family, that is a 20S core alpha
subunit. [provided by RefSeq, Jul 2008].
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC047697.1, BM563315.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-89 AC010132.5 35483-35571
90-166 AC010132.5 40230-40306
167-299 AC010132.5 41021-41153
300-422 AC010132.5 42892-43014
423-504 AC010132.5 44283-44364
505-578 AC010132.5 45758-45831
579-636 AC010132.5 49854-49911
637-1466 AC010132.5 49999-50828
FEATURES Location/Qualifiers
source 1..1466
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="7"
/map="7p13"
gene 1..1466
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/note="proteasome (prosome, macropain) subunit, alpha
type, 2"
/db_xref="GeneID:5683"
/db_xref="HGNC:9531"
/db_xref="HPRD:08907"
/db_xref="MIM:176842"
exon 1..89
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
CDS 49..753
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/EC_number="3.4.25.1"
/note="proteasome subunit HC3; proteasome component C3;
macropain subunit C3; multicatalytic endopeptidase complex
subunit C3"
/codon_start=1
/product="proteasome subunit alpha type-2"
/protein_id="NP_002778.1"
/db_xref="GI:4506181"
/db_xref="CCDS:CCDS5467.1"
/db_xref="GeneID:5683"
/db_xref="HGNC:9531"
/db_xref="HPRD:08907"
/db_xref="MIM:176842"
/translation="
MAERGYSFSLTTFSPSGKLVQIEYALAAVAGGAPSVGIKAANGVVLATEKKQKSILYDERSVHKVEPITKHIGLVYSGMGPDYRVLVHRARKLAQQYYLVYQEPIPTAQLVQRVASVMQEYTQSGGVRPFGVSLLICGWNEGRPYLFQSDPSGAYFAWKATAMGKNYVNGKTFLEKRYNEDLELEDAIHTAILTLKESFEGQMTEDNIEVGICNEAGFRRLTPTEVKDYLAAIA
"
misc_feature 61..747
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/note="proteasome subunit alpha; Provisional; Region:
PRK03996"
/db_xref="CDD:235192"
misc_feature 64..741
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/note="proteasome_alpha_type_2. The 20S proteasome,
multisubunit proteolytic complex, is the central enzyme of
nonlysosomal protein degradation in both the cytosol and
nucleus. It is composed of 28 subunits arranged as four
homoheptameric rings that stack on...; Region:
proteasome_alpha_type_2; cd03750"
/db_xref="CDD:239719"
misc_feature order(70..81,85..90,94..99,109..111,118..120,127..132,
139..141,163..165,208..210,214..219,286..294,298..303,
394..396,403..405,412..417,424..438,487..489,502..507,
511..513,517..522,526..528)
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/note="alpha subunit interaction site [polypeptide
binding]; other site"
/db_xref="CDD:239719"
misc_feature 118..120
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[5]
misc_feature order(145..147,193..195,199..201,238..240,541..543)
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/note="active site"
/db_xref="CDD:239719"
misc_feature 217..219
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 256..258
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P25787.2); acetylation site"
misc_feature 274..276
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 340..342
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[5]
misc_feature 559..561
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P25787.2); acetylation site"
misc_feature 733..735
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/experiment="experimental evidence, no additional details
recorded"
/note="Nitrated tyrosine; propagated from
UniProtKB/Swiss-Prot (P25787.2); modified site"
exon 90..166
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
exon 167..299
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
exon 300..422
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
exon 423..504
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
exon 505..578
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
exon 579..636
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
STS 603..729
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/standard_name="RH17359"
/db_xref="UniSTS:12476"
exon 637..1466
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/inference="alignment:Splign:1.39.8"
STS 687..843
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/standard_name="RH36520"
/db_xref="UniSTS:63263"
variation 993
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1060304"
STS 1068..1185
/gene="PSMA2"
/gene_synonym="HC3; MU; PMSA2; PSC2"
/standard_name="RH36115"
/db_xref="UniSTS:83051"
ORIGIN
ggccacagtgcgcatgtgtgcggctgtgctttggctcttcgggtaaagatggcggagcgcgggtacagcttttcgctgactacattcagcccgtctggtaaacttgtccagattgaatatgctttggctgctgtagctggaggagccccgtccgtgggaattaaagctgcaaatggtgtggtattagcaactgagaaaaaacagaaatccattctgtatgatgagcgaagtgtacacaaagtagaaccaattaccaagcatataggtttggtgtacagtggcatgggccccgattacagagtgcttgtgcacagagctcgaaaactagctcaacaatactatcttgtgtaccaagaacccattcctacagctcagctggtacagagagtagcttctgtgatgcaagaatatactcagtcaggtggtgttcgtccatttggagtttctttacttatttgtggttggaatgagggacgaccatatttatttcagtcagatccatctggagcttactttgcctggaaagctacagcaatgggaaagaactatgtgaatgggaagactttccttgagaaaagatataatgaagatctggaacttgaagatgccattcatacagccatcttaaccctaaaggaaagctttgaagggcaaatgacagaggataacatagaagttggaatctgcaatgaagctggatttaggaggcttactccaactgaagttaaggattacttggctgccatagcataacaatgaagtgactgaaaaatccagaatttcagataatctatctacttaaacatgtttaaagtatgttttgttttgcagactttttgcatacttatttctacatggtttaaatcgactgtttttaaaatgacacttataaatcctaataaactgttaaacccaccttccagccttttaggagttgctaaaattttaacagttatttcctgctttttatcacagttgatttctgaagactacattgccaagcagaatgatgaaatgactttttcgttgtcaggcaattttggttaagtcaaatcttaatgccctcttcgctatcagatgttgcctgtgtttccataaagcaaaatgctgattttggtaaaaaacatgactgcttctagagctgggaggatctgcagactttcacggattcatggaacaagaaaagaagcataggtacttttaggtgccattaggtattgatcagtgaaatcctagggtgctctatgagattgtactaggcctatgaagagtggtaagccaaataggtctccatgggagatacattatgtaaataaataaacaatggtttgctggttcctgttggtgtctccacaagtaggtaaacatgtttaaaggaacccgggttcttagattttgttagactttttaaactcaaggatgagcataagtgcttgaaataaaatgctaatacttaagtgtcaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5683 -> Molecular function: GO:0004298 [threonine-type endopeptidase activity] evidence: IEA
GeneID:5683 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5683 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:5683 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:5683 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5683 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:5683 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
GeneID:5683 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
GeneID:5683 -> Biological process: GO:0009615 [response to virus] evidence: IEP
GeneID:5683 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:5683 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:5683 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
GeneID:5683 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5683 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5683 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5683 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5683 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS
GeneID:5683 -> Cellular component: GO:0000932 [cytoplasmic mRNA processing body] evidence: ISS
GeneID:5683 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5683 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5683 -> Cellular component: GO:0005839 [proteasome core complex] evidence: ISS
GeneID:5683 -> Cellular component: GO:0019773 [proteasome core complex, alpha-subunit complex] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_002778 -> EC 3.4.25.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.