2024-04-26 05:08:11, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002750 5676 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-a1, mRNA. ACCESSION NM_002750 VERSION NM_002750.3 GI:513788275 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 5676) AUTHORS Park,M.K., You,H.J., Lee,H.J., Kang,J.H., Oh,S.H., Kim,S.Y. and Lee,C.H. TITLE Transglutaminase-2 induces N-cadherin expression in TGF-beta1-induced epithelial mesenchymal transition via c-Jun-N-terminal kinase activation by protein phosphatase 2A down-regulation JOURNAL Eur. J. Cancer 49 (7), 1692-1705 (2013) PUBMED 23290789 REMARK GeneRIF: Results suggest that Tgase-2/PP2A/JNK might be a novel axis that affects N-cadherin switching in the epithelial-mesenchymal-transition (EMT) of A549 lung cancer cells. REFERENCE 2 (bases 1 to 5676) AUTHORS Takahashi,R., Hirata,Y., Sakitani,K., Nakata,W., Kinoshita,H., Hayakawa,Y., Nakagawa,H., Sakamoto,K., Hikiba,Y., Ijichi,H., Moses,H.L., Maeda,S. and Koike,K. TITLE Therapeutic effect of c-Jun N-terminal kinase inhibition on pancreatic cancer JOURNAL Cancer Sci. 104 (3), 337-344 (2013) PUBMED 23237571 REMARK GeneRIF: activation of JNK promotes development of pancreatic cancer REFERENCE 3 (bases 1 to 5676) AUTHORS An,J., Liu,H., Magyar,C.E., Guo,Y., Veena,M.S., Srivatsan,E.S., Huang,J. and Rettig,M.B. TITLE Hyperactivated JNK is a therapeutic target in pVHL-deficient renal cell carcinoma JOURNAL Cancer Res. 73 (4), 1374-1385 (2013) PUBMED 23393199 REMARK GeneRIF: Data indicate that von Hippel-Lindau (VHL)-deficient clear cell renal cell carcinomas (RCC) are dependent upon c-Jun-NH(2)-kinase (JNK) activity for in vitro and in vivo growth. REFERENCE 4 (bases 1 to 5676) AUTHORS Li,M., Qiu,L., Lin,T., He,D., Hua,Y., Yuan,X., Liu,X. and Wei,G. TITLE c-Jun N-terminal kinase is upregulated in patients with hypospadias JOURNAL Urology 81 (1), 178-183 (2013) PUBMED 23273084 REMARK GeneRIF: We observed that the JNK1 gene and the phosphorylated expression of JNK1 and JNK2 were upregulated in the skin of patients with hypospadias compared with that in the normal prepuce in the levels of mRNA and protein, respectively. REFERENCE 5 (bases 1 to 5676) AUTHORS Kanaji,N., Nelson,A., Wang,X., Sato,T., Nakanishi,M., Gunji,Y., Basma,H., Michalski,J., Farid,M., Rennard,S.I. and Liu,X. TITLE Differential roles of JNK, ERK1/2, and p38 mitogen-activated protein kinases on endothelial cell tissue repair functions in response to tumor necrosis factor-alpha JOURNAL J. Vasc. Res. 50 (2), 145-156 (2013) PUBMED 23258237 REMARK GeneRIF: TNF-alpha stimulates tissue repair functions of HPAECs. This may be mediated, at least in part, positively via JNK & ERK1/2. This may play a role in endothelial cell-mediated tissue repair, especially in an inflammatory milieu where TNF-alpha is present. REFERENCE 6 (bases 1 to 5676) AUTHORS Kharbanda,S., Saleem,A., Shafman,T., Emoto,Y., Taneja,N., Rubin,E., Weichselbaum,R., Woodgett,J., Avruch,J., Kyriakis,J. et al. TITLE Ionizing radiation stimulates a Grb2-mediated association of the stress-activated protein kinase with phosphatidylinositol 3-kinase JOURNAL J. Biol. Chem. 270 (32), 18871-18874 (1995) PUBMED 7642542 REFERENCE 7 (bases 1 to 5676) AUTHORS van Dam,H., Wilhelm,D., Herr,I., Steffen,A., Herrlich,P. and Angel,P. TITLE ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents JOURNAL EMBO J. 14 (8), 1798-1811 (1995) PUBMED 7737130 REFERENCE 8 (bases 1 to 5676) AUTHORS Livingstone,C., Patel,G. and Jones,N. TITLE ATF-2 contains a phosphorylation-dependent transcriptional activation domain JOURNAL EMBO J. 14 (8), 1785-1797 (1995) PUBMED 7737129 REFERENCE 9 (bases 1 to 5676) AUTHORS Derijard,B., Raingeaud,J., Barrett,T., Wu,I.H., Han,J., Ulevitch,R.J. and Davis,R.J. TITLE Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms JOURNAL Science 267 (5198), 682-685 (1995) PUBMED 7839144 REMARK Erratum:[Science 1995 Jul 7;269(5220):17] REFERENCE 10 (bases 1 to 5676) AUTHORS Seth,A., Alvarez,E., Gupta,S. and Davis,R.J. TITLE A phosphorylation site located in the NH2-terminal domain of c-Myc increases transactivation of gene expression JOURNAL J. Biol. Chem. 266 (35), 23521-23524 (1991) PUBMED 1748630 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK292523.1, L26318.1, AC016397.6 and AA808177.1. On Jun 20, 2013 this sequence version replaced gi:20986493. Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jun 2013]. Transcript Variant: This variant (JNK1-a1) uses a different acceptor splice site in the last coding exon compared to transcript variant JNK1-a2, resulting in a frameshift and a shorter isoform (JNK1 alpha1) with a different C-terminus, compared to isoform JNK1 alpha2. The JNK1-a1 variant differs from the JNK1-b1 variant in the use of an alternate internal coding exon of the same length. Thus, JNK1 alpha1 isoform is the same length as JNK1 beta1 isoform, with a few aa difference in an internal protein segment. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L26318.1, AB451231.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025082, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-32 AK292523.1 80-111 33-1449 L26318.1 2-1418 1450-5297 AC016397.6 82949-86796 5298-5676 AA808177.1 1-379 c FEATURES Location/Qualifiers source 1..5676 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10q11.22" gene 1..5676 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="mitogen-activated protein kinase 8" /db_xref="GeneID:5599" /db_xref="HGNC:6881" /db_xref="HPRD:03100" /db_xref="MIM:601158" exon 1..171 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" misc_feature 35..37 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="upstream in-frame stop codon" CDS 50..1204 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /EC_number="2.7.11.24" /note="isoform alpha1 is encoded by transcript variant JNK1-a1; JUN N-terminal kinase; c-Jun N-terminal kinase 1; mitogen-activated protein kinase 8 isoform JNK1 alpha1; mitogen-activated protein kinase 8 isoform JNK1 beta2; MAP kinase 8; stress-activated protein kinase 1; stress-activated protein kinase 1c" /codon_start=1 /product="mitogen-activated protein kinase 8 isoform alpha1" /protein_id="NP_002741.1" /db_xref="GI:4506095" /db_xref="CCDS:CCDS7225.1" /db_xref="GeneID:5599" /db_xref="HGNC:6881" /db_xref="HPRD:03100" /db_xref="MIM:601158" /translation="
MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLAQVQQ
" misc_feature 74..1129 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="Catalytic domain of the Serine/Threonine Kinase, c-Jun N-terminal Kinase; Region: STKc_JNK; cd07850" /db_xref="CDD:173746" misc_feature 125..1012 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220" /db_xref="CDD:214567" misc_feature order(143..163,167..169,206..208,212..214,263..265, 305..307,371..391,395..400,500..502,506..508,512..517, 521..523,551..556,563..565,596..598,602..613,617..619, 728..730) /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="active site" /db_xref="CDD:173746" misc_feature order(143..163,167..169,206..208,212..214,305..307, 371..391,521..523,551..553) /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:173746" misc_feature order(263..265,395..397,500..502,506..508,563..565, 596..598,602..613,617..619,728..730) /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:173746" misc_feature order(383..385,401..403,428..430,437..439,524..538, 1016..1021,1025..1027,1034..1036) /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="KIM docking site [polypeptide binding]; other site" /db_xref="CDD:173746" misc_feature order(551..583,596..619) /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /note="activation loop (A-loop); other site" /db_xref="CDD:173746" misc_feature 596..604 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P45983.2); Region: TXY" misc_feature 596..598 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by MAP2K7; propagated from UniProtKB/Swiss-Prot (P45983.2); phosphorylation site" misc_feature 596..598 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:04309" misc_feature 602..604 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by MAP2K4; propagated from UniProtKB/Swiss-Prot (P45983.2); phosphorylation site" misc_feature 602..604 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03213" misc_feature 602..604 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01266" exon 172..301 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 302..360 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 361..499 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 500..665 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 666..737 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 738..920 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 921..1045 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" STS 979..1083 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="MARC_12374-12375:997362452:1" /db_xref="UniSTS:267421" STS 985..1086 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="MARC_13424-13425:1002294866:1" /db_xref="UniSTS:267492" exon 1046..1109 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 1110..1187 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" exon 1188..5669 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /inference="alignment:Splign:1.39.8" STS 1207..1343 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="STS-L26318" /db_xref="UniSTS:6223" STS 1226..1349 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="D10S2185" /db_xref="UniSTS:27764" STS 1929..2016 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="RH69616" /db_xref="UniSTS:47949" STS 2005..2142 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="STS-T94087" /db_xref="UniSTS:42388" polyA_signal 2165..2170 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" polyA_site 2192 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" STS 2427..2640 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="HSC1IF052" /db_xref="UniSTS:25988" STS 2492..2697 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="A004M36" /db_xref="UniSTS:62067" polyA_site 2736 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" STS 5476..5595 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" /standard_name="D10S1856" /db_xref="UniSTS:81152" polyA_signal 5634..5639 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" polyA_site 5669 /gene="MAPK8" /gene_synonym="JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c" ORIGIN
cttcttggtgaatttttggatgaagccattaaattaattgcttgccatcatgagcagaagcaagcgtgacaacaatttttatagtgtagagattggagattctacattcacagtcctgaaacgatatcagaatttaaaacctataggctcaggagctcaaggaatagtatgcgcagcttatgatgccattcttgaaagaaatgttgcaatcaagaagctaagccgaccatttcagaatcagactcatgccaagcgggcctacagagagctagttcttatgaaatgtgttaatcacaaaaatataattggccttttgaatgttttcacaccacagaaatccctagaagaatttcaagatgtttacatagtcatggagctcatggatgcaaatctttgccaagtgattcagatggagctagatcatgaaagaatgtcctaccttctctatcagatgctgtgtggaatcaagcaccttcattctgctggaattattcatcgggacttaaagcccagtaatatagtagtaaaatctgattgcactttgaagattcttgacttcggtctggccaggactgcaggaacgagttttatgatgacgccttatgtagtgactcgctactacagagcacccgaggtcatccttggcatgggctacaaggaaaacgtggatttatggtctgtggggtgcattatgggagaaatggtttgccacaaaatcctctttccaggaagggactatattgatcagtggaataaagttattgaacagcttggaacaccatgtcctgaattcatgaagaaactgcaaccaacagtaaggacttacgttgaaaacagacctaaatatgctggatatagctttgagaaactcttccctgatgtccttttcccagctgactcagaacacaacaaacttaaagccagtcaggcaagggatttgttatccaaaatgctggtaatagatgcatctaaaaggatctctgtagatgaagctctccaacacccgtacatcaatgtctggtatgatccttctgaagcagaagctccaccaccaaagatccctgacaagcagttagatgaaagggaacacacaatagaagagtggaaagaattgatatataaggaagttatggacttggaggagagaaccaagaatggagttatacgggggcagccctctcctttagcacaggtgcagcagtgatcaatggctctcagcatccatcatcatcgtcgtctgtcaatgatgtgtcttcaatgtcaacagatccgactttggcctctgatacagacagcagtctagaagcagcagctgggcctctgggctgctgtagatgactacttgggccatcggggggtgggagggatggggagtcggttagtcattgatagaactactttgaaaacaattcagtggtcttatttttgggtgatttttcaaaaaatgtagaattcattttgtagtaaagtagtttattttttttaatttcaagtgatgtaatttaaaacctaagttgtgtttcaaaacagcaacaaaactgtattgtattttttttgctgtaattaactgtataatgtaaacctaattattttatcatggtttaaattttttgcatatttgctttatcttatgctgctgatttttttaactgaatttgtaagattttgtttatcaaagcaactattatgtggtgacttgcctatatcatgaattatttaagatttttatagttttttttaattagaatttatttcagatgttttgttcatgatactatccttcagggttatgtgcttatcaatgaaataaccccagaggagtgagggaaaataacttgtagccagttatattcaggaataactactgtaaatgatgaacgtgttaggagacctccaatatttgctacttgccaatcctaatttagttacaagaattggtaggcaatcctacttaattttggcaaaagccccgtcatctaaatggcagaataactcagagcatgtctttgaagatgctgggcgtctaccaccaccttatgtccccaccctacccaacaaaaataagtaaaaagaatatggtgtattctacaaatttgtggcatgctcaaagtttatgatcacataaaggcaagaggatacttcatgaataatacatttcaatgcaaataaacagatggttcacttctactagctatgagcctgtttttgtatacactgagttaatctactcaggctgtaggtcccagcaatgttctagagtctggtctttccctttcctgcagcttcgggtccttggacctttcctgtttcctattacttggagtgtctgtcagttgagcaccagttgttctggtgtttcatttgattctacttgtagcataatcatttatacgagctattgggaggttccaaaccctacctagatttgtgtaggtgatgtatcaaatgagcaatataccgttcatctgaaaatagtagcacacagccatatataggatatcattttctaaggactgtttcttcacattgagcagagcaggcataaatggtggttatttagtctaagtcttttatttttttatacctgattttcaacataacacgcaatgtggatgtcgagtagtgttaagaatggtgctgctcctgacaagtgtatgttaactgtttacattttctatctgtagaattatttctctattactgaacttttcctaagtaaaatgtctttgaagtctcgttatttctgaaatacgttgtctgtaatagacccaggcaccttttaaattatctctggaacaagagggatttcatgtaatgaactaggaaatgcatactcacataagcaacaaggttctaggcagaaagccccttggaatttgtgaccaacaggagcaagaacaggtgcggctcaacatgcaatgtctgaaaatttgcttggcattttattcatatatttagtgcaaaattatttttgagtgagatattttacatcactgttaatgtgcaatatttaagattaaaatacattagcttttttatatactttgaagtagcaagtttgttttcgatggcttagagtcatgatttccagcttcccagcctttttatcagtcccttttctaatacaacaaggtgcattaatttgattaggcaaattagagttctaagacacttcttgaattgtagacagaaaatattggattcacaatttcagcagaaatttgagaatgagtgtgtttatattaatttcacaattagctgtattttctgtagcatagattatgtcactgttgcactttcacagcagacatgctttcagaaggttctcatattttatgtttgattgctgataagccatctctattgatacagattttggttaagtaaggaaaaccaggtgtgtgtctgtatcatttattgtaaatgccagctgccacttgccaaccatcatgttcagttcaattcaaagaaaacaaactctcattacttagtgtaaactaaaatacttaacaaattatatcctaaaaacaaggtctctttgttaaatgttgcatgccctaggttttaaattactacatccaaatacagttttcgtcttaaatttgttaagctaaatatatgttggttctttttattttggaatcctttaagcatcttaaacattttttttttgaagagaagttacaaataacatttctatcaggtagtacttgtatgaaaccacctttcttattctataattttgatttttcaattttatatacttaatatactcactgtcttactatcagaaagttattttgaccaagatttttattatcttcatagattcagaaagagatgctaattctgtaccaatgtcttcctggttactattctcttccctctaatatatactggccatttgtaaaaccattgtgttgttgggatcacttagttatactatacgcagatagagcatctcaactctgtcatagtgtttgctgaacagttttcagtgtcatgcacctttggctgctaattgttcctgacgtgcactcttccgagttggtaaaggcacagtgtgttcatgccagacttctaagagaaacaccagcctcttaaatcagaagcctacacacaacccccttaacaatccaaagaagcttgatggtgtgcaaagaagcatcctgccagccttgtcattgttctgttctatgctaatcctgctgtgttgtctaaaagatggagggaagaggacatcagtgtctgatagtgaaatcatcagcaggaaagtgaagctctttccttggttacagataagacttggtttacactattggccagtatctgctaaacatatgaagacttaactattcagtgttgcctaggcattcgcctgcacaacattttgaggttagaacatagaatattttcagaaatactgttgtagtttgtgagtgttgttcattagttacacattagctatagagtggatgcatgaagccccatgacaccagtaaacttctcttaccagtaggtaaaccaaacaccattctgtcattagcagccctcttaaatgttgcctctccgtatcctgttgcatttttgtgtgcattgtgtttctactgatctctcttaggtttttacggaatcaaaggaaactaatttttccttaatagcaagaaagatgaagaggtaaagggcattgaagcagaaatgtatagtttggggtacgattagaaaactcgtaaggaaaacagaagtcctaatttcaaactgactgctcttcgttaagtgctcttaaggagagtctagtaacagtaacactttctggccatttctagtttagattctcttcgttactgaaacttttgagaaatattacctgtggattaattttgcacaatgttctattctcataatgacttacaaattaaactaggtttttattgaactacctcacactaattttctatgctttcccaagtaagctgttgccctgttagatctttactgagtgaattataaatgtgtgttaaatactttctagccaatgttgacacaataccagtaagtatgtaaagtatataccttacatcagtaagagacacgtgtaaaatctttgactgtatgtcttgcaaaattgtgctcgttgacattattactgtttttgtaagtagaaacctgctcgtgatatcggtccatttacattttacaaaaggagtaaatcttagtaaaaattttacgaagaaataaattacttttgtaggcccaatatttggtatatttttgagaagctgttaatcttttagctgaataatgaagttagactgaattacgtgtctccctggactgtgacatctattttctcattacagtttatcctggtcagcagggtgtcacacctggaaacctgagtatgatagctgacatttgcttttctccctctgcgatgtcattcctcctccattcctctccttccctgtgttccgttccctctcctttcctctagacaaaacaaaatggggcactttttagggaatgctgagatcattattgtggtttttcatcattcatgccctagtcattaaacatgcaccactggaatgtaaacaatgttatctagtatgtcaattggttataatattttaaataaaaaagaaaaaagtggtatgaaaattatgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5599 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA GeneID:5599 -> Molecular function: GO:0004705 [JUN kinase activity] evidence: IDA GeneID:5599 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5599 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:5599 -> Molecular function: GO:0035033 [histone deacetylase regulator activity] evidence: IMP GeneID:5599 -> Molecular function: GO:0042826 [histone deacetylase binding] evidence: IPI GeneID:5599 -> Biological process: GO:0001503 [ossification] evidence: IEA GeneID:5599 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:5599 -> Biological process: GO:0006950 [response to stress] evidence: TAS GeneID:5599 -> Biological process: GO:0007254 [JNK cascade] evidence: IDA GeneID:5599 -> Biological process: GO:0007254 [JNK cascade] evidence: TAS GeneID:5599 -> Biological process: GO:0007258 [JUN phosphorylation] evidence: IDA GeneID:5599 -> Biological process: GO:0009411 [response to UV] evidence: IDA GeneID:5599 -> Biological process: GO:0010628 [positive regulation of gene expression] evidence: IMP GeneID:5599 -> Biological process: GO:0018105 [peptidyl-serine phosphorylation] evidence: IDA GeneID:5599 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IDA GeneID:5599 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IMP GeneID:5599 -> Biological process: GO:0031063 [regulation of histone deacetylation] evidence: IMP GeneID:5599 -> Biological process: GO:0032091 [negative regulation of protein binding] evidence: IDA GeneID:5599 -> Biological process: GO:0032880 [regulation of protein localization] evidence: IDA GeneID:5599 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: TAS GeneID:5599 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IDA GeneID:5599 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:5599 -> Biological process: GO:0046686 [response to cadmium ion] evidence: IEA GeneID:5599 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0051090 [regulation of sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:5599 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS GeneID:5599 -> Biological process: GO:0071260 [cellular response to mechanical stimulus] evidence: IEP GeneID:5599 -> Biological process: GO:0090045 [positive regulation of deacetylase activity] evidence: IMP GeneID:5599 -> Biological process: GO:0097190 [apoptotic signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:0097193 [intrinsic apoptotic signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:1900740 [positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway] evidence: TAS GeneID:5599 -> Biological process: GO:2000017 [positive regulation of determination of dorsal identity] evidence: IEA GeneID:5599 -> Biological process: GO:2001235 [positive regulation of apoptotic signaling pathway] evidence: IEA GeneID:5599 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5599 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:5599 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA GeneID:5599 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_002741 -> EC 2.7.11.24
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.