GGRNA Home | Help | Advanced search

2020-10-24 06:52:59, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002747               4736 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens mitogen-activated protein kinase 4 (MAPK4), mRNA.
ACCESSION   NM_002747
VERSION     NM_002747.3  GI:89276768
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4736)
  AUTHORS   Long,W., Foulds,C.E., Qin,J., Liu,J., Ding,C., Lonard,D.M.,
            Solis,L.M., Wistuba,I.I., Qin,J., Tsai,S.Y., Tsai,M.J. and
            O'Malley,B.W.
  TITLE     ERK3 signals through SRC-3 coactivator to promote human lung cancer
            cell invasion
  JOURNAL   J. Clin. Invest. 122 (5), 1869-1880 (2012)
   PUBMED   22505454
  REMARK    GeneRIF: A previously unknown role for ERK3 in promoting lung
            cancer cell invasiveness by phosphorylating SRC-3 and regulating
            SRC-3 proinvasive activity by site-specific phosphorylation.
REFERENCE   2  (bases 1 to 4736)
  AUTHORS   De la Mota-Peynado,A., Chernoff,J. and Beeser,A.
  TITLE     Identification of the atypical MAPK Erk3 as a novel substrate for
            p21-activated kinase (Pak) activity
  JOURNAL   J. Biol. Chem. 286 (15), 13603-13611 (2011)
   PUBMED   21317288
  REMARK    GeneRIF: identify the Erk3 protein as a novel class I Pak substrate
            and further suggest a role for Pak kinase activity in atypical MAPK
            signaling.
REFERENCE   3  (bases 1 to 4736)
  AUTHORS   Deleris,P., Trost,M., Topisirovic,I., Tanguay,P.L., Borden,K.L.,
            Thibault,P. and Meloche,S.
  TITLE     Activation loop phosphorylation of ERK3/ERK4 by group I
            p21-activated kinases (PAKs) defines a novel
            PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway
  JOURNAL   J. Biol. Chem. 286 (8), 6470-6478 (2011)
   PUBMED   21177870
  REMARK    GeneRIF: Activation loop phosphorylation of ERK3/ERK4 by group I
            p21-activated kinases (PAKs) defines a novel
            PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway.
REFERENCE   4  (bases 1 to 4736)
  AUTHORS   Aberg,E., Torgersen,K.M., Johansen,B., Keyse,S.M., Perander,M. and
            Seternes,O.M.
  TITLE     Docking of PRAK/MK5 to the atypical MAPKs ERK3 and ERK4 defines a
            novel MAPK interaction motif
  JOURNAL   J. Biol. Chem. 284 (29), 19392-19401 (2009)
   PUBMED   19473979
  REMARK    GeneRIF: Data defined a novel MK5 interaction motif (FRIEDE) within
            both ERK4 and ERK3 that is essential for binding to the C-terminal
            region of MK5.
REFERENCE   5  (bases 1 to 4736)
  AUTHORS   Lerner-Marmarosh,N., Miralem,T., Gibbs,P.E. and Maines,M.D.
  TITLE     Human biliverdin reductase is an ERK activator; hBVR is an ERK
            nuclear transporter and is required for MAPK signaling
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 105 (19), 6870-6875 (2008)
   PUBMED   18463290
  REMARK    GeneRIF: These findings, together with observations that si-hBVR
            blocked activation of ERK and Elk1 by IGF1 and prevented formation
            of ternary complex between MEK/ERK/hBVR, define the critical role
            of hBVR in ERK signaling and nuclear functions of the kinase.
REFERENCE   6  (bases 1 to 4736)
  AUTHORS   Davis,R.J.
  TITLE     Transcriptional regulation by MAP kinases
  JOURNAL   Mol. Reprod. Dev. 42 (4), 459-467 (1995)
   PUBMED   8607977
  REMARK    Review article
REFERENCE   7  (bases 1 to 4736)
  AUTHORS   Seger,R. and Krebs,E.G.
  TITLE     The MAPK signaling cascade
  JOURNAL   FASEB J. 9 (9), 726-735 (1995)
   PUBMED   7601337
  REMARK    Review article
REFERENCE   8  (bases 1 to 4736)
  AUTHORS   Zhu,A.X., Zhao,Y., Moller,D.E. and Flier,J.S.
  TITLE     Cloning and characterization of p97MAPK, a novel human homolog of
            rat ERK-3
  JOURNAL   Mol. Cell. Biol. 14 (12), 8202-8211 (1994)
   PUBMED   7969157
REFERENCE   9  (bases 1 to 4736)
  AUTHORS   Li,L., Wysk,M., Gonzalez,F.A. and Davis,R.J.
  TITLE     Genomic loci of human mitogen-activated protein kinases
  JOURNAL   Oncogene 9 (2), 647-649 (1994)
   PUBMED   8290275
REFERENCE   10 (bases 1 to 4736)
  AUTHORS   Gonzalez,F.A., Raden,D.L., Rigby,M.R. and Davis,R.J.
  TITLE     Heterogeneous expression of four MAP kinase isoforms in human
            tissues
  JOURNAL   FEBS Lett. 304 (2-3), 170-178 (1992)
   PUBMED   1319925
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC050299.1, X59727.1,
            BC040493.1 and AI088913.1.
            On Mar 9, 2006 this sequence version replaced gi:6715608.
            
            Summary: Mitogen-activated protein kinase 4 is a member of the
            mitogen-activated protein kinase family. Tyrosine kinase growth
            factor receptors activate mitogen-activated protein kinases which
            then translocate into the nucleus where it phosphorylates nuclear
            targets. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK295058.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-942               BC050299.1         1-942
            943-2067            X59727.1           480-1604
            2068-4518           BC040493.1         1664-4114
            4519-4736           AI088913.1         1-218               c
FEATURES             Location/Qualifiers
     source          1..4736
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q21.1"
     gene            1..4736
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="mitogen-activated protein kinase 4"
                     /db_xref="GeneID:5596"
                     /db_xref="HGNC:6878"
                     /db_xref="MIM:176949"
     exon            1..130
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       48
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146548264"
     variation       97
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190769648"
     exon            131..1546
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       135
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142956846"
     variation       150
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181934847"
     variation       325
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377162712"
     variation       462
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370642437"
     variation       543
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049710"
     variation       763
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1049711"
     variation       816
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138390517"
     misc_feature    911..913
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="upstream in-frame stop codon"
     variation       943
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3752085"
     variation       978
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370578537"
     variation       979
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372936554"
     CDS             1001..2764
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /EC_number="2.7.11.24"
                     /note="Erk3-related; p63-MAPK; MAP kinase 4; MAP kinase
                     isoform p63; extracellular signal-regulated kinase 4"
                     /codon_start=1
                     /product="mitogen-activated protein kinase 4"
                     /protein_id="NP_002738.2"
                     /db_xref="GI:89276769"
                     /db_xref="CCDS:CCDS42437.1"
                     /db_xref="GeneID:5596"
                     /db_xref="HGNC:6878"
                     /db_xref="MIM:176949"
                     /translation="
MAEKGDCIASVYGYDLGGRFVDFQPLGFGVNGLVLSAVDSRACRKVAVKKIALSDARSMKHALREIKIIRRLDHDNIVKVYEVLGPKGTDLQGELFKFSVAYIVQEYMETDLARLLEQGTLAEEHAKLFMYQLLRGLKYIHSANVLHRDLKPANIFISTEDLVLKIGDFGLARIVDQHYSHKGYLSEGLVTKWYRSPRLLLSPNNYTKAIDMWAAGCILAEMLTGRMLFAGAHELEQMQLILETIPVIREEDKDELLRVMPSFVSSTWEVKRPLRKLLPEVNSEAIDFLEKILTFNPMDRLTAEMGLQHPYMSPYSCPEDEPTSQHPFRIEDEIDDIVLMAANQSQLSNWDTCSSRYPVSLSSDLEWRPDRCQDASEVQRDPRAGSAPLAEDVQVDPRKDSHSSSERFLEQSHSSMERAFEADYGRSCDYKVGSPSYLDKLLWRDNKPHHYSEPKLILDLSHWKQAAGAPPTATGLADTGAREDEPASLFLEIAQWVKSTQGGPEHASPPADDPERRLSASPPGRPAPVDGGASPQFDLDVFISRALKLCTKPEDLPDNKLGDLNGACIPEHPGDLVQTEAFSKERW
"
     misc_feature    1040..2053
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="Catalytic domain of the Serine/Threonine Kinases,
                     Mitogen-Activated Protein Kinases 4 and 6; Region:
                     STKc_MAPK4_6; cd07854"
                     /db_xref="CDD:143359"
     misc_feature    1058..1936
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="Protein kinase domain; Region: Pkinase; pfam00069"
                     /db_xref="CDD:200973"
     misc_feature    order(1076..1087,1091..1096,1100..1102,1139..1141,
                     1145..1147,1190..1192,1232..1234,1313..1324,1331..1333,
                     1337..1342,1445..1447,1451..1453,1457..1462,1466..1468,
                     1499..1504,1511..1513,1556..1558,1562..1573,1577..1579,
                     1691..1693)
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="active site"
                     /db_xref="CDD:143359"
     misc_feature    order(1076..1087,1091..1096,1100..1102,1139..1141,
                     1145..1147,1232..1234,1313..1324,1331..1333,1340..1342,
                     1451..1453,1457..1462,1466..1468,1499..1504)
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:143359"
     misc_feature    order(1190..1192,1337..1339,1445..1447,1451..1453,
                     1511..1513,1556..1558,1562..1573,1577..1579,1691..1693)
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:143359"
     misc_feature    order(1223..1225,1325..1330,1343..1345,1373..1375,
                     1382..1384,1403..1405,1469..1480,1484..1486,1943..1945,
                     1949..1951,1958..1960)
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="KIM docking site [polypeptide binding]; other site"
                     /db_xref="CDD:143359"
     misc_feature    1499..1579
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:143359"
     misc_feature    1556..1564
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P31152.2);
                     Region: SEG motif"
     misc_feature    1556..1558
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PAK1, PAK2 and PAK3; propagated
                     from UniProtKB/Swiss-Prot (P31152.2); phosphorylation
                     site"
     misc_feature    1586..1588
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[10]
                     /db_xref="HPRD:01497"
     misc_feature    1982..1999
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P31152.2);
                     Region: FRIEDE motif"
     variation       1001
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201113430"
     variation       1024
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370265083"
     variation       1049
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374524649"
     variation       1050
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34207571"
     variation       1072
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370695586"
     variation       1084
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3752086"
     variation       1108
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367914884"
     variation       1112
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3752087"
     variation       1122
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199879399"
     variation       1139
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367684848"
     variation       1155
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140972647"
     variation       1162
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56259916"
     variation       1163
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61747609"
     variation       1169
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369990219"
     variation       1170
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373566179"
     variation       1183
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55800528"
     variation       1186
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56328353"
     variation       1190
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372835108"
     variation       1208
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200603915"
     variation       1252
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56335862"
     variation       1297
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200651462"
     variation       1298
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199714690"
     variation       1303
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368717366"
     variation       1309
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377215882"
     variation       1330
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55888637"
     variation       1331
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200812352"
     variation       1340
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186595195"
     variation       1359
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376833028"
     variation       1360
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370581359"
     variation       1382
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372903985"
     variation       1403
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375617264"
     variation       1405
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370089598"
     variation       1408
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373807658"
     variation       1423
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45484996"
     variation       1426
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373515540"
     variation       1457
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201642307"
     variation       1465
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371208782"
     variation       1474
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372619410"
     variation       1487
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376363938"
     variation       1489
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45471400"
     variation       1500
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375005333"
     variation       1522
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191006677"
     exon            1547..1691
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       1564
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373908500"
     variation       1588
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200093759"
     variation       1591
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371497095"
     variation       1611
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374923849"
     variation       1636
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368403152"
     variation       1663
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372337672"
     variation       1671
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201585776"
     exon            1692..1853
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       1723
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372444429"
     variation       1745
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375703786"
     variation       1746
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369281315"
     variation       1751
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:66911538"
     variation       1786
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375115857"
     variation       1812
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144944694"
     variation       1837
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16952476"
     variation       1847
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200724420"
     exon            1854..2067
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       1865
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376293194"
     variation       1872
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371938450"
     variation       1877
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374522930"
     variation       1888
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368937966"
     variation       1948
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9953234"
     variation       1950
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183692158"
     variation       1960
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199726442"
     variation       2003
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201688372"
     variation       2005
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371446025"
     variation       2020
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199859025"
     variation       2023
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201644833"
     variation       2046
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368928539"
     variation       2055
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186466272"
     variation       2056
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55784156"
     variation       2060
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376409655"
     exon            2068..4736
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /inference="alignment:Splign:1.39.8"
     variation       2112
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3752089"
     variation       2203
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373760952"
     variation       2207
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199532611"
     variation       2275
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201785400"
     variation       2317
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201371342"
     variation       2338
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202060655"
     variation       2343
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371041289"
     variation       2398
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368636904"
     variation       2437
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56329210"
     variation       2578
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374164796"
     variation       2645
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368327562"
     variation       2659
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372005204"
     variation       2668
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374912748"
     variation       2671
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150838442"
     variation       2729
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202116209"
     variation       2753
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7506742"
     variation       2799
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182939342"
     variation       2803
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369768996"
     STS             2868..3047
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="RH80094"
                     /db_xref="UniSTS:90223"
     STS             2928..3057
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="SHGC-30831"
                     /db_xref="UniSTS:60855"
     variation       2938
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371909184"
     variation       3084
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117538599"
     variation       3094
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369187150"
     variation       3103
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187274075"
     variation       3112
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371792734"
     variation       3151
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139987399"
     variation       3154
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117876156"
     variation       3201
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190903705"
     variation       3210
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143981075"
     STS             3214..3513
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="G43235"
                     /db_xref="UniSTS:94901"
     STS             3244..3452
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="G59817"
                     /db_xref="UniSTS:136966"
     variation       3255
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183090695"
     variation       3284
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187725356"
     variation       3343
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1049712"
     variation       3354
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049713"
     variation       3428
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3288"
     variation       3465
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192502665"
     variation       3494
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184360910"
     variation       3620..3621
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35835049"
     variation       3639
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147310972"
     variation       3723
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188104940"
     variation       3747
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192840046"
     variation       3770
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1049714"
     variation       3859
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117572218"
     variation       3865
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140996922"
     variation       3948..3949
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:71796948"
     variation       3950
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73431466"
     variation       3953
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71357248"
     variation       4005
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149843351"
     variation       4055
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145878730"
     variation       4090
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184556363"
     variation       4094
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148600103"
     variation       4146
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142067224"
     variation       4216
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146692699"
     variation       4283
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77980688"
     variation       4296
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74860287"
     STS             4304..4570
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="STS-X59727"
                     /db_xref="UniSTS:30227"
     variation       4336
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140313726"
     STS             4405..4567
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="STS-T28761"
                     /db_xref="UniSTS:37486"
     variation       4482
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813088"
     variation       4519
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8724"
     variation       4523
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188921998"
     STS             4532..4721
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /standard_name="STS-R37298"
                     /db_xref="UniSTS:3540"
     variation       4571
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371538793"
     variation       4670
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181577660"
     variation       4673
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146496996"
     variation       4692
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185109855"
     polyA_signal    4713..4718
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
     variation       4719
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111349400"
     variation       4728
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190553333"
     polyA_site      4734
                     /gene="MAPK4"
                     /gene_synonym="ERK-4; ERK3; Erk4; MAPK 4; p63MAPK; PRKM4"
ORIGIN      
gctgtcggggcgaccgcgggagctcgccgtgcgccgtggctgggaccggcctggccgagcgcgccggcgccgcggccgcagacaaagggcggctcgcgcccgggccgccacgctctcgggctctgcctcgggaaggagacttggtctgaaagatgccacattcctgcagcctctcttggtgcagtggaatacagtcttgggcgaggtggcgtggatgagctggtgaaagaggatgctgcccacatccaaaggctccagaggatcctggcctggcagctgagctcccctgcatttggaacctcaggcgtaacttggtgtagagctcatgaaaggtgcttgtgtttctccagcttttttcaccagtgcttaccagactggctcaggttttggaatctaaggtgagctggtagaaacaggagaggtagaaagaagcccctggatgcctccagaattcattgatgggatccctgcatactgcttggaacacagaaagaggctgtgacacagctgagctttggagcatcttaaggagctcagctcagcaaacaactcttgcatttcagccagaaagagcctcttgtaacaaagtattcaaaggggagagtttctgcatcttttactttgcagtccactatggtagaaaacttgacattccatagataatgatactgggttttctttccaagatgccagctttaaaagaaatatgagccattctaagctttaagaagggttcaggaaacacaggaattagtagacagccctcccaatgcaggttaagacgacagcctgcgcccccaactagcacagctcagcgagcatgaccatatgccattctcgtctccagagagctggtggcagtgacctcactaggagaaaacacatccctcagccgtgggacttgacagaatgaggtgcgcgagggaggccgctagccgagacttggcctttcctgactgcccctgtgttacctgggcagctccagatcactgagcccacaatggctgagaagggtgactgcatcgccagtgtctatgggtatgacctcggtgggcgctttgttgacttccaacccctgggcttcggtgtcaatggtttggtgctgtcggccgtggacagccgggcctgccggaaggtcgctgtgaagaagattgccctgagcgatgcccgcagcatgaagcacgcgctccgagagatcaagatcattcggcgcctggaccacgacaacatcgtcaaagtgtacgaggtgctcggtcccaagggcactgacctgcagggtgagctgttcaagttcagcgtggcgtacatcgtccaggagtacatggagaccgacctggcacgcctgctggagcagggcacgctggcagaagagcatgccaagctgttcatgtaccagctgctccgcgggctcaagtacatccactccgccaacgtgctgcacagggacctgaagcccgccaacatcttcatcagcacagaggacctcgtgctcaagattggggatttcgggttggcaaggatcgttgatcagcattactcccacaagggttatctgtcagaagggttggtaacaaagtggtaccgttccccacgactgctcctttcccccaataactacaccaaagccatcgacatgtgggccgccggctgcatcctggctgagatgcttacggggagaatgctctttgctggggcccatgagctggagcagatgcaactcatcctggagaccatccctgtaatccgggaggaagacaaggacgagctgctcagggtgatgccttcctttgtcagcagcacctgggaggtgaagaggcctctgcgcaagctgctccctgaagtgaacagtgaagccatcgactttctggagaagatcctgacctttaaccccatggatcgcctaacagctgagatggggctgcaacacccctacatgagcccatactcgtgccctgaggacgagcccacctcacaacaccccttccgcattgaggatgagatcgacgacatcgtgctgatggccgctaaccagagccagctgtccaactgggacacgtgcagttccaggtaccctgtgagcctgtcgtcggacctggagtggcggcctgaccggtgccaggacgccagcgaggtacagcgcgacccgcgcgcgggttcggcgccactggctgaggacgtgcaggtggacccgcgcaaggactcgcacagcagctccgagcgcttcctagagcagtcgcactcgtccatggagcgcgccttcgaggccgactacgggcgctcctgcgactacaaggtggggtcgccgtcctacctggacaagctgctgtggcgcgacaacaagccgcaccactactcggagcccaagctcatcctggacctgtcgcactggaagcaggcggccggcgcgccccccacggccacggggctggcggacacgggggcgcgcgaggacgagccggccagcctcttcctggagatcgcgcagtgggtcaagagcacgcagggcggcccagagcacgccagcccgcccgccgacgaccccgagcgccgcttgtctgcctcgccccccggccgcccggccccggtggacggcggcgccagcccccagttcgacctggacgtgttcatctcccgcgccctgaagctctgcaccaagcccgaggacctgccggacaataaactgggcgacctcaatggtgcgtgcatccccgagcaccctggcgacctcgtgcagaccgaggccttctccaaagaaaggtggtgagggcggaggggccgctccaggccccacagagcaggagacccccagagaaagccggggctggcaggaggcggccgcccttcccgcccctctctgctgccttggggttggcagaacacgtgaaggatccgaggagcgagaggaatgtccatttcttaaactgccttaataactagcctttaacctgtgggagcgggtttgaacaggaccctggcttaggggttgatcactttcctagcaaaggggagaccacatgtggtgcacagggaagaaacggctttagacagcagtctgcgggccccacctgggtggcaggatgccgagaaatcttgcagaggtagctccgaaaccatctggcccaactagcctcaactgacagctgaggaaaggcaattaggcccagagaggcagagacactcgcttaagatcacaggcttagtgtgaggacgagcttgaaatcccagtctcctggcccccaggccagggtctgtccaccatagaatgtcttcctctactggggtcgttctggctttttgttagaaacttggtctgagatgtttcttccctgtccattaccattcgatgttcttttattcagagcaatgtttcttgtattctgaaactggaaactgaaccagtttgtttctcctagtcaccaagcatactttcctggctccccaagtacttaaatgttctcatctgtcgcacccctgtatttgcctcacccctgcatggtcggaaatcttcgtttcaggtcagaacagcctggggtctgtgggtaaaatcagcccttctcccaggcctgtgcacacaccccctcagcactccctatgcactttcctgacacgcaaagacacagccctctttccccactgggcgtcctaccccagtgaggttgaaggcaccaattccaagaatccctccaacctccctgccagcactcccccttcaccccacacccggcccccccacctaaccacagcgcctctccagacctacctcgggacctaatgttctctacatgaactgctcatttggaggacagcagtgaggtcctgccatagagcaaatgtgttaggagagaaggtttcacatgggacccaacatccttcatcaatactttcctgagtttgatcatccatttagccttgacaaacagcagaccctacagagatgtgttggagagcacgtcgtgaccttgggggcaaggaatccagaaaggtaggaagatatgaaaagagaggtgtcaacagcaagggctcttaggggtcaggcaccagcatggagacctcatgacaaaggaagggactcaaagcagcaatgcccctcatagtgtaggctaaggtgagtttggtgcatgcaaacctgtgtgctcacccacagagcatggggtaatggtgtgtagacacaggccctctgcagaagcgtggggtggggacactgacagcccctatctggtccccaggaacattctaccatttctgccactggtgttcagctccttctcttcccccaacactcccaaagatacccacaggaagtccagccagtttccaggtagaggattccaccagttggtcttgggctgcgttcaccctcacatcacagcaccttaaatctaatcagcaaactataatttgtacgttgaaacctgcaacacattagaaacttatatttaaaaacagaattaatcacactgaccaacttttaaatggaaaatatgtaaataggaagtgtttgggttttgttttttctttaagaaaaagaaatgtacaccactcctcatgtgccattttgtcctcagagggcggctttacttttttggtaaaggaacaagctgctggccttgaccaggagttcatatataactgttattacagaggaattgttataactactaatgtttttaaaaaatttattaaacattattaaacttgatcaggtcaggccaaataaagttttattggaacacaga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5596 -> Molecular function: GO:0004707 [MAP kinase activity] evidence: IEA
            GeneID:5596 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:5596 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:5596 -> Molecular function: GO:0019901 [protein kinase binding] evidence: ISS
            GeneID:5596 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: ISS
            GeneID:5596 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IEA
            GeneID:5596 -> Biological process: GO:0000165 [MAPK cascade] evidence: TAS
            GeneID:5596 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
            GeneID:5596 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
            GeneID:5596 -> Cellular component: GO:0005634 [nucleus] evidence: ISS
            GeneID:5596 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_002738 -> EC 2.7.11.24

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.