Home |
Help |
Advanced search
2024-04-20 16:19:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002742 3679 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens protein kinase D1 (PRKD1), mRNA.
ACCESSION NM_002742
VERSION NM_002742.2 GI:115529462
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3679)
AUTHORS Doppler,H., Bastea,L.I., Eiseler,T. and Storz,P.
TITLE Neuregulin mediates F-actin-driven cell migration through
inhibition of protein kinase D1 via Rac1 protein
JOURNAL J. Biol. Chem. 288 (1), 455-465 (2013)
PUBMED 23148218
REMARK GeneRIF: Neuregulin mediates F-actin-driven cell migration through
inhibition of protein kinase D1 via Rac1 protein
REFERENCE 2 (bases 1 to 3679)
AUTHORS Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
TITLE Loci associated with N-glycosylation of human immunoglobulin G show
pleiotropy with autoimmune diseases and haematological cancers
JOURNAL PLoS Genet. 9 (1), E1003225 (2013)
PUBMED 23382691
REFERENCE 3 (bases 1 to 3679)
AUTHORS Shin,S., Wolgamott,L. and Yoon,S.O.
TITLE Regulation of endothelial cell morphogenesis by the protein kinase
D (PKD)/glycogen synthase kinase 3 (GSK3)beta pathway
JOURNAL Am. J. Physiol., Cell Physiol. 303 (7), C743-C756 (2012)
PUBMED 22855295
REMARK GeneRIF: The role of PKD is found to mediate the regulation of
vascular morphogenesis.
REFERENCE 4 (bases 1 to 3679)
AUTHORS Christoforides,C., Rainero,E., Brown,K.K., Norman,J.C. and Toker,A.
TITLE PKD controls alphavbeta3 integrin recycling and tumor cell invasive
migration through its substrate Rabaptin-5
JOURNAL Dev. Cell 23 (3), 560-572 (2012)
PUBMED 22975325
REMARK GeneRIF: The PKD pathway couples receptor tyrosine kinase signaling
to an integrin switch via Rabaptin-5 phosphorylation.
REFERENCE 5 (bases 1 to 3679)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 6 (bases 1 to 3679)
AUTHORS Johannes,F.J., Prestle,J., Eis,S., Oberhagemann,P. and
Pfizenmaier,K.
TITLE PKCu is a novel, atypical member of the protein kinase C family
JOURNAL J. Biol. Chem. 269 (8), 6140-6148 (1994)
PUBMED 8119958
REFERENCE 7 (bases 1 to 3679)
AUTHORS Jakobovits,A., Rosenthal,A. and Capon,D.J.
TITLE Trans-activation of HIV-1 LTR-directed gene expression by tat
requires protein kinase C
JOURNAL EMBO J. 9 (4), 1165-1170 (1990)
PUBMED 2182321
REMARK Erratum:[EMBO J 1990 Oct;9(10):3413]
REFERENCE 8 (bases 1 to 3679)
AUTHORS Davis,R.J. and Czech,M.P.
TITLE Platelet-derived growth factor mimics phorbol diester action on
epidermal growth factor receptor phosphorylation at threonine-654
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 82 (12), 4080-4084 (1985)
PUBMED 2987962
REFERENCE 9 (bases 1 to 3679)
AUTHORS Davis,R.J. and Czech,M.P.
TITLE Tumor-promoting phorbol diesters cause the phosphorylation of
epidermal growth factor receptors in normal human fibroblasts at
threonine-654
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 82 (7), 1974-1978 (1985)
PUBMED 2984676
REFERENCE 10 (bases 1 to 3679)
AUTHORS Busch,H. and Eisenhart-Rothe,B.V.
TITLE [Old and new dangers of blood transfusion (author's transl)]
JOURNAL MMW Munch Med Wochenschr 118 (22), 713-718 (1976)
PUBMED 5668
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
X75756.1, CN412379.1 and BX645735.1.
On Oct 5, 2006 this sequence version replaced gi:4506074.
Summary: PRKD1 is a serine/threonine kinase that regulates a
variety of cellular functions, including membrane receptor
signaling, transport at the Golgi, protection from oxidative stress
at the mitochondria, gene transcription, and regulation of cell
shape, motility, and adhesion (summary by Eiseler et al., 2009
[PubMed 19329994]).[supplied by OMIM, Nov 2010].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X75756.1, AK314170.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-583 X75756.1 55-637
584-877 CN412379.1 172-465
878-2809 X75756.1 932-2863
2810-3283 BX645735.1 120-593
3284-3679 X75756.1 3338-3733
FEATURES Location/Qualifiers
source 1..3679
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q11"
gene 1..3679
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="protein kinase D1"
/db_xref="GeneID:5587"
/db_xref="HGNC:9407"
/db_xref="MIM:605435"
exon 1..445
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
CDS 182..2920
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/EC_number="2.7.11.13"
/note="protein kinase C, mu; nPKC-D1; nPKC-mu; protein
kinase D; protein kinase C mu type"
/codon_start=1
/product="serine/threonine-protein kinase D1"
/protein_id="NP_002733.2"
/db_xref="GI:115529463"
/db_xref="CCDS:CCDS9637.1"
/db_xref="GeneID:5587"
/db_xref="HGNC:9407"
/db_xref="MIM:605435"
/translation="
MSAPPVLRPPSPLLPVAAAAAAAAAALVPGSGPGPAPFLAPVAAPVGGISFHLQIGLSREPVLLLQDSSGDYSLAHVREMACSIVDQKFPECGFYGMYDKILLFRHDPTSENILQLVKAASDIQEGDLIEVVLSASATFEDFQIRPHALFVHSYRAPAFCDHCGEMLWGLVRQGLKCEGCGLNYHKRCAFKIPNNCSGVRRRRLSNVSLTGVSTIRTSSAELSTSAPDEPLLQKSPSESFIGREKRSNSQSYIGRPIHLDKILMSKVKVPHTFVIHSYTRPTVCQYCKKLLKGLFRQGLQCKDCRFNCHKRCAPKVPNNCLGEVTINGDLLSPGAESDVVMEEGSDDNDSERNSGLMDDMEEAMVQDAEMAMAECQNDSGEMQDPDPDHEDANRTISPSTSNNIPLMRVVQSVKHTKRKSSTVMKEGWMVHYTSKDTLRKRHYWRLDSKCITLFQNDTGSRYYKEIPLSEILSLEPVKTSALIPNGANPHCFEITTANVVYYVGENVVNPSSPSPNNSVLTSGVGADVARMWEIAIQHALMPVIPKGSSVGTGTNLHRDISVSISVSNCQIQENVDISTVYQIFPDEVLGSGQFGIVYGGKHRKTGRDVAIKIIDKLRFPTKQESQLRNEVAILQNLHHPGVVNLECMFETPERVFVVMEKLHGDMLEMILSSEKGRLPEHITKFLITQILVALRHLHFKNIVHCDLKPENVLLASADPFPQVKLCDFGFARIIGEKSFRRSVVGTPAYLAPEVLRNKGYNRSLDMWSVGVIIYVSLSGTFPFNEDEDIHDQIQNAAFMYPPNPWKEISHEAIDLINNLLQVKMRKRYSVDKTLSHPWLQDYQTWLDLRELECKIGERYITHESDDLRWEKYAGEQGLQYPTHLINPSASHSDTPETEETEMKALGERVSIL
"
misc_feature 464..466
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 620..769
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="Protein kinase C conserved region 1 (C1) .
Cysteine-rich zinc binding domain. Some members of this
domain family bind phorbol esters and diacylglycerol, some
are reported to bind RasGTP. May occur in tandem
arrangement. Diacylglycerol (DAG) is a second...; Region:
C1; cd00029"
/db_xref="CDD:28911"
misc_feature order(620..622,659..661,668..670,710..712,719..721,
734..736,743..745,767..769)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="zinc binding sites [ion binding]; other site"
/db_xref="CDD:28911"
misc_feature order(641..643,650..655,680..700)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="putative DAG/PE binding site; other site"
/db_xref="CDD:28911"
misc_feature order(650..652,656..658)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="putative RAS interaction site [polypeptide
binding]; other site"
/db_xref="CDD:28911"
misc_feature 794..796
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15139.2); phosphorylation site"
misc_feature 794..796
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05668"
misc_feature 803..805
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15139.2); phosphorylation site"
misc_feature 926..928
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 992..1141
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="Protein kinase C conserved region 1 (C1) .
Cysteine-rich zinc binding domain. Some members of this
domain family bind phorbol esters and diacylglycerol, some
are reported to bind RasGTP. May occur in tandem
arrangement. Diacylglycerol (DAG) is a second...; Region:
C1; cd00029"
/db_xref="CDD:28911"
misc_feature order(992..994,1031..1033,1040..1042,1082..1084,
1091..1093,1106..1108,1115..1117,1139..1141)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="zinc binding sites [ion binding]; other site"
/db_xref="CDD:28911"
misc_feature order(1013..1015,1022..1027,1052..1072)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="putative DAG/PE binding site; other site"
/db_xref="CDD:28911"
misc_feature order(1022..1024,1028..1030)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="putative RAS interaction site [polypeptide
binding]; other site"
/db_xref="CDD:28911"
misc_feature 1214..1216
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15139.2); phosphorylation site"
misc_feature 1370..1372
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MAPK13; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 1370..1372
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1382..1384
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MAPK13; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 1451..1798
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="Pleckstrin homology-like domain; Region: PH-like;
cl00273"
/db_xref="CDD:206947"
misc_feature order(1454..1477,1499..1519,1526..1546,1598..1609,
1652..1663,1727..1741,1772..1798)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="PH-like core; other site"
/db_xref="CDD:176275"
misc_feature 1475..1477
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 1475..1477
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01809"
misc_feature 1475..1477
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 1523..1525
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15139.2); phosphorylation site"
misc_feature 1568..1570
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by ABL; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 1568..1570
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01809"
misc_feature 1568..1570
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 1598..1600
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15139.2); phosphorylation site"
misc_feature 1685..1687
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 1685..1687
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 1685..1687
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1940..2698
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature 1946..2692
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="Catalytic domain of Protein Kinases; Region: PKc;
cd00180"
/db_xref="CDD:173623"
misc_feature order(1946..1960,1970..1972,2009..2011,2015..2017,
2108..2110,2156..2167,2177..2179,2183..2185,2297..2299,
2303..2305,2309..2314,2318..2320,2360..2362,2369..2371,
2414..2425)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(1946..1960,1970..1972,2009..2011,2015..2017,
2108..2110,2156..2167,2177..2179,2297..2299,2303..2305,
2309..2314,2318..2320,2360..2362)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(1958..1960,2177..2179,2183..2185,2297..2299,
2303..2305,2309..2311,2369..2371,2414..2425)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(2357..2377,2414..2425)
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 2393..2395
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by PKC/PRKCD; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 2393..2395
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05668"
misc_feature 2393..2395
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05669"
misc_feature 2405..2407
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis and PKC/PRKCD;
propagated from UniProtKB/Swiss-Prot (Q15139.2);
phosphorylation site"
misc_feature 2405..2407
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05668"
misc_feature 2909..2911
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (Q15139.2); phosphorylation site"
misc_feature 2909..2911
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05668"
variation 271..272
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:45441697"
variation 277..278
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace=""
/replace="tccggg"
/db_xref="dbSNP:45471692"
exon 446..584
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
variation 449
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="c"
/replace="g"
/db_xref="dbSNP:45458201"
exon 585..716
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 717..877
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 878..1088
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1089..1166
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
variation 1123
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:2273807"
exon 1167..1371
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
variation 1202
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="c"
/db_xref="dbSNP:45460991"
exon 1372..1495
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1496..1573
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1574..1853
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1854..1906
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1907..1979
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 1980..2086
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 2087..2248
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
variation 2143
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="c"
/db_xref="dbSNP:45586635"
exon 2249..2347
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 2348..2615
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
variation 2383
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2230505"
exon 2616..2701
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
exon 2702..3679
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/inference="alignment:Splign:1.39.8"
STS 2719..3172
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/standard_name="MARC_14413-14414:1010075307:1"
/db_xref="UniSTS:267659"
variation 2810
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042825"
variation 2838
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:45585836"
STS 2910..3111
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/standard_name="STS-X75756"
/db_xref="UniSTS:47916"
variation 2917
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="c"
/db_xref="dbSNP:1475116"
STS 2989..3142
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/standard_name="UniSTS:224841"
/db_xref="UniSTS:224841"
variation 3348
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:45569242"
variation 3386
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:11984"
variation 3615
/gene="PRKD1"
/gene_synonym="PKC-MU; PKCM; PKD; PRKCM"
/replace="a"
/replace="g"
/db_xref="dbSNP:45474193"
ORIGIN
ccctcccctcccgatcctcatccccttgccctcccccagcccagggacttttccggaaagtttttattttccgtctgggctctcggagaaagaagctcctggctcagcggctgcaaaactttcctgctgccgcgccgccagcccccgccctccgctgcccggccctgcgccccgccgagcgatgagcgcccctccggtcctgcggccgcccagtccgctgctgcccgtggcggcggcagctgccgcagcggccgccgcactggtcccagggtccgggcccgggcccgcgccgttcttggctcctgtcgcggccccggtcgggggcatctcgttccatctgcagatcggcctgagccgtgagccggtgctgctgctgcaggactcgtccggggactacagcctggcgcacgtccgcgagatggcttgctccattgtcgaccagaagttccctgaatgtggtttctacggaatgtatgataagatcctgctttttcgccatgaccctacctctgaaaacatccttcagctggtgaaagcggccagtgatatccaggaaggcgatcttattgaagtggtcttgtcagcttccgccacctttgaagactttcagattcgtccccacgctctctttgttcattcatacagagctccagctttctgtgatcactgtggagaaatgctgtgggggctggtacgtcaaggtcttaaatgtgaagggtgtggtctgaattaccataagagatgtgcatttaaaatacccaacaattgcagcggtgtgaggcggagaaggctctcaaacgtttccctcactggggtcagcaccatccgcacatcatctgctgaactctctacaagtgcccctgatgagccccttctgcaaaaatcaccatcagagtcgtttattggtcgagagaagaggtcaaattctcaatcatacattggacgaccaattcaccttgacaagattttgatgtctaaagttaaagtgccgcacacatttgtcatccactcctacacccggcccacagtgtgccagtactgcaagaagcttctgaaggggcttttcaggcagggcttgcagtgcaaagattgcagattcaactgccataaacgttgtgcaccgaaagtaccaaacaactgccttggcgaagtgaccattaatggagatttgcttagccctggggcagagtctgatgtggtcatggaagaagggagtgatgacaatgatagtgaaaggaacagtgggctcatggatgatatggaagaagcaatggtccaagatgcagagatggcaatggcagagtgccagaacgacagtggcgagatgcaagatccagacccagaccacgaggacgccaacagaaccatcagtccatcaacaagcaacaatatcccactcatgagggtagtgcagtctgtcaaacacacgaagaggaaaagcagcacagtcatgaaagaaggatggatggtccactacaccagcaaggacacgctgcggaaacggcactattggagattggatagcaaatgtattaccctctttcagaatgacacaggaagcaggtactacaaggaaattcctttatctgaaattttgtctctggaaccagtaaaaacttcagctttaattcctaatggggccaatcctcattgtttcgaaatcactacggcaaatgtagtgtattatgtgggagaaaatgtggtcaatccttccagcccatcaccaaataacagtgttctcaccagtggcgttggtgcagatgtggccaggatgtgggagatagccatccagcatgcccttatgcccgtcattcccaagggctcctccgtgggtacaggaaccaacttgcacagagatatctctgtgagtatttcagtatcaaattgccagattcaagaaaatgtggacatcagcacagtatatcagatttttcctgatgaagtactgggttctggacagtttggaattgtttatggaggaaaacatcgtaaaacaggaagagatgtagctattaaaatcattgacaaattacgatttccaacaaaacaagaaagccagcttcgtaatgaggttgcaattctacagaaccttcatcaccctggtgttgtaaatttggagtgtatgtttgagacgcctgaaagagtgtttgttgttatggaaaaactccatggagacatgctggaaatgatcttgtcaagtgaaaagggcaggttgccagagcacataacgaagtttttaattactcagatactcgtggctttgcggcaccttcattttaaaaatatcgttcactgtgacctcaaaccagaaaatgtgttgctagcctcagctgatccttttcctcaggtgaaactttgtgattttggttttgcccggatcattggagagaagtctttccggaggtcagtggtgggtacccccgcttacctggctcctgaggtcctaaggaacaagggctacaatcgctctctagacatgtggtctgttggggtcatcatctatgtaagcctaagcggcacattcccatttaatgaagatgaagacatacacgaccaaattcagaatgcagctttcatgtatccaccaaatccctggaaggaaatatctcatgaagccattgatcttatcaacaatttgctgcaagtaaaaatgagaaagcgctacagtgtggataagaccttgagccacccttggctacaggactatcagacctggttagatttgcgagagctggaatgcaaaatcggggagcgctacatcacccatgaaagtgatgacctgaggtgggagaagtatgcaggcgagcaggggctgcagtaccccacacacctgatcaatccaagtgctagccacagtgacactcctgagactgaagaaacagaaatgaaagccctcggtgagcgtgtcagcatcctctgagttccatctcctataatctgtcaaaacactgtggaactaataaatacatacggtcaggtttaacatttgccttgcagaactgccattattttctgtcagatgagaacaaagctgttaaactgttagcactgttgatgtatctgagttgccaagacaaatcaacagaagcatttgtattttgtgtgaccaactgtgttgtattaacaaaagttccctgaaacacgaaacttgttattgtgaatgattcatgttatatttaatgcattaaacctgtctccactgtgcctttgcaaatcagtgtttttcttactggagcttcattttggtaagagacagaatgtatctgtgaagtagttctgtttggtgtgtcccattggtgttgtcattgtaaacaaactcttgaagagtcgattatttccagtgttctatgaacaactccaaaacccatgtgggaaaaaaatgaatgaggagggtagggaataaaatcctaagacacaaatgcatgaacaagttttaatgtatagttttgaatcctttgcctgcctggtgtgcctcagtatatttaaactcaagacaatgcacctagctgtgcaagacctagtgctcttaagcctaaatgccttagaaatgtaaactgccatatataacagatacatttccctctttcttataatactctgttgtactatggaaaatcagctgctcagcaacctttcacctttgtgtatttttcaataataaaaaatattcttgtcaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5587 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:5587 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:5587 -> Molecular function: GO:0004697 [protein kinase C activity] evidence: IEA
GeneID:5587 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5587 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:5587 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
GeneID:5587 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
GeneID:5587 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:5587 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
GeneID:5587 -> Biological process: GO:0001938 [positive regulation of endothelial cell proliferation] evidence: IGI
GeneID:5587 -> Biological process: GO:0006665 [sphingolipid metabolic process] evidence: TAS
GeneID:5587 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:5587 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
GeneID:5587 -> Biological process: GO:0007030 [Golgi organization] evidence: IMP
GeneID:5587 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:5587 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: TAS
GeneID:5587 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IGI
GeneID:5587 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IMP
GeneID:5587 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:5587 -> Biological process: GO:0010595 [positive regulation of endothelial cell migration] evidence: IMP
GeneID:5587 -> Biological process: GO:0010837 [regulation of keratinocyte proliferation] evidence: ISS
GeneID:5587 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
GeneID:5587 -> Biological process: GO:0018105 [peptidyl-serine phosphorylation] evidence: IDA
GeneID:5587 -> Biological process: GO:0030148 [sphingolipid biosynthetic process] evidence: TAS
GeneID:5587 -> Biological process: GO:0032793 [positive regulation of CREB transcription factor activity] evidence: IGI
GeneID:5587 -> Biological process: GO:0033138 [positive regulation of peptidyl-serine phosphorylation] evidence: IGI
GeneID:5587 -> Biological process: GO:0034599 [cellular response to oxidative stress] evidence: IDA
GeneID:5587 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: IGI
GeneID:5587 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: IMP
GeneID:5587 -> Biological process: GO:0038033 [positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway] evidence: IGI
GeneID:5587 -> Biological process: GO:0038033 [positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway] evidence: IMP
GeneID:5587 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP
GeneID:5587 -> Biological process: GO:0043536 [positive regulation of blood vessel endothelial cell migration] evidence: IGI
GeneID:5587 -> Biological process: GO:0043536 [positive regulation of blood vessel endothelial cell migration] evidence: IMP
GeneID:5587 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5587 -> Biological process: GO:0045087 [innate immune response] evidence: IEA
GeneID:5587 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: ISS
GeneID:5587 -> Biological process: GO:0045766 [positive regulation of angiogenesis] evidence: IGI
GeneID:5587 -> Biological process: GO:0045766 [positive regulation of angiogenesis] evidence: IMP
GeneID:5587 -> Biological process: GO:0045806 [negative regulation of endocytosis] evidence: TAS
GeneID:5587 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
GeneID:5587 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: TAS
GeneID:5587 -> Biological process: GO:0048010 [vascular endothelial growth factor receptor signaling pathway] evidence: IMP
GeneID:5587 -> Biological process: GO:0048193 [Golgi vesicle transport] evidence: ISS
GeneID:5587 -> Biological process: GO:0051092 [positive regulation of NF-kappaB transcription factor activity] evidence: IMP
GeneID:5587 -> Biological process: GO:0060548 [negative regulation of cell death] evidence: IMP
GeneID:5587 -> Biological process: GO:1901727 [positive regulation of histone deacetylase activity] evidence: IGI
GeneID:5587 -> Biological process: GO:2001028 [positive regulation of endothelial cell chemotaxis] evidence: IMP
GeneID:5587 -> Biological process: GO:2001044 [regulation of integrin-mediated signaling pathway] evidence: TAS
GeneID:5587 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:5587 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:5587 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
GeneID:5587 -> Cellular component: GO:0005802 [trans-Golgi network] evidence: IDA
GeneID:5587 -> Cellular component: GO:0005829 [cytosol] evidence: ISS
GeneID:5587 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5587 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:5587 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
GeneID:5587 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IEA
GeneID:5587 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_002733 -> EC 2.7.11.13
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.