Home |
Help |
Advanced search
2024-04-19 13:21:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002613 7243 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens 3-phosphoinositide dependent protein kinase-1 (PDPK1),
transcript variant 1, mRNA.
ACCESSION NM_002613 XM_001130789
VERSION NM_002613.4 GI:387849236
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 7243)
AUTHORS Eser,S., Reiff,N., Messer,M., Seidler,B., Gottschalk,K., Dobler,M.,
Hieber,M., Arbeiter,A., Klein,S., Kong,B., Michalski,C.W.,
Schlitter,A.M., Esposito,I., Kind,A.J., Rad,L., Schnieke,A.E.,
Baccarini,M., Alessi,D.R., Rad,R., Schmid,R.M., Schneider,G. and
Saur,D.
TITLE Selective requirement of PI3K/PDK1 signaling for Kras
oncogene-driven pancreatic cell plasticity and cancer
JOURNAL Cancer Cell 23 (3), 406-420 (2013)
PUBMED 23453624
REMARK GeneRIF: cell-autonomous phosphoinositide 3-kinase and
3-phosphoinositide-dependent protein kinase 1 are key effectors of
oncogenic Kras in the pancreas, mediating cell plasticity,
acinar-to-ductal metaplasia, and pancreatic ductal adenocarcinoma
formation
REFERENCE 2 (bases 1 to 7243)
AUTHORS Raimondi,C., Chikh,A., Wheeler,A.P., Maffucci,T. and Falasca,M.
TITLE A novel regulatory mechanism links PLCgamma1 to PDK1
JOURNAL J. Cell. Sci. 125 (PT 13), 3153-3163 (2012)
PUBMED 22454520
REMARK GeneRIF: PDK1 and PLCgamma1 act on the same signalling cascade, and
the PDK1/PLCgamma1 pathway is required for regulation of cell
invasion.
REFERENCE 3 (bases 1 to 7243)
AUTHORS Kim,M.G., Moon,J.S., Kim,E.J., Lee,S.H. and Oh,J.W.
TITLE Destabilization of PDK1 by Hsp90 inactivation suppresses hepatitis
C virus replication through inhibition of PRK2-mediated viral RNA
polymerase phosphorylation
JOURNAL Biochem. Biophys. Res. Commun. 421 (1), 112-118 (2012)
PUBMED 22490666
REMARK GeneRIF: these findings suggest that Hsp90 plays a critical role in
the regulation of HCV RNA polymerase phosphorylation via the
PDK1-PRK2 signaling pathway.
REFERENCE 4 (bases 1 to 7243)
AUTHORS Kikani,C.K., Verona,E.V., Ryu,J., Shen,Y., Ye,Q., Zheng,L.,
Qian,Z., Sakaue,H., Nakamura,K., Du,J., Ji,Q., Ogawa,W., Sun,L.Z.,
Dong,L.Q. and Liu,F.
TITLE Proliferative and antiapoptotic signaling stimulated by
nuclear-localized PDK1 results in oncogenesis
JOURNAL Sci Signal 5 (249), RA80 (2012)
PUBMED 23131847
REMARK GeneRIF: cytoplasmic localization of PDK1 correlated only with
early-stage, low-risk tumors, whereas nuclear PDK1 localization
correlated with high-risk tumors
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 7243)
AUTHORS Yu,J., Chen,K.S., Li,Y.N., Yang,J. and Zhao,L.
TITLE Silencing of PDK1 gene expression by RNA interference suppresses
growth of esophageal cancer
JOURNAL Asian Pac. J. Cancer Prev. 13 (8), 4147-4151 (2012)
PUBMED 23098536
REMARK GeneRIF: High 3-phosphoinositide-dependent protein kinase 1 is
associated with esophageal cancer.
REFERENCE 6 (bases 1 to 7243)
AUTHORS Meier,R., Alessi,D.R., Cron,P., Andjelkovic,M. and Hemmings,B.A.
TITLE Mitogenic activation, phosphorylation, and nuclear translocation of
protein kinase Bbeta
JOURNAL J. Biol. Chem. 272 (48), 30491-30497 (1997)
PUBMED 9374542
REFERENCE 7 (bases 1 to 7243)
AUTHORS Shaw,M., Cohen,P. and Alessi,D.R.
TITLE Further evidence that the inhibition of glycogen synthase
kinase-3beta by IGF-1 is mediated by PDK1/PKB-induced
phosphorylation of Ser-9 and not by dephosphorylation of Tyr-216
JOURNAL FEBS Lett. 416 (3), 307-311 (1997)
PUBMED 9373175
REFERENCE 8 (bases 1 to 7243)
AUTHORS Alessi,D.R., Deak,M., Casamayor,A., Caudwell,F.B., Morrice,N.,
Norman,D.G., Gaffney,P., Reese,C.B., MacDougall,C.N., Harbison,D.,
Ashworth,A. and Bownes,M.
TITLE 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural
and functional homology with the Drosophila DSTPK61 kinase
JOURNAL Curr. Biol. 7 (10), 776-789 (1997)
PUBMED 9368760
REFERENCE 9 (bases 1 to 7243)
AUTHORS Moser,B.A., Dennis,P.B., Pullen,N., Pearson,R.B., Williamson,N.A.,
Wettenhall,R.E., Kozma,S.C. and Thomas,G.
TITLE Dual requirement for a newly identified phosphorylation site in
p70s6k
JOURNAL Mol. Cell. Biol. 17 (9), 5648-5655 (1997)
PUBMED 9271440
REFERENCE 10 (bases 1 to 7243)
AUTHORS Alessi,D.R., James,S.R., Downes,C.P., Holmes,A.B., Gaffney,P.R.,
Reese,C.B. and Cohen,P.
TITLE Characterization of a 3-phosphoinositide-dependent protein kinase
which phosphorylates and activates protein kinase Balpha
JOURNAL Curr. Biol. 7 (4), 261-269 (1997)
PUBMED 9094314
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC093525.3, BC012103.1 and AC141586.2.
On May 17, 2012 this sequence version replaced gi:60498971.
Transcript Variant: This variant (1) represents the longest
transcript and encodes the longest isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC012103.1, AK222581.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-40 AC093525.3 55237-55276 c
41-1964 BC012103.1 1-1924
1965-7243 AC141586.2 62525-67803 c
FEATURES Location/Qualifiers
source 1..7243
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="16"
/map="16p13.3"
gene 1..7243
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="3-phosphoinositide dependent protein kinase-1"
/db_xref="GeneID:5170"
/db_xref="HGNC:8816"
/db_xref="HPRD:05556"
/db_xref="MIM:605213"
exon 1..173
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 30
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="t"
/db_xref="dbSNP:191389305"
CDS 150..1820
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/EC_number="2.7.11.1"
/note="isoform 1 is encoded by transcript variant 1;
PkB-like 1; PkB kinase like gene 1"
/codon_start=1
/product="3-phosphoinositide-dependent protein kinase 1
isoform 1"
/protein_id="NP_002604.1"
/db_xref="GI:4505695"
/db_xref="CCDS:CCDS10472.1"
/db_xref="GeneID:5170"
/db_xref="HGNC:8816"
/db_xref="HPRD:05556"
/db_xref="MIM:605213"
/translation="
MARTTSQLYDAVPIQSSVVLCSCPSPSMVRTQTESSTPPGIPGGSRQGPAMDGTAAEPRPGAGSLQHAQPPPQPRKKRPEDFKFGKILGEGSFSTVVLARELATSREYAIKILEKRHIIKENKVPYVTRERDVMSRLDHPFFVKLYFTFQDDEKLYFGLSYAKNGELLKYIRKIGSFDETCTRFYTAEIVSALEYLHGKGIIHRDLKPENILLNEDMHIQITDFGTAKVLSPESKQARANSFVGTAQYVSPELLTEKSACKSSDLWALGCIIYQLVAGLPPFRAGNEYLIFQKIIKLEYDFPEKFFPKARDLVEKLLVLDATKRLGCEEMEGYGPLKAHPFFESVTWENLHQQTPPKLTAYLPAMSEDDEDCYGNYDNLLSQFGCMQVSSSSSSHSLSASDTGLPQRSGSNIEQYIHDLDSNSFELDLQFSEDEKRLLLEKQAGGNPWHQFVENNLILKMGPVDKRKGLFARRRQLLLTEGPHLYYVDPVNKVLKGEIPWSQELRPEAKNFKTFFVHTPNRTYYLMDPSGNAHKWCRKIQEVWRQRYQSHPDAAVQ
"
misc_feature 174..176
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by SRC and INSR; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 174..176
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 222..224
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O15530.1); phosphorylation site"
misc_feature 222..224
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 246..248
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05556"
misc_feature 387..1175
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="Catalytic domain of the Protein Serine/Threonine
Kinase, Phosphoinositide-dependent kinase 1; Region:
STKc_PDK1; cd05581"
/db_xref="CDD:173672"
misc_feature 393..1175
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(411..425,435..437,474..476,480..482,576..578,
624..629,633..635,645..647,651..653,762..764,768..770,
774..779,783..785,813..818,825..827,873..890,969..971,
987..989,996..998)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="active site"
/db_xref="CDD:173672"
misc_feature order(411..422,429..431,435..437,474..476,480..482,
537..539,576..578,624..635,642..647,774..779,783..785,
813..818)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173672"
misc_feature order(423..425,645..647,651..653,762..764,768..770,
774..776,825..827,873..890,969..971,987..989,996..998)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173672"
misc_feature order(813..845,864..890)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173672"
misc_feature 870..872
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 870..872
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05556"
misc_feature 870..872
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 870..872
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 882..884
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1209..1211
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by MELK; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1266..1268
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by SRC and INSR; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1266..1268
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 1275..1277
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by SRC and INSR; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1326..1328
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O15530.1); phosphorylation site"
misc_feature 1326..1328
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1329..1331
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MAP3K5; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1335..1337
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O15530.1); phosphorylation site"
misc_feature 1335..1337
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1341..1343
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MAP3K5; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1377..1379
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O15530.1); phosphorylation site"
misc_feature 1377..1379
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1518..1781
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="3-Phosphoinositide dependent protein kinase 1
(PDK1) pleckstrin homology (PH) domain; Region: PH_PDK1;
cd01262"
/db_xref="CDD:176338"
misc_feature order(1524..1547,1563..1586,1593..1613,1635..1652,
1656..1676,1686..1706,1713..1730,1740..1775)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="core domain; other site"
/db_xref="CDD:176338"
misc_feature order(1524..1526,1530..1532,1563..1565,1569..1571,
1575..1577)
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/note="putative phosphoinositide binding site [chemical
binding]; other site"
/db_xref="CDD:176338"
misc_feature 1602..1604
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 1686..1688
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
misc_feature 1686..1688
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05556"
exon 174..434
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 198
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="t"
/db_xref="dbSNP:76505791"
variation 200
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:61747742"
variation 200
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:200979773"
variation 247
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:61747743"
variation 271
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:55824600"
variation 362
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:79145795"
variation 380
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:372064092"
variation 410
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:758319"
variation 410
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:369990948"
variation 431
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:146388630"
exon 435..477
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 478..615
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 616..760
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 656
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:3743978"
variation 677
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:2041206"
variation 694
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:79495278"
variation 716
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056871"
variation 741
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:77608557"
variation 742
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:79032757"
exon 761..858
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 859..934
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 894
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:370069297"
variation 903
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:373278831"
variation 905
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:139543796"
variation 913
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:144186731"
variation 923
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:200735205"
exon 935..1003
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 1004..1100
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 1101..1274
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 1275..1492
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 1309
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:370279457"
variation 1319
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:377095764"
variation 1327
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:200076126"
variation 1342
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:370494924"
variation 1353
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:76887737"
variation 1354
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:75824263"
variation 1355
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:75077217"
variation 1357
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:139732994"
variation 1359
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:201780963"
variation 1381
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:149931764"
variation 1434
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:145034828"
variation 1448
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:145594574"
variation 1456
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:374111988"
variation 1467
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:142153837"
exon 1493..1550
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
variation 1509
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:374649760"
exon 1551..1703
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
exon 1704..7243
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/inference="alignment:Splign:1.39.8"
STS 1704..2563
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/standard_name="PDPK1_7852"
/db_xref="UniSTS:471709"
variation 1736
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:147843249"
variation 1742
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:141143951"
variation 1758
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:143425561"
variation 1786
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:148008907"
variation 1805
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:201375554"
variation 1808
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:201646295"
variation 1809
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:201983709"
variation 1821
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:141708903"
variation 1831
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:371050359"
variation 1835
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:375625632"
variation 1871
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:368140738"
variation 1872
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:111905533"
variation 1873
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:374100568"
variation 1928
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:10866"
variation 1965
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:3087784"
variation 2005
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:375635017"
variation 2096
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:148121766"
variation 2116
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:140982354"
variation 2122
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:13335284"
variation 2123
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:369818229"
variation 2126
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:374470586"
variation 2158
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:371038846"
variation 2229
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:189787811"
variation 2300..2301
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="cgggggccgcagctttgtgg"
/db_xref="dbSNP:374612917"
variation 2315
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:181078294"
variation 2325
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:113332295"
variation 2360
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:375417064"
variation 2447
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:185952911"
variation 2552
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:79745244"
variation 2608
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:138049982"
variation 2703
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:71386677"
variation 2707
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:142512073"
variation 2820
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:190327635"
variation 2865
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:78560075"
variation 2886
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:138756291"
variation 2970
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:76291069"
variation 2985
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:74003037"
variation 3028
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:144433575"
variation 3072
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:376035884"
variation 3092
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:148393103"
variation 3093
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:141692563"
variation 3108
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:147153606"
variation 3119
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:183283033"
variation 3206
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:28679688"
variation 3295..3297
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="tgc"
/db_xref="dbSNP:149315179"
variation 3461
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:370396602"
variation 3473
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:367998725"
variation 3526
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:373772013"
variation 3529
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:372067195"
variation 3627
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:4786296"
variation 3720
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:4786297"
variation 3774
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:147975625"
variation 3796..3810
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="gtcctgtgtctccat"
/db_xref="dbSNP:370970044"
variation 3798..3812
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="cctgtgtctccatgt"
/db_xref="dbSNP:11268185"
variation 3844
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:187363186"
variation 3856
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:28457160"
variation 3888
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:113716221"
variation 3919
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:190975527"
variation 4009
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:113054936"
variation 4040
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:3112701"
variation 4040
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:28615548"
variation 4068
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:372950862"
variation 4102..4108
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="cagcccc"
/db_xref="dbSNP:71148147"
variation 4130
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:149131034"
variation 4198
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:71386681"
variation 4198
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:78765961"
variation 4311..4312
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="a"
/db_xref="dbSNP:199508475"
variation 4322
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:2108863"
variation 4418
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:147659496"
STS 4743..4849
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/standard_name="D16S426E"
/db_xref="UniSTS:147333"
variation 5137
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:182763560"
variation 5247
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:187478880"
variation 5268
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:112319026"
variation 5271
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:191845035"
variation 5276
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:144753105"
variation 5329
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:182493826"
variation 5425
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:11554593"
variation 5489
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:112703875"
variation 5567
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:373860725"
variation 5661
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:367757589"
variation 5670
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:371321013"
variation 5682
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="g"
/replace="t"
/db_xref="dbSNP:368594243"
variation 5755..5760
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="gtgggg"
/db_xref="dbSNP:33994421"
variation 5860
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="c"
/db_xref="dbSNP:376887169"
variation 5866
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:56318884"
variation 5906
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:2335110"
variation 5986
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:187543589"
variation 6011
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:2335111"
variation 6013
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:137906061"
variation 6091..6092
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="cc"
/db_xref="dbSNP:71776175"
variation 6127
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:3095103"
variation 6151
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:369381082"
variation 6206
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:376666016"
variation 6225
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:185737005"
variation 6235
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="c"
/db_xref="dbSNP:190542981"
variation 6273..6274
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="a"
/db_xref="dbSNP:200815032"
variation 6303
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:200359888"
variation 6357
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/db_xref="dbSNP:368831914"
variation 6491
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:371727709"
variation 6492
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:929457"
variation 6528
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:201156361"
variation 6593
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:184540154"
variation 6594
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="t"
/db_xref="dbSNP:189062814"
variation 6652..6655
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="gtaa"
/db_xref="dbSNP:5815128"
variation 6655..6658
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="agta"
/db_xref="dbSNP:3030674"
variation 6729
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:375159135"
STS 6765..6929
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/standard_name="RH78462"
/db_xref="UniSTS:48236"
variation 6943..6944
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="tg"
/db_xref="dbSNP:201869822"
variation 7072
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:11554591"
variation 7141..7142
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="tt"
/db_xref="dbSNP:111618468"
variation 7142..7143
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="tt"
/db_xref="dbSNP:71726088"
variation 7143
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:11554592"
variation 7148
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:181213412"
variation 7152..7153
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace=""
/replace="tc"
/db_xref="dbSNP:201698119"
variation 7172
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="g"
/db_xref="dbSNP:185318792"
variation 7196
/gene="PDPK1"
/gene_synonym="PDK1; PDPK2; PRO0461"
/replace="a"
/replace="t"
/db_xref="dbSNP:189105574"
ORIGIN
gcggcgccgggggcggggggcggcgggcgacggggcgggcgcaggatgagggcggccattgctggggctccgcttcggggaggaggacgctgaggaggcgccgagccgcgcagcgctgcgggggaggcgcccgcgccgacgcggggcccatggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctcggcccggcgccggctccctgcagcatgcccagcctccgccgcagcctcggaagaagcggcctgaggacttcaagtttgggaaaatccttggggaaggctctttttccacggttgtcctggctcgagaactggcaacctccagagaatatgcgattaaaattctggagaagcgacatatcataaaagagaacaaggtcccctatgtaaccagagagcgggatgtcatgtcgcgcctggatcaccccttctttgttaagctttacttcacatttcaggacgacgagaagctgtatttcggccttagttatgccaaaaatggagaactacttaaatatattcgcaaaatcggttcattcgatgagacctgtacccgattttacacggctgagattgtgtctgctttagagtacttgcacggcaagggcatcattcacagggaccttaaaccggaaaacattttgttaaatgaagatatgcacatccagatcacagattttggaacagcaaaagtcttatccccagagagcaaacaagccagggccaactcattcgtgggaacagcgcagtacgtttctccagagctgctcacggagaagtccgcctgtaagagttcagacctttgggctcttggatgcataatataccagcttgtggcaggactcccaccattccgagctggaaacgagtatcttatatttcagaagatcattaagttggaatatgactttccagaaaaattcttccctaaggcaagagacctcgtggagaaacttttggttttagatgccacaaagcggttaggctgtgaggaaatggaaggatacggacctcttaaagcacacccgttcttcgagtccgtcacgtgggagaacctgcaccagcagacgcctccgaagctcaccgcttacctgccggctatgtcggaagacgacgaggactgctatggcaattatgacaatctcctgagccagtttggctgcatgcaggtgtcttcgtcctcctcctcacactccctgtcagcctccgacacgggcctgccccagaggtcaggcagcaacatagagcagtacattcacgatctggactcgaactcctttgaactggacttacagttttccgaagatgagaagaggttgttgttggagaagcaggctggcggaaacccttggcaccagtttgtagaaaataatttaatactaaagatgggcccagtggataagcggaagggtttatttgcaagacgacgacagctgttgctcacagaaggaccacatttatattatgtggatcctgtcaacaaagttctgaaaggtgaaattccttggtcacaagaacttcgaccagaggccaagaattttaaaactttctttgtccacacgcctaacaggacgtattatctgatggaccccagcgggaacgcacacaagtggtgcaggaagatccaggaggtttggaggcagcgataccagagccacccggacgccgctgtgcagtgacgtggcctgcggccgggctgcccttcgctgccaggacacctgccccagcgcggcttggccgccatccgggacgcttccagaccacctgccagccatcacaaggggaacgcagaggcggaaaccttgcagcatttttatttaaaagaaaagaagaaaaaaaacacccaaccacacaaagaacaaaaccagtaacaaacacaaaggaattcagggtcgctttgcttgctctctgtgctccgtggaggcctccgtgtgccctcgttgccgtggggacccagctccatgcacgtcaacccagtcccgcccagactagtggacagacctggtgtcaccagtttttcctagcatcagtccgaaccatgcgcccgccctgccccaactgtgtgctggtcctgctgtggccgaggggaccgggtgtgtttggctctttatgcccctcccgctgtggtcctggaactcttcaccagggagggagccctgcgggggccgcagctttgtggagggagccgccgtgcttctgtcacctgctccctttcttgcgtctccctgtgatgggcccttaggcctggctgggcccattacatatccctgtggtggctctggtggcagctttctgtggcccctgctgtgttggcaggcaggtttgcgtggtgaggagcgggaggggttggagtggtgcgggagcaggctgccgagtggagggtgccatcgagggctccggatcccttatcctacttagcagtgttggtctctggggctggaagccgagcgcatgctgggagcggtactgtcagaagtgagcccagttagtaccccgctggctcactgcacgagagagtcctgccccgagccctaggtggggccaggaggtgccttggagaagccagccagagcagagagggctgctgacttccgtgtggagcagagaggcctgagggcctcctaaaaggtttaaatgtccacgcctctccagttgctgaagtagggtctgagagaaccctggcatcagcagacccagggtgcttctgtctcctgcagaccacgccagggagtgcagacaccaccgtcacacacgccccttttgtgttttggttcaagtttctcagagcccctcagagcttctacatctgtgcatcagaaatctcacagccttctcatgctgccggctcatctgggcccatagagtgggctttgccagttgctgttgcacaggaggcgagaacagcacacttcaaccccagcttgctggtcggctttcctctagagagagccggttttggggccatttccctttgatgctttggtggccttgccccgctctgcagcacagacaggccagatgcatttgtcctttgcctagctactccccaggtagagagtgctcctggtggcctggcaggtctgggcccttctctccctgcccaggttgtccctggagggcagccctcactccctttgggggagaggcagacattgctgcccacagacctgcctctgactcaactgtgtccaccctccctggtccctacccccaagtcacaggtgactcagcagtgaccctgtgtgccaggccagatccaaactgagagggaaggtgtcgtttttacactgctaatgacgagagtggctctttttagctaggcgagtacagacggggcctgggagggggcagagatgttccccaggccctgcctgtggttcctgcctgggccttggctgctgctgtgtgagagctgcatgtgagcctgtgaccgtgagctggggtgagctgggccgcacctaccctggggccccagggagcaggacgctccggggcccagcacgttgccctgggcctgtggccggagtcggagtcctctctcctcctcctggcttttggaaaggcttggctgtgttggggagtctctcttagccctttcaggaatttctgttcaggcttcctcctcctcatcagctattttacccatctcagaacgtcctgtgtctccatgtaggagagtggctctctcagatctctcagggcgtctggttatagggaaacaagtggagcagggacgtggctttaattggagcactcggctgggctgcttggggagactcttccgtgcgttcttcctctggatagaaccaccacctcctgggcgtcactgacaagctccatcttaacctccaaagccacagaactaggggctcagagccagagctggcagccgccagccaaaatgatgccattgcctgagctgacagccaagcccttctgtgggtcacctttctcctcacccagccccttgctcttcccttttgaaaggcccgtgtgttttctttccttaccctgtgcttgctcatgtctactccggttttctctaccacatccttagagccatcacctggcacgcaggcgccttacattctacggtagaacgtggggtactgtgtgtgcacatagacacacttacgtggaattacagttgtgggtttatccaagatgaggaagatttcacctgctgtttaatagacttggggccatgtgcctccccacacatgggcaaggacaggtggaatgtcgggaccacactgtgcggcttctcggcacaaagcggagggaggctgtggtcgctgccggcctaggtgtcccaggtgccccgcctttctctgggacacagttgggggctggcttctgagggattcctttctcccctctttgtgtggccccagccagggcggtgggcagtcctggtgtagagcacaagcctctccaccctagagaaatgcctctgtaccacggctaccatgtggaaccttaacttgcagaaggcttgttaacaattgttttgagagagatggctggtcatgccacagctgctggggactccgcctactccagccctcttgggacacactgtgggatttgtggcccttccccagaggaattgtggagactgtcccatggaacaaaccctcaggcaccagcacagggctctgggtgactcagtaaaactaacgtttgtctctgacaagatcagctgtaggctcaccggccagagaagaccactgtgagcattttgccgtatatcctgccctgccatttgttcactttttaaactaaaataggaacatccgacacacaccgtttgcatcgtcttctcccttgatattttaagcattttcccatgtcatgagtttctcagaaacatgtttttaacaattgtactatttagtcattgtccatttactataatttatctgaccatttccctactgtaaaatacttaagacggtttctgatttttccactatttaaataatgctgtgatgaatatctttaaaatcttctgatttcttacttttttcccccttagatgcctggaagtggtattttgaggtgaaagagtttgttcattttgaagatatttctgtctctctctcgacctgatgtgtagacgctcacttccagtagcagaaccaccttagttgtgtcttacagattctgaacaaatcggtttctgataagccatgtgttccaaagaatgtctgaataagaccgctctttatttaaatgctaagaggatgtcactactgcaatccatctgtggccgattttttccaagagccaatttccttgttttggttgcaagaacctggctctgcctgcatgtcagctctctgccctccctgctgccgtggctttcaagcgcttggcagaatcttgtacttcgtgtccacaatggtactgaatttgcatctgcacagtcagcagagataacaagtgttgaactgaccttgccacatgcttagtgagtgatttgtaattaagtttatagactcagaaggtatattaggacatttggaatcagtagcagagcaaagcctctttgaaaaaaaccacgtagctgattgggttttacaagagtgcatttgtctcccccttccacccgtggggccccaccttcaggtcttagtggttcacaagagcccagcagccaggctggctttttcattgtagggcgtggttgtcccagctggtgtagatttcaggccgccccccccaactccctgcccacagtgttgcagattgcctggctggcagcaagtccagaccacccaaatttggttggattcttcatttctccactgtagttggggtccattgattgtgcaggggaacgtgcaggaggtttttctaggcaccgtgttcagtgctgcttcactctaccagagattatggccaaattgcacggaatttggtttcttgccctctgaagcctgagggcccccccttgcctggctggttgacagacccggggtggtcactgctgagacttcagagatcgcagctgctgtgagaatacggtgaaggtactttgttctggaagatgttgtcatacacttttccccagttattttcaaacttgacatgagcctatgttgactcactgggtgggggtcccttcttacgcagcacacgtggcaagtgcctgaatcggggctggaggcacttcagagcctctgaggggccaccacttctggcccaaaattgcagggttgtagatgaggctgcctgtggagaactggtgtgaggaggaagctgtttccaacaaagagcactttcatctgttgagatggctgtggtgagcaactgaacgagcctacgtgtgtacctgaattttccccgtaactcatttcttccatatgaagaaacaccaaactatgtacagagaactttttacaaaaggcagaccttttttaagctgtgtaacccacatagcctaaccacctggcagaatgactacgaataggggtcattgtgctggtaaaagcctctattacgactgtaagtaagttggatgttggcaaaattaaattgttacagtatttagagctgctgtagctgttccttcacaacataaaataggataaatgactagtacgtctttcaggtgggtggcaagcagaacatgcgtaatattctctacctggtctgtagctgtaactgtgatgtacagacaaagcaaaaattaaaagaacttatgaaaacaaatgcaatgatactaggatatacacttttgtatttttattcttatataaggttatttgctggctattgttggcctctagttcagtctgtgttatttaaattctaatatatgaattatttgaattgaattcatgttcggggccacgttgttgtatgtattgatgtacagccttgaatgtgaataattattgtaaactatattttacaactttttttctggctttattatataaattttctattgggtcagtgatttaatcatataatttaatgaatctgtttatcctttttttttttccaaatacttgtgctttaggtgtagttaccagatgatgaattttcctcgtatggtcagtagtcttgtaataaaaagcatgtagagtgtaga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:5170 -> Molecular function: GO:0004676 [3-phosphoinositide-dependent protein kinase activity] evidence: IDA
GeneID:5170 -> Molecular function: GO:0005158 [insulin receptor binding] evidence: IEA
GeneID:5170 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5170 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:5170 -> Molecular function: GO:0016301 [kinase activity] evidence: EXP
GeneID:5170 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IEA
GeneID:5170 -> Biological process: GO:0003323 [type B pancreatic cell development] evidence: IEA
GeneID:5170 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:5170 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:5170 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:5170 -> Biological process: GO:0006469 [negative regulation of protein kinase activity] evidence: IDA
GeneID:5170 -> Biological process: GO:0006972 [hyperosmotic response] evidence: IEA
GeneID:5170 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
GeneID:5170 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
GeneID:5170 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0010594 [regulation of endothelial cell migration] evidence: IEA
GeneID:5170 -> Biological process: GO:0010667 [negative regulation of cardiac muscle cell apoptotic process] evidence: IEA
GeneID:5170 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IDA
GeneID:5170 -> Biological process: GO:0030036 [actin cytoskeleton organization] evidence: TAS
GeneID:5170 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
GeneID:5170 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA
GeneID:5170 -> Biological process: GO:0031295 [T cell costimulation] evidence: TAS
GeneID:5170 -> Biological process: GO:0032148 [activation of protein kinase B activity] evidence: IDA
GeneID:5170 -> Biological process: GO:0032869 [cellular response to insulin stimulus] evidence: IMP
GeneID:5170 -> Biological process: GO:0034122 [negative regulation of toll-like receptor signaling pathway] evidence: IEA
GeneID:5170 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: IDA
GeneID:5170 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0043122 [regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP
GeneID:5170 -> Biological process: GO:0043304 [regulation of mast cell degranulation] evidence: IEA
GeneID:5170 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:5170 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: TAS
GeneID:5170 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: TAS
GeneID:5170 -> Biological process: GO:0048041 [focal adhesion assembly] evidence: IEA
GeneID:5170 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: TAS
GeneID:5170 -> Biological process: GO:0090004 [positive regulation of establishment of protein localization to plasma membrane] evidence: IMP
GeneID:5170 -> Biological process: GO:0097191 [extrinsic apoptotic signaling pathway] evidence: IMP
GeneID:5170 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5170 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:5170 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:5170 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5170 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:5170 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:5170 -> Cellular component: GO:0005925 [focal adhesion] evidence: IEA
GeneID:5170 -> Cellular component: GO:0016020 [membrane] evidence: IEA
GeneID:5170 -> Cellular component: GO:0016023 [cytoplasmic membrane-bounded vesicle] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_002604 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.