GGRNA Home | Help | Advanced search

2024-04-27 01:33:39, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002613               7243 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens 3-phosphoinositide dependent protein kinase-1 (PDPK1),
            transcript variant 1, mRNA.
ACCESSION   NM_002613 XM_001130789
VERSION     NM_002613.4  GI:387849236
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7243)
  AUTHORS   Eser,S., Reiff,N., Messer,M., Seidler,B., Gottschalk,K., Dobler,M.,
            Hieber,M., Arbeiter,A., Klein,S., Kong,B., Michalski,C.W.,
            Schlitter,A.M., Esposito,I., Kind,A.J., Rad,L., Schnieke,A.E.,
            Baccarini,M., Alessi,D.R., Rad,R., Schmid,R.M., Schneider,G. and
            Saur,D.
  TITLE     Selective requirement of PI3K/PDK1 signaling for Kras
            oncogene-driven pancreatic cell plasticity and cancer
  JOURNAL   Cancer Cell 23 (3), 406-420 (2013)
   PUBMED   23453624
  REMARK    GeneRIF: cell-autonomous phosphoinositide 3-kinase and
            3-phosphoinositide-dependent protein kinase 1 are key effectors of
            oncogenic Kras in the pancreas, mediating cell plasticity,
            acinar-to-ductal metaplasia, and pancreatic ductal adenocarcinoma
            formation
REFERENCE   2  (bases 1 to 7243)
  AUTHORS   Raimondi,C., Chikh,A., Wheeler,A.P., Maffucci,T. and Falasca,M.
  TITLE     A novel regulatory mechanism links PLCgamma1 to PDK1
  JOURNAL   J. Cell. Sci. 125 (PT 13), 3153-3163 (2012)
   PUBMED   22454520
  REMARK    GeneRIF: PDK1 and PLCgamma1 act on the same signalling cascade, and
            the PDK1/PLCgamma1 pathway is required for regulation of cell
            invasion.
REFERENCE   3  (bases 1 to 7243)
  AUTHORS   Kim,M.G., Moon,J.S., Kim,E.J., Lee,S.H. and Oh,J.W.
  TITLE     Destabilization of PDK1 by Hsp90 inactivation suppresses hepatitis
            C virus replication through inhibition of PRK2-mediated viral RNA
            polymerase phosphorylation
  JOURNAL   Biochem. Biophys. Res. Commun. 421 (1), 112-118 (2012)
   PUBMED   22490666
  REMARK    GeneRIF: these findings suggest that Hsp90 plays a critical role in
            the regulation of HCV RNA polymerase phosphorylation via the
            PDK1-PRK2 signaling pathway.
REFERENCE   4  (bases 1 to 7243)
  AUTHORS   Kikani,C.K., Verona,E.V., Ryu,J., Shen,Y., Ye,Q., Zheng,L.,
            Qian,Z., Sakaue,H., Nakamura,K., Du,J., Ji,Q., Ogawa,W., Sun,L.Z.,
            Dong,L.Q. and Liu,F.
  TITLE     Proliferative and antiapoptotic signaling stimulated by
            nuclear-localized PDK1 results in oncogenesis
  JOURNAL   Sci Signal 5 (249), RA80 (2012)
   PUBMED   23131847
  REMARK    GeneRIF: cytoplasmic localization of PDK1 correlated only with
            early-stage, low-risk tumors, whereas nuclear PDK1 localization
            correlated with high-risk tumors
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 7243)
  AUTHORS   Yu,J., Chen,K.S., Li,Y.N., Yang,J. and Zhao,L.
  TITLE     Silencing of PDK1 gene expression by RNA interference suppresses
            growth of esophageal cancer
  JOURNAL   Asian Pac. J. Cancer Prev. 13 (8), 4147-4151 (2012)
   PUBMED   23098536
  REMARK    GeneRIF: High 3-phosphoinositide-dependent protein kinase 1 is
            associated with esophageal cancer.
REFERENCE   6  (bases 1 to 7243)
  AUTHORS   Meier,R., Alessi,D.R., Cron,P., Andjelkovic,M. and Hemmings,B.A.
  TITLE     Mitogenic activation, phosphorylation, and nuclear translocation of
            protein kinase Bbeta
  JOURNAL   J. Biol. Chem. 272 (48), 30491-30497 (1997)
   PUBMED   9374542
REFERENCE   7  (bases 1 to 7243)
  AUTHORS   Shaw,M., Cohen,P. and Alessi,D.R.
  TITLE     Further evidence that the inhibition of glycogen synthase
            kinase-3beta by IGF-1 is mediated by PDK1/PKB-induced
            phosphorylation of Ser-9 and not by dephosphorylation of Tyr-216
  JOURNAL   FEBS Lett. 416 (3), 307-311 (1997)
   PUBMED   9373175
REFERENCE   8  (bases 1 to 7243)
  AUTHORS   Alessi,D.R., Deak,M., Casamayor,A., Caudwell,F.B., Morrice,N.,
            Norman,D.G., Gaffney,P., Reese,C.B., MacDougall,C.N., Harbison,D.,
            Ashworth,A. and Bownes,M.
  TITLE     3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural
            and functional homology with the Drosophila DSTPK61 kinase
  JOURNAL   Curr. Biol. 7 (10), 776-789 (1997)
   PUBMED   9368760
REFERENCE   9  (bases 1 to 7243)
  AUTHORS   Moser,B.A., Dennis,P.B., Pullen,N., Pearson,R.B., Williamson,N.A.,
            Wettenhall,R.E., Kozma,S.C. and Thomas,G.
  TITLE     Dual requirement for a newly identified phosphorylation site in
            p70s6k
  JOURNAL   Mol. Cell. Biol. 17 (9), 5648-5655 (1997)
   PUBMED   9271440
REFERENCE   10 (bases 1 to 7243)
  AUTHORS   Alessi,D.R., James,S.R., Downes,C.P., Holmes,A.B., Gaffney,P.R.,
            Reese,C.B. and Cohen,P.
  TITLE     Characterization of a 3-phosphoinositide-dependent protein kinase
            which phosphorylates and activates protein kinase Balpha
  JOURNAL   Curr. Biol. 7 (4), 261-269 (1997)
   PUBMED   9094314
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC093525.3, BC012103.1 and AC141586.2.
            On May 17, 2012 this sequence version replaced gi:60498971.
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC012103.1, AK222581.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025083, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-40                AC093525.3         55237-55276         c
            41-1964             BC012103.1         1-1924
            1965-7243           AC141586.2         62525-67803         c
FEATURES             Location/Qualifiers
     source          1..7243
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16p13.3"
     gene            1..7243
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="3-phosphoinositide dependent protein kinase-1"
                     /db_xref="GeneID:5170"
                     /db_xref="HGNC:8816"
                     /db_xref="HPRD:05556"
                     /db_xref="MIM:605213"
     exon            1..173
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       30
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191389305"
     CDS             150..1820
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /EC_number="2.7.11.1"
                     /note="isoform 1 is encoded by transcript variant 1;
                     PkB-like 1; PkB kinase like gene 1"
                     /codon_start=1
                     /product="3-phosphoinositide-dependent protein kinase 1
                     isoform 1"
                     /protein_id="NP_002604.1"
                     /db_xref="GI:4505695"
                     /db_xref="CCDS:CCDS10472.1"
                     /db_xref="GeneID:5170"
                     /db_xref="HGNC:8816"
                     /db_xref="HPRD:05556"
                     /db_xref="MIM:605213"
                     /translation="
MARTTSQLYDAVPIQSSVVLCSCPSPSMVRTQTESSTPPGIPGGSRQGPAMDGTAAEPRPGAGSLQHAQPPPQPRKKRPEDFKFGKILGEGSFSTVVLARELATSREYAIKILEKRHIIKENKVPYVTRERDVMSRLDHPFFVKLYFTFQDDEKLYFGLSYAKNGELLKYIRKIGSFDETCTRFYTAEIVSALEYLHGKGIIHRDLKPENILLNEDMHIQITDFGTAKVLSPESKQARANSFVGTAQYVSPELLTEKSACKSSDLWALGCIIYQLVAGLPPFRAGNEYLIFQKIIKLEYDFPEKFFPKARDLVEKLLVLDATKRLGCEEMEGYGPLKAHPFFESVTWENLHQQTPPKLTAYLPAMSEDDEDCYGNYDNLLSQFGCMQVSSSSSSHSLSASDTGLPQRSGSNIEQYIHDLDSNSFELDLQFSEDEKRLLLEKQAGGNPWHQFVENNLILKMGPVDKRKGLFARRRQLLLTEGPHLYYVDPVNKVLKGEIPWSQELRPEAKNFKTFFVHTPNRTYYLMDPSGNAHKWCRKIQEVWRQRYQSHPDAAVQ
"
     misc_feature    174..176
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by SRC and INSR; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    174..176
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01819"
     misc_feature    222..224
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O15530.1); phosphorylation site"
     misc_feature    222..224
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    246..248
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05556"
     misc_feature    387..1175
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="Catalytic domain of the Protein Serine/Threonine
                     Kinase, Phosphoinositide-dependent kinase 1; Region:
                     STKc_PDK1; cd05581"
                     /db_xref="CDD:173672"
     misc_feature    393..1175
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    order(411..425,435..437,474..476,480..482,576..578,
                     624..629,633..635,645..647,651..653,762..764,768..770,
                     774..779,783..785,813..818,825..827,873..890,969..971,
                     987..989,996..998)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="active site"
                     /db_xref="CDD:173672"
     misc_feature    order(411..422,429..431,435..437,474..476,480..482,
                     537..539,576..578,624..635,642..647,774..779,783..785,
                     813..818)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173672"
     misc_feature    order(423..425,645..647,651..653,762..764,768..770,
                     774..776,825..827,873..890,969..971,987..989,996..998)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173672"
     misc_feature    order(813..845,864..890)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173672"
     misc_feature    870..872
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    870..872
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05556"
     misc_feature    870..872
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    870..872
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    882..884
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1209..1211
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by MELK; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1266..1268
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by SRC and INSR; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1266..1268
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01819"
     misc_feature    1275..1277
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by SRC and INSR; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1326..1328
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O15530.1); phosphorylation site"
     misc_feature    1326..1328
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1329..1331
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by MAP3K5; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1335..1337
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O15530.1); phosphorylation site"
     misc_feature    1335..1337
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1341..1343
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by MAP3K5; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1377..1379
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O15530.1); phosphorylation site"
     misc_feature    1377..1379
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1518..1781
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="3-Phosphoinositide dependent protein kinase 1
                     (PDK1) pleckstrin homology (PH) domain; Region: PH_PDK1;
                     cd01262"
                     /db_xref="CDD:176338"
     misc_feature    order(1524..1547,1563..1586,1593..1613,1635..1652,
                     1656..1676,1686..1706,1713..1730,1740..1775)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="core domain; other site"
                     /db_xref="CDD:176338"
     misc_feature    order(1524..1526,1530..1532,1563..1565,1569..1571,
                     1575..1577)
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /note="putative phosphoinositide binding site [chemical
                     binding]; other site"
                     /db_xref="CDD:176338"
     misc_feature    1602..1604
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01819"
     misc_feature    1686..1688
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (O15530.1); phosphorylation site"
     misc_feature    1686..1688
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05556"
     exon            174..434
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       198
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76505791"
     variation       200
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61747742"
     variation       200
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200979773"
     variation       247
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61747743"
     variation       271
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55824600"
     variation       362
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79145795"
     variation       380
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372064092"
     variation       410
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758319"
     variation       410
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369990948"
     variation       431
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146388630"
     exon            435..477
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            478..615
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            616..760
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       656
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3743978"
     variation       677
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2041206"
     variation       694
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79495278"
     variation       716
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056871"
     variation       741
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77608557"
     variation       742
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79032757"
     exon            761..858
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            859..934
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       894
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370069297"
     variation       903
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373278831"
     variation       905
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139543796"
     variation       913
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144186731"
     variation       923
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200735205"
     exon            935..1003
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            1004..1100
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            1101..1274
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            1275..1492
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       1309
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370279457"
     variation       1319
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377095764"
     variation       1327
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200076126"
     variation       1342
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370494924"
     variation       1353
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76887737"
     variation       1354
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75824263"
     variation       1355
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75077217"
     variation       1357
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139732994"
     variation       1359
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201780963"
     variation       1381
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149931764"
     variation       1434
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145034828"
     variation       1448
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145594574"
     variation       1456
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374111988"
     variation       1467
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142153837"
     exon            1493..1550
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     variation       1509
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374649760"
     exon            1551..1703
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     exon            1704..7243
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /inference="alignment:Splign:1.39.8"
     STS             1704..2563
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /standard_name="PDPK1_7852"
                     /db_xref="UniSTS:471709"
     variation       1736
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147843249"
     variation       1742
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141143951"
     variation       1758
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143425561"
     variation       1786
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148008907"
     variation       1805
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201375554"
     variation       1808
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201646295"
     variation       1809
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201983709"
     variation       1821
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141708903"
     variation       1831
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371050359"
     variation       1835
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375625632"
     variation       1871
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368140738"
     variation       1872
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111905533"
     variation       1873
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374100568"
     variation       1928
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10866"
     variation       1965
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3087784"
     variation       2005
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375635017"
     variation       2096
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148121766"
     variation       2116
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140982354"
     variation       2122
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13335284"
     variation       2123
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369818229"
     variation       2126
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374470586"
     variation       2158
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371038846"
     variation       2229
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189787811"
     variation       2300..2301
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="cgggggccgcagctttgtgg"
                     /db_xref="dbSNP:374612917"
     variation       2315
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181078294"
     variation       2325
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113332295"
     variation       2360
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375417064"
     variation       2447
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185952911"
     variation       2552
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79745244"
     variation       2608
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138049982"
     variation       2703
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:71386677"
     variation       2707
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142512073"
     variation       2820
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190327635"
     variation       2865
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78560075"
     variation       2886
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138756291"
     variation       2970
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76291069"
     variation       2985
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74003037"
     variation       3028
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144433575"
     variation       3072
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376035884"
     variation       3092
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148393103"
     variation       3093
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141692563"
     variation       3108
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147153606"
     variation       3119
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183283033"
     variation       3206
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28679688"
     variation       3295..3297
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="tgc"
                     /db_xref="dbSNP:149315179"
     variation       3461
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370396602"
     variation       3473
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367998725"
     variation       3526
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373772013"
     variation       3529
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372067195"
     variation       3627
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4786296"
     variation       3720
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4786297"
     variation       3774
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147975625"
     variation       3796..3810
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="gtcctgtgtctccat"
                     /db_xref="dbSNP:370970044"
     variation       3798..3812
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="cctgtgtctccatgt"
                     /db_xref="dbSNP:11268185"
     variation       3844
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187363186"
     variation       3856
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:28457160"
     variation       3888
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113716221"
     variation       3919
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190975527"
     variation       4009
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113054936"
     variation       4040
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3112701"
     variation       4040
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28615548"
     variation       4068
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372950862"
     variation       4102..4108
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="cagcccc"
                     /db_xref="dbSNP:71148147"
     variation       4130
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149131034"
     variation       4198
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71386681"
     variation       4198
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78765961"
     variation       4311..4312
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:199508475"
     variation       4322
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2108863"
     variation       4418
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147659496"
     STS             4743..4849
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /standard_name="D16S426E"
                     /db_xref="UniSTS:147333"
     variation       5137
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182763560"
     variation       5247
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187478880"
     variation       5268
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112319026"
     variation       5271
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191845035"
     variation       5276
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144753105"
     variation       5329
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182493826"
     variation       5425
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11554593"
     variation       5489
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112703875"
     variation       5567
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373860725"
     variation       5661
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367757589"
     variation       5670
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371321013"
     variation       5682
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368594243"
     variation       5755..5760
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="gtgggg"
                     /db_xref="dbSNP:33994421"
     variation       5860
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:376887169"
     variation       5866
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56318884"
     variation       5906
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2335110"
     variation       5986
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187543589"
     variation       6011
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2335111"
     variation       6013
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137906061"
     variation       6091..6092
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:71776175"
     variation       6127
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3095103"
     variation       6151
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369381082"
     variation       6206
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376666016"
     variation       6225
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185737005"
     variation       6235
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190542981"
     variation       6273..6274
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200815032"
     variation       6303
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200359888"
     variation       6357
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368831914"
     variation       6491
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371727709"
     variation       6492
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929457"
     variation       6528
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201156361"
     variation       6593
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184540154"
     variation       6594
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189062814"
     variation       6652..6655
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="gtaa"
                     /db_xref="dbSNP:5815128"
     variation       6655..6658
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="agta"
                     /db_xref="dbSNP:3030674"
     variation       6729
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375159135"
     STS             6765..6929
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /standard_name="RH78462"
                     /db_xref="UniSTS:48236"
     variation       6943..6944
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:201869822"
     variation       7072
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11554591"
     variation       7141..7142
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:111618468"
     variation       7142..7143
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:71726088"
     variation       7143
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11554592"
     variation       7148
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181213412"
     variation       7152..7153
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:201698119"
     variation       7172
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185318792"
     variation       7196
                     /gene="PDPK1"
                     /gene_synonym="PDK1; PDPK2; PRO0461"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189105574"
ORIGIN      
gcggcgccgggggcggggggcggcgggcgacggggcgggcgcaggatgagggcggccattgctggggctccgcttcggggaggaggacgctgaggaggcgccgagccgcgcagcgctgcgggggaggcgcccgcgccgacgcggggcccatggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctcggcccggcgccggctccctgcagcatgcccagcctccgccgcagcctcggaagaagcggcctgaggacttcaagtttgggaaaatccttggggaaggctctttttccacggttgtcctggctcgagaactggcaacctccagagaatatgcgattaaaattctggagaagcgacatatcataaaagagaacaaggtcccctatgtaaccagagagcgggatgtcatgtcgcgcctggatcaccccttctttgttaagctttacttcacatttcaggacgacgagaagctgtatttcggccttagttatgccaaaaatggagaactacttaaatatattcgcaaaatcggttcattcgatgagacctgtacccgattttacacggctgagattgtgtctgctttagagtacttgcacggcaagggcatcattcacagggaccttaaaccggaaaacattttgttaaatgaagatatgcacatccagatcacagattttggaacagcaaaagtcttatccccagagagcaaacaagccagggccaactcattcgtgggaacagcgcagtacgtttctccagagctgctcacggagaagtccgcctgtaagagttcagacctttgggctcttggatgcataatataccagcttgtggcaggactcccaccattccgagctggaaacgagtatcttatatttcagaagatcattaagttggaatatgactttccagaaaaattcttccctaaggcaagagacctcgtggagaaacttttggttttagatgccacaaagcggttaggctgtgaggaaatggaaggatacggacctcttaaagcacacccgttcttcgagtccgtcacgtgggagaacctgcaccagcagacgcctccgaagctcaccgcttacctgccggctatgtcggaagacgacgaggactgctatggcaattatgacaatctcctgagccagtttggctgcatgcaggtgtcttcgtcctcctcctcacactccctgtcagcctccgacacgggcctgccccagaggtcaggcagcaacatagagcagtacattcacgatctggactcgaactcctttgaactggacttacagttttccgaagatgagaagaggttgttgttggagaagcaggctggcggaaacccttggcaccagtttgtagaaaataatttaatactaaagatgggcccagtggataagcggaagggtttatttgcaagacgacgacagctgttgctcacagaaggaccacatttatattatgtggatcctgtcaacaaagttctgaaaggtgaaattccttggtcacaagaacttcgaccagaggccaagaattttaaaactttctttgtccacacgcctaacaggacgtattatctgatggaccccagcgggaacgcacacaagtggtgcaggaagatccaggaggtttggaggcagcgataccagagccacccggacgccgctgtgcagtgacgtggcctgcggccgggctgcccttcgctgccaggacacctgccccagcgcggcttggccgccatccgggacgcttccagaccacctgccagccatcacaaggggaacgcagaggcggaaaccttgcagcatttttatttaaaagaaaagaagaaaaaaaacacccaaccacacaaagaacaaaaccagtaacaaacacaaaggaattcagggtcgctttgcttgctctctgtgctccgtggaggcctccgtgtgccctcgttgccgtggggacccagctccatgcacgtcaacccagtcccgcccagactagtggacagacctggtgtcaccagtttttcctagcatcagtccgaaccatgcgcccgccctgccccaactgtgtgctggtcctgctgtggccgaggggaccgggtgtgtttggctctttatgcccctcccgctgtggtcctggaactcttcaccagggagggagccctgcgggggccgcagctttgtggagggagccgccgtgcttctgtcacctgctccctttcttgcgtctccctgtgatgggcccttaggcctggctgggcccattacatatccctgtggtggctctggtggcagctttctgtggcccctgctgtgttggcaggcaggtttgcgtggtgaggagcgggaggggttggagtggtgcgggagcaggctgccgagtggagggtgccatcgagggctccggatcccttatcctacttagcagtgttggtctctggggctggaagccgagcgcatgctgggagcggtactgtcagaagtgagcccagttagtaccccgctggctcactgcacgagagagtcctgccccgagccctaggtggggccaggaggtgccttggagaagccagccagagcagagagggctgctgacttccgtgtggagcagagaggcctgagggcctcctaaaaggtttaaatgtccacgcctctccagttgctgaagtagggtctgagagaaccctggcatcagcagacccagggtgcttctgtctcctgcagaccacgccagggagtgcagacaccaccgtcacacacgccccttttgtgttttggttcaagtttctcagagcccctcagagcttctacatctgtgcatcagaaatctcacagccttctcatgctgccggctcatctgggcccatagagtgggctttgccagttgctgttgcacaggaggcgagaacagcacacttcaaccccagcttgctggtcggctttcctctagagagagccggttttggggccatttccctttgatgctttggtggccttgccccgctctgcagcacagacaggccagatgcatttgtcctttgcctagctactccccaggtagagagtgctcctggtggcctggcaggtctgggcccttctctccctgcccaggttgtccctggagggcagccctcactccctttgggggagaggcagacattgctgcccacagacctgcctctgactcaactgtgtccaccctccctggtccctacccccaagtcacaggtgactcagcagtgaccctgtgtgccaggccagatccaaactgagagggaaggtgtcgtttttacactgctaatgacgagagtggctctttttagctaggcgagtacagacggggcctgggagggggcagagatgttccccaggccctgcctgtggttcctgcctgggccttggctgctgctgtgtgagagctgcatgtgagcctgtgaccgtgagctggggtgagctgggccgcacctaccctggggccccagggagcaggacgctccggggcccagcacgttgccctgggcctgtggccggagtcggagtcctctctcctcctcctggcttttggaaaggcttggctgtgttggggagtctctcttagccctttcaggaatttctgttcaggcttcctcctcctcatcagctattttacccatctcagaacgtcctgtgtctccatgtaggagagtggctctctcagatctctcagggcgtctggttatagggaaacaagtggagcagggacgtggctttaattggagcactcggctgggctgcttggggagactcttccgtgcgttcttcctctggatagaaccaccacctcctgggcgtcactgacaagctccatcttaacctccaaagccacagaactaggggctcagagccagagctggcagccgccagccaaaatgatgccattgcctgagctgacagccaagcccttctgtgggtcacctttctcctcacccagccccttgctcttcccttttgaaaggcccgtgtgttttctttccttaccctgtgcttgctcatgtctactccggttttctctaccacatccttagagccatcacctggcacgcaggcgccttacattctacggtagaacgtggggtactgtgtgtgcacatagacacacttacgtggaattacagttgtgggtttatccaagatgaggaagatttcacctgctgtttaatagacttggggccatgtgcctccccacacatgggcaaggacaggtggaatgtcgggaccacactgtgcggcttctcggcacaaagcggagggaggctgtggtcgctgccggcctaggtgtcccaggtgccccgcctttctctgggacacagttgggggctggcttctgagggattcctttctcccctctttgtgtggccccagccagggcggtgggcagtcctggtgtagagcacaagcctctccaccctagagaaatgcctctgtaccacggctaccatgtggaaccttaacttgcagaaggcttgttaacaattgttttgagagagatggctggtcatgccacagctgctggggactccgcctactccagccctcttgggacacactgtgggatttgtggcccttccccagaggaattgtggagactgtcccatggaacaaaccctcaggcaccagcacagggctctgggtgactcagtaaaactaacgtttgtctctgacaagatcagctgtaggctcaccggccagagaagaccactgtgagcattttgccgtatatcctgccctgccatttgttcactttttaaactaaaataggaacatccgacacacaccgtttgcatcgtcttctcccttgatattttaagcattttcccatgtcatgagtttctcagaaacatgtttttaacaattgtactatttagtcattgtccatttactataatttatctgaccatttccctactgtaaaatacttaagacggtttctgatttttccactatttaaataatgctgtgatgaatatctttaaaatcttctgatttcttacttttttcccccttagatgcctggaagtggtattttgaggtgaaagagtttgttcattttgaagatatttctgtctctctctcgacctgatgtgtagacgctcacttccagtagcagaaccaccttagttgtgtcttacagattctgaacaaatcggtttctgataagccatgtgttccaaagaatgtctgaataagaccgctctttatttaaatgctaagaggatgtcactactgcaatccatctgtggccgattttttccaagagccaatttccttgttttggttgcaagaacctggctctgcctgcatgtcagctctctgccctccctgctgccgtggctttcaagcgcttggcagaatcttgtacttcgtgtccacaatggtactgaatttgcatctgcacagtcagcagagataacaagtgttgaactgaccttgccacatgcttagtgagtgatttgtaattaagtttatagactcagaaggtatattaggacatttggaatcagtagcagagcaaagcctctttgaaaaaaaccacgtagctgattgggttttacaagagtgcatttgtctcccccttccacccgtggggccccaccttcaggtcttagtggttcacaagagcccagcagccaggctggctttttcattgtagggcgtggttgtcccagctggtgtagatttcaggccgccccccccaactccctgcccacagtgttgcagattgcctggctggcagcaagtccagaccacccaaatttggttggattcttcatttctccactgtagttggggtccattgattgtgcaggggaacgtgcaggaggtttttctaggcaccgtgttcagtgctgcttcactctaccagagattatggccaaattgcacggaatttggtttcttgccctctgaagcctgagggcccccccttgcctggctggttgacagacccggggtggtcactgctgagacttcagagatcgcagctgctgtgagaatacggtgaaggtactttgttctggaagatgttgtcatacacttttccccagttattttcaaacttgacatgagcctatgttgactcactgggtgggggtcccttcttacgcagcacacgtggcaagtgcctgaatcggggctggaggcacttcagagcctctgaggggccaccacttctggcccaaaattgcagggttgtagatgaggctgcctgtggagaactggtgtgaggaggaagctgtttccaacaaagagcactttcatctgttgagatggctgtggtgagcaactgaacgagcctacgtgtgtacctgaattttccccgtaactcatttcttccatatgaagaaacaccaaactatgtacagagaactttttacaaaaggcagaccttttttaagctgtgtaacccacatagcctaaccacctggcagaatgactacgaataggggtcattgtgctggtaaaagcctctattacgactgtaagtaagttggatgttggcaaaattaaattgttacagtatttagagctgctgtagctgttccttcacaacataaaataggataaatgactagtacgtctttcaggtgggtggcaagcagaacatgcgtaatattctctacctggtctgtagctgtaactgtgatgtacagacaaagcaaaaattaaaagaacttatgaaaacaaatgcaatgatactaggatatacacttttgtatttttattcttatataaggttatttgctggctattgttggcctctagttcagtctgtgttatttaaattctaatatatgaattatttgaattgaattcatgttcggggccacgttgttgtatgtattgatgtacagccttgaatgtgaataattattgtaaactatattttacaactttttttctggctttattatataaattttctattgggtcagtgatttaatcatataatttaatgaatctgtttatcctttttttttttccaaatacttgtgctttaggtgtagttaccagatgatgaattttcctcgtatggtcagtagtcttgtaataaaaagcatgtagagtgtaga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
            GeneID:5170 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
            GeneID:5170 -> Molecular function: GO:0004676 [3-phosphoinositide-dependent protein kinase activity] evidence: IDA
            GeneID:5170 -> Molecular function: GO:0005158 [insulin receptor binding] evidence: IEA
            GeneID:5170 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:5170 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:5170 -> Molecular function: GO:0016301 [kinase activity] evidence: EXP
            GeneID:5170 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IEA
            GeneID:5170 -> Biological process: GO:0003323 [type B pancreatic cell development] evidence: IEA
            GeneID:5170 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:5170 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
            GeneID:5170 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
            GeneID:5170 -> Biological process: GO:0006469 [negative regulation of protein kinase activity] evidence: IDA
            GeneID:5170 -> Biological process: GO:0006972 [hyperosmotic response] evidence: IEA
            GeneID:5170 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:5170 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:5170 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0010594 [regulation of endothelial cell migration] evidence: IEA
            GeneID:5170 -> Biological process: GO:0010667 [negative regulation of cardiac muscle cell apoptotic process] evidence: IEA
            GeneID:5170 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IDA
            GeneID:5170 -> Biological process: GO:0030036 [actin cytoskeleton organization] evidence: TAS
            GeneID:5170 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:5170 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA
            GeneID:5170 -> Biological process: GO:0031295 [T cell costimulation] evidence: TAS
            GeneID:5170 -> Biological process: GO:0032148 [activation of protein kinase B activity] evidence: IDA
            GeneID:5170 -> Biological process: GO:0032869 [cellular response to insulin stimulus] evidence: IMP
            GeneID:5170 -> Biological process: GO:0034122 [negative regulation of toll-like receptor signaling pathway] evidence: IEA
            GeneID:5170 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: IDA
            GeneID:5170 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0043122 [regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP
            GeneID:5170 -> Biological process: GO:0043304 [regulation of mast cell degranulation] evidence: IEA
            GeneID:5170 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:5170 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: TAS
            GeneID:5170 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: TAS
            GeneID:5170 -> Biological process: GO:0048041 [focal adhesion assembly] evidence: IEA
            GeneID:5170 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: TAS
            GeneID:5170 -> Biological process: GO:0090004 [positive regulation of establishment of protein localization to plasma membrane] evidence: IMP
            GeneID:5170 -> Biological process: GO:0097191 [extrinsic apoptotic signaling pathway] evidence: IMP
            GeneID:5170 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:5170 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:5170 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:5170 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:5170 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:5170 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:5170 -> Cellular component: GO:0005925 [focal adhesion] evidence: IEA
            GeneID:5170 -> Cellular component: GO:0016020 [membrane] evidence: IEA
            GeneID:5170 -> Cellular component: GO:0016023 [cytoplasmic membrane-bounded vesicle] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_002604 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.