GGRNA Home | Help | Advanced search

2019-03-25 14:46:45, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002600               4264 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens phosphodiesterase 4B, cAMP-specific (PDE4B),
            transcript variant a, mRNA.
ACCESSION   NM_002600
VERSION     NM_002600.3  GI:82799480
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4264)
  AUTHORS   Yang,J.J., Cheng,C., Devidas,M., Cao,X., Campana,D., Yang,W.,
            Fan,Y., Neale,G., Cox,N., Scheet,P., Borowitz,M.J., Winick,N.J.,
            Martin,P.L., Bowman,W.P., Camitta,B., Reaman,G.H., Carroll,W.L.,
            Willman,C.L., Hunger,S.P., Evans,W.E., Pui,C.H., Loh,M. and
            Relling,M.V.
  TITLE     Genome-wide association study identifies germline polymorphisms
            associated with relapse of childhood acute lymphoblastic leukemia
  JOURNAL   Blood 120 (20), 4197-4204 (2012)
   PUBMED   23007406
REFERENCE   2  (bases 1 to 4264)
  AUTHORS   Lee,J., Komatsu,K., Lee,B.C., Lim,J.H., Jono,H., Xu,H., Kai,H.,
            Zhang,Z.J., Yan,C. and Li,J.D.
  TITLE     Phosphodiesterase 4B mediates extracellular signal-regulated
            kinase-dependent up-regulation of mucin MUC5AC protein by
            Streptococcus pneumoniae by inhibiting cAMP-protein kinase
            A-dependent MKP-1 phosphatase pathway
  JOURNAL   J. Biol. Chem. 287 (27), 22799-22811 (2012)
   PUBMED   22610099
  REMARK    GeneRIF: PDE4B mediates ERK-dependent up-regulation of mucin MUC5AC
            by S. pneumoniae by inhibiting cAMP-PKA-dependent MKP-1 pathway.
REFERENCE   3  (bases 1 to 4264)
  AUTHORS   Benjamin,D.J., Cesarini,D., van der Loos,M.J., Dawes,C.T.,
            Koellinger,P.D., Magnusson,P.K., Chabris,C.F., Conley,D.,
            Laibson,D., Johannesson,M. and Visscher,P.M.
  TITLE     The genetic architecture of economic and political preferences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (21), 8026-8031 (2012)
   PUBMED   22566634
REFERENCE   4  (bases 1 to 4264)
  AUTHORS   Kashiwagi,E., Shiota,M., Yokomizo,A., Itsumi,M., Inokuchi,J.,
            Uchiumi,T. and Naito,S.
  TITLE     Downregulation of phosphodiesterase 4B (PDE4B) activates protein
            kinase A and contributes to the progression of prostate cancer
  JOURNAL   Prostate 72 (7), 741-751 (2012)
   PUBMED   22529021
  REMARK    GeneRIF: PDE4B was downregulated and the protein kinase A pathway
            was activated in castration-resistant LNCaP prostate cancer cells.
            PDE4B expression was reduced in advanced prostate cancer and PDE4B
            knockdown promoted castration-resistant growth of LNCaP cells.
REFERENCE   5  (bases 1 to 4264)
  AUTHORS   Newburn,E.N., Hyde,T.M., Ye,T., Morita,Y., Weinberger,D.R.,
            Kleinman,J.E. and Lipska,B.K.
  TITLE     Interactions of human truncated DISC1 proteins: implications for
            schizophrenia
  JOURNAL   Transl Psychiatry 1, E30 (2011)
   PUBMED   22832604
  REMARK    GeneRIF: Short Disrupted-in-Schizophrenia (DISC)1 splice variants
            show reduced or no binding to nudE nuclear distribution E homolog
            (NDEL)1 and PDE4B proteins but fully interact with
            fasciculation/elongation zeta (FEZ)1 and glycogen synthase kinase 3
            GSK3beta.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4264)
  AUTHORS   Szpirer,C., Szpirer,J., Riviere,M., Swinnen,J., Vicini,E. and
            Conti,M.
  TITLE     Chromosomal localization of the human and rat genes (PDE4D and
            PDE4B) encoding the cAMP-specific phosphodiesterases 3 and 4
  JOURNAL   Cytogenet. Cell Genet. 69 (1-2), 11-14 (1995)
   PUBMED   7835077
REFERENCE   7  (bases 1 to 4264)
  AUTHORS   Bolger,G.B., Rodgers,L. and Riggs,M.
  TITLE     Differential CNS expression of alternative mRNA isoforms of the
            mammalian genes encoding cAMP-specific phosphodiesterases
  JOURNAL   Gene 149 (2), 237-244 (1994)
   PUBMED   7958996
REFERENCE   8  (bases 1 to 4264)
  AUTHORS   Bolger,G., Michaeli,T., Martins,T., St John,T., Steiner,B.,
            Rodgers,L., Riggs,M., Wigler,M. and Ferguson,K.
  TITLE     A family of human phosphodiesterases homologous to the dunce
            learning and memory gene product of Drosophila melanogaster are
            potential targets for antidepressant drugs
  JOURNAL   Mol. Cell. Biol. 13 (10), 6558-6571 (1993)
   PUBMED   8413254
REFERENCE   9  (bases 1 to 4264)
  AUTHORS   Obernolte,R., Bhakta,S., Alvarez,R., Bach,C., Zuppan,P.,
            Mulkins,M., Jarnagin,K. and Shelton,E.R.
  TITLE     The cDNA of a human lymphocyte cyclic-AMP phosphodiesterase (PDE
            IV) reveals a multigene family
  JOURNAL   Gene 129 (2), 239-247 (1993)
   PUBMED   8392015
REFERENCE   10 (bases 1 to 4264)
  AUTHORS   McLaughlin,M.M., Cieslinski,L.B., Burman,M., Torphy,T.J. and
            Livi,G.P.
  TITLE     A low-Km, rolipram-sensitive, cAMP-specific phosphodiesterase from
            human brain. Cloning and expression of cDNA, biochemical
            characterization of recombinant protein, and tissue distribution of
            mRNA
  JOURNAL   J. Biol. Chem. 268 (9), 6470-6476 (1993)
   PUBMED   8384210
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA126733.1, L20966.1,
            AA453531.1, AA206316.1, CN268011.1, BC046161.1 and AW519027.1.
            On Nov 30, 2005 this sequence version replaced gi:32171240.
            
            Summary: This gene is a member of the type IV, cyclic AMP
            (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family.
            Cyclic nucleotides are important second messengers that regulate
            and mediate a number of cellular responses to extracellular
            signals, such as hormones, light, and neurotransmitters. The cyclic
            nucleotide phosphodiesterases (PDEs) regulate the cellular
            concentrations of cyclic nucleotides and thereby play a role in
            signal transduction. This gene encodes a protein that specifically
            hydrolyzes cAMP. Altered activity of this protein has been
            associated with schizophrenia and bipolar affective disorder.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (a) encodes the longest isoform
            (1, also referred to as PDE4B1 or Tm72). Both variants a and d
            encode the same isoform.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK289969.1, L20966.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-8                 DA126733.1         1-8
            9-3183              L20966.1           1-3175
            3184-3553           AA453531.1         60-429
            3554-3830           AA206316.1         89-365
            3831-4102           CN268011.1         121-392
            4103-4253           BC046161.1         1196-1346
            4254-4264           AW519027.1         1-11                c
FEATURES             Location/Qualifiers
     source          1..4264
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p31"
     gene            1..4264
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="phosphodiesterase 4B, cAMP-specific"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="HPRD:02528"
                     /db_xref="MIM:600127"
     exon            1..76
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     exon            77..188
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       119
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12038009"
     misc_feature    120..122
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="upstream in-frame stop codon"
     variation       136
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138598652"
     variation       140
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368045878"
     CDS             147..2357
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /EC_number="3.1.4.17"
                     /note="isoform 1 is encoded by transcript variant a;
                     phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4
                     dunce homolog, Drosophila); dunce-like phosphodiesterase
                     E4; cAMP-specific 3',5'-cyclic phosphodiesterase 4B;
                     cAMP-specific phosphodiesterase-4 B isoform; PDE32"
                     /codon_start=1
                     /product="cAMP-specific 3',5'-cyclic phosphodiesterase 4B
                     isoform 1"
                     /protein_id="NP_002591.2"
                     /db_xref="GI:32171241"
                     /db_xref="CCDS:CCDS632.1"
                     /db_xref="GeneID:5142"
                     /db_xref="HGNC:8781"
                     /db_xref="HPRD:02528"
                     /db_xref="MIM:600127"
                     /translation="
MKKSRSVMTVMADDNVKDYFECSLSKSYSSSSNTLGIDLWRGRRCCSGNLQLPPLSQRQSERARTPEGDGISRPTTLPLTTLPSIAITTVSQECFDVENGPSPGRSPLDPQASSSAGLVLHATFPGHSQRRESFLYRSDSDYDLSPKAMSRNSSLPSEQHGDDLIVTPFAQVLASLRSVRNNFTILTNLHGTSNKRSPAASQPPVSRVNPQEESYQKLAMETLEELDWCLDQLETIQTYRSVSEMASNKFKRMLNRELTHLSEMSRSGNQVSEYISNTFLDKQNDVEIPSPTQKDREKKKKQQLMTQISGVKKLMHSSSLNNTSISRFGVNTENEDHLAKELEDLNKWGLNIFNVAGYSHNRPLTCIMYAIFQERDLLKTFRISSDTFITYMMTLEDHYHSDVAYHNSLHAADVAQSTHVLLSTPALDAVFTDLEILAAIFAAAIHDVDHPGVSNQFLINTNSELALMYNDESVLENHHLAVGFKLLQEEHCDIFMNLTKKQRQTLRKMVIDMVLATDMSKHMSLLADLKTMVETKKVTSSGVLLLDNYTDRIQVLRNMVHCADLSNPTKSLELYRQWTDRIMEEFFQQGDKERERGMEISPMCDKHTASVEKSQVGFIDYIVHPLWETWADLVQPDAQDILDTLEDNRNWYQSMIPQSPSPPLDEQNRDCQGLMEKFQFELTLDEEDSEGPEKEGEGHSYFSSTKTLCVIDPENRDSLGETDIDIATEDKSPVDT
"
     misc_feature    543..545
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03382"
     misc_feature    1359..1907
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Metal dependent phosphohydrolases with conserved
                     'HD' motif; Region: HDc; cd00077"
                     /db_xref="CDD:28958"
     misc_feature    order(1374..1376,1482..1487,1836..1838)
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Zn2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1485..1487
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28958"
     misc_feature    1845..1847
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Binds AMP, but not cAMP (By similarity); propagated
                     from UniProtKB/Swiss-Prot (Q07343.1); other site"
     misc_feature    2340..2342
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     variation       173
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200612585"
     variation       181
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12038033"
     variation       185
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144957956"
     exon            189..427
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       221
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138030327"
     variation       302
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79691733"
     variation       338
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147193846"
     variation       425
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367782903"
     exon            428..622
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       435
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374255487"
     variation       459
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367809652"
     variation       463
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145072153"
     variation       481
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75398902"
     variation       491
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143755153"
     variation       510
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375693073"
     variation       548
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201506484"
     variation       560
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141704617"
     variation       566
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139030347"
     variation       595
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370994595"
     variation       596
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143872916"
     variation       617
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115853607"
     exon            623..659
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       626
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372187760"
     variation       628
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374832183"
     exon            660..730
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       692
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369969167"
     exon            731..780
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       734
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192869700"
     exon            781..893
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       804
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371423323"
     variation       843
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116739380"
     variation       863
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140500253"
     exon            894..987
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       915
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376229903"
     variation       918
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145203756"
     variation       943
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199554373"
     variation       976
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371297521"
     exon            988..1166
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1029
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138828553"
     variation       1110
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369849443"
     variation       1113
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372730987"
     variation       1157
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188281"
     variation       1166
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143554413"
     exon            1167..1265
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1168
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141692815"
     STS             1261..1367
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="RH64524"
                     /db_xref="UniSTS:59487"
     exon            1266..1430
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1283
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138407878"
     variation       1332
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4322205"
     variation       1370
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166974"
     variation       1373
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115052833"
     variation       1376
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368002134"
     variation       1390
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371715752"
     variation       1403
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202021123"
     exon            1431..1530
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1451
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:783036"
     variation       1479
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185687552"
     variation       1497
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116379917"
     exon            1531..1685
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1538
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144798451"
     exon            1686..1808
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1750
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151031090"
     variation       1767
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34079300"
     variation       1786
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116816923"
     variation       1796
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373028719"
     variation       1800
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142379593"
     exon            1809..1991
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       1815
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370349934"
     variation       1816
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116312841"
     variation       1826
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34492439"
     variation       1841
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367550787"
     variation       1886
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141437989"
     variation       1892
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200251647"
     variation       1913
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41286714"
     variation       1926
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201667673"
     variation       1934
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114211692"
     variation       1943
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370428408"
     variation       1949
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373800241"
     exon            1992..4258
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /inference="alignment:Splign:1.39.8"
     variation       2057
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149054617"
     variation       2066
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41286716"
     variation       2072
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79722858"
     variation       2073
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114393853"
     variation       2090
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001333"
     variation       2101
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211480"
     variation       2112
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371876952"
     variation       2129
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201727510"
     variation       2141
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139374179"
     variation       2142
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149588422"
     variation       2143
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144568843"
     variation       2186
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3181494"
     variation       2187
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042020"
     variation       2190
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34469235"
     variation       2198
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373468487"
     variation       2212
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370754936"
     variation       2240
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372714875"
     variation       2247
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150977853"
     variation       2253
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2227297"
     variation       2254
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375941228"
     variation       2266
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185910614"
     variation       2287
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370636828"
     variation       2301
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200854845"
     variation       2310
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114387631"
     STS             2375..3259
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="PDE4B_372"
                     /db_xref="UniSTS:277574"
     variation       2378
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374227067"
     variation       2397
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115922110"
     variation       2504
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376708525"
     variation       2560
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57315098"
     variation       2596
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41286718"
     variation       2681
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371856307"
     variation       2729
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:783067"
     variation       2809
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138914808"
     variation       2824
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804141"
     variation       2897
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141470428"
     variation       3064
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:377201462"
     variation       3074
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181156834"
     variation       3087
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200935637"
     variation       3101
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78315788"
     variation       3321
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150394636"
     variation       3337
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4655837"
     variation       3380..3381
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaca"
                     /db_xref="dbSNP:199875231"
     variation       3401
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186227828"
     variation       3501
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190701813"
     STS             3559..3891
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="D1S2393"
                     /db_xref="UniSTS:66663"
     variation       3592
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371829302"
     variation       3637
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76335673"
     variation       3639
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112424842"
     variation       3653
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3176927"
     variation       3682
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138156061"
     variation       3724
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149577217"
     variation       3753
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144286936"
     variation       3777
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183451410"
     STS             3805..3905
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /standard_name="SGC30670"
                     /db_xref="UniSTS:79282"
     variation       3849
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186230480"
     variation       3865
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190745276"
     variation       3880
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377465393"
     variation       3888
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377626847"
     polyA_signal    3932..3937
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     variation       3954
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182887410"
     polyA_site      3966
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       3983
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374581239"
     variation       4100..4101
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tgggtt"
                     /db_xref="dbSNP:368800294"
     variation       4100
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="aaccca"
                     /db_xref="dbSNP:16354"
     variation       4101..4102
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="gg"
                     /replace="tgggtt"
                     /db_xref="dbSNP:71807410"
     variation       4102..4103
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:141736339"
     variation       4103..4104
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="ggtttg"
                     /db_xref="dbSNP:71682925"
     variation       4103
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368211356"
     variation       4104
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371168935"
     variation       4106
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374364770"
     variation       4155
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376802391"
     variation       4166
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138911836"
     variation       4177..4178
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
                     /replace=""
                     /replace="tat"
                     /db_xref="dbSNP:202242622"
     polyA_signal    4234..4239
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
     polyA_site      4258
                     /gene="PDE4B"
                     /gene_synonym="DPDE4; PDE4B5; PDEIVB"
ORIGIN      
agagcgctgcggccgcggcggtgcagcagaggcgcctcgggcaggaggagggcggcttctgcgagggcagcctgaggtattaaaaagtgtcagcaaactgcattgaataacagacatcctaagaggggatattttccacctctataatgaagaaaagcaggagtgtgatgacggtgatggctgatgataatgttaaagattattttgaatgtagcttgagtaaatcctacagttcttccagtaacacacttgggatcgacctctggagagggagaaggtgttgctcaggaaacttacagttaccaccactgtctcaaagacagagtgaaagggcaaggactcctgagggagatggtatttccaggccgaccacactgcctttgacaacgcttccaagcattgctattacaactgtaagccaggagtgctttgatgtggaaaatggcccttccccaggtcggagtccactggatccccaggccagctcttccgctgggctggtacttcacgccacctttcctgggcacagccagcgcagagagtcatttctctacagatcagacagcgactatgacttgtcaccaaaggcgatgtcgagaaactcttctcttccaagcgagcaacacggcgatgacttgattgtaactccttttgcccaggtccttgccagcttgcgaagtgtgagaaacaacttcactatactgacaaaccttcatggtacatctaacaagaggtccccagctgctagtcagcctcctgtctccagagtcaacccacaagaagaatcttatcaaaaattagcaatggaaacgctggaggaattagactggtgtttagaccagctagagaccatacagacctaccggtctgtcagtgagatggcttctaacaagttcaaaagaatgctgaaccgggagctgacacacctctcagagatgagccgatcagggaaccaggtgtctgaatacatttcaaatactttcttagacaagcagaatgatgtggagatcccatctcctacccagaaagacagggagaaaaagaaaaagcagcagctcatgacccagataagtggagtgaagaaattaatgcatagttcaagcctaaacaatacaagcatctcacgctttggagtcaacactgaaaatgaagatcacctggccaaggagctggaagacctgaacaaatggggtcttaacatctttaatgtggctggatattctcacaatagacccctaacatgcatcatgtatgctatattccaggaaagagacctcctaaagacattcagaatctcatctgacacatttataacctacatgatgactttagaagaccattaccattctgacgtggcatatcacaacagcctgcacgctgctgatgtagcccagtcgacccatgttctcctttctacaccagcattagacgctgtcttcacagatttggagatcctggctgccatttttgcagctgccatccatgacgttgatcatcctggagtctccaatcagtttctcatcaacacaaattcagaacttgctttgatgtataatgatgaatctgtgttggaaaatcatcaccttgctgtgggtttcaaactgctgcaagaagaacactgtgacatcttcatgaatctcaccaagaagcagcgtcagacactcaggaagatggttattgacatggtgttagcaactgatatgtctaaacatatgagcctgctggcagacctgaagacaatggtagaaacgaagaaagttacaagttcaggcgttcttctcctagacaactataccgatcgcattcaggtccttcgcaacatggtacactgtgcagacctgagcaaccccaccaagtccttggaattgtatcggcaatggacagaccgcatcatggaggaatttttccagcagggagacaaagagcgggagaggggaatggaaattagcccaatgtgtgataaacacacagcttctgtggaaaaatcccaggttggtttcatcgactacattgtccatccattgtgggagacatgggcagatttggtacagcctgatgctcaggacattctcgataccttagaagataacaggaactggtatcagagcatgatacctcaaagtccctcaccaccactggacgagcagaacagggactgccagggtctgatggagaagtttcagtttgaactgactctcgatgaggaagattctgaaggacctgagaaggagggagagggacacagctatttcagcagcacaaagacgctttgtgtgattgatccagaaaacagagattccctgggagagactgacatagacattgcaacagaagacaagtcccccgtggatacataatccccctctccctgtggagatgaacattctatccttgatgagcatgccagctatgtggtagggccagcccaccatgggggccaagacctgcacaggacaagggccacctggcctttcagttacttgagtttggagtcagaaagcaagaccaggaagcaaatagcagctcaggaaatcccacggttgacttgccttgatggcaagcttggtggagagggctgaagctgttgctgggggccgattctgatcaagacacatggcttgaaaatggaagacacaaaactgagagatcattctgcactaagtttcgggaacttatccccgacagtgactgaactcactgactaataacttcatttatgaatcttctcacttgtccctttgtctgccaacctgtgtgccttttttgtaaaacattttcatgtctttaaaatgcctgttgaatacctggagtttagtatcaacttctacacagataagctttcaaagttgacaaacttttttgactctttctggaaaagggaaagaaaatagtcttccttctttcttgggcaatatccttcactttactacagttacttttgcaaacagacagaaaggatacacttctaaccacattttacttccttcccctgttgtccagtccaactccacagtcactcttaaaacttctctctgtttgcctgcctccaacagtacttttaactttttgctgtaaacagaataaaattgaacaaattagggggtagaaaggagcagtggtgtcgttcaccgtgagagtctgcatagaactcagcagtgtgccctgctgtgtcttggaccctgccccccacaggagttgtacagtccctggccctgttccctacctcctctcttcaccccgttaggctgttttcaatgtaatgctgccgtccttctcttgcactgccttctgcgctaacacctccattcctgtttataaccgtgtatttattacttaatgtatataatgtaatgttttgtaagttattaatttatatatctaacattgcctgccaatggtggtgttaaatttgtgtagaaaactctgcctaagagttacgactttttcttgtaatgttttgtattgtgtattatataacccaaacgtcacttagtagagacatatggcccccttggcagagaggacaggggtgggcttttgttcaaagggtctgccctttccctgcctgagttgctacttctgcacaacccctttatgaaccagttttggaaacaatattctcacattagatactaaatggtttatactgagcttttacttttgtatagcttgataggggcagggggcaatgggatgtagtttttacccaggttctatccaaatctatgtgggcatgagttgggttataactggatcctactatcattgtggctttggttcaaaaggaaacactacatttgctcacagatgattcttctgaatgctcccgaactactgactttgaagaggtagcctcctgcctgccattaagcaggaatgtcatgttccagttcattacaaaagaaaacaataaaacaatgtgaatttttataataaaatgtgaactgatgtagcaaattacgcaaatgtgaagcctcttctgataacacttgttaggcctcttactgatgtcagtttcagtttgtaaaatatgtttcatgctttcagttcagcattgtgactcagtaattacagaaaatggcacaaatgtgcatgaccaatgtatgtctatgaacactgcattgtttcaggtggacattttatcattttcaaatgtttctcacaatgtatgttatagtattattattatatattgtgttcaaatgcattctaaagagacttttatatgaggtgaataaagaaaagcatgattagattaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5142 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IDA
            GeneID:5142 -> Molecular function: GO:0004115 [3',5'-cyclic-AMP phosphodiesterase activity] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0030552 [cAMP binding] evidence: IGI
            GeneID:5142 -> Molecular function: GO:0044325 [ion channel binding] evidence: ISS
            GeneID:5142 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:5142 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IDA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
            GeneID:5142 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IGI
            GeneID:5142 -> Biological process: GO:0030593 [neutrophil chemotaxis] evidence: ISS
            GeneID:5142 -> Biological process: GO:0032729 [positive regulation of interferon-gamma production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0032743 [positive regulation of interleukin-2 production] evidence: IMP
            GeneID:5142 -> Biological process: GO:0035690 [cellular response to drug] evidence: ISS
            GeneID:5142 -> Biological process: GO:0050852 [T cell receptor signaling pathway] evidence: IMP
            GeneID:5142 -> Biological process: GO:0050900 [leukocyte migration] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: ISS
            GeneID:5142 -> Biological process: GO:0071872 [cellular response to epinephrine stimulus] evidence: ISS
            GeneID:5142 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901841 [regulation of high voltage-gated calcium channel activity] evidence: ISS
            GeneID:5142 -> Biological process: GO:1901898 [negative regulation of relaxation of cardiac muscle] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:5142 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:5142 -> Cellular component: GO:0005891 [voltage-gated calcium channel complex] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0030018 [Z disc] evidence: ISS
            GeneID:5142 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_002591 -> EC 3.1.4.17

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.