GGRNA Home | Help | Advanced search

2020-10-26 19:30:47, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002501               5576 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens nuclear factor I/X (CCAAT-binding transcription
            factor) (NFIX), transcript variant 2, mRNA.
ACCESSION   NM_002501
VERSION     NM_002501.2  GI:56549648
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5576)
  AUTHORS   Lee,H.J., Woo,H.G., Greenwood,T.A., Kripke,D.F. and Kelsoe,J.R.
  TITLE     A genome-wide association study of seasonal pattern mania
            identifies NF1A as a possible susceptibility gene for bipolar
            disorder
  JOURNAL   J Affect Disord 145 (2), 200-207 (2013)
   PUBMED   22925353
REFERENCE   2  (bases 1 to 5576)
  AUTHORS   Yoneda,Y., Saitsu,H., Touyama,M., Makita,Y., Miyamoto,A.,
            Hamada,K., Kurotaki,N., Tomita,H., Nishiyama,K., Tsurusaki,Y.,
            Doi,H., Miyake,N., Ogata,K., Naritomi,K. and Matsumoto,N.
  TITLE     Missense mutations in the DNA-binding/dimerization domain of NFIX
            cause Sotos-like features
  JOURNAL   J. Hum. Genet. 57 (3), 207-211 (2012)
   PUBMED   22301465
  REMARK    GeneRIF: missense mutations in NFIX were able to cause Sotos-like
            features.
REFERENCE   3  (bases 1 to 5576)
  AUTHORS   Lee,H., Jaffe,A.E., Feinberg,J.I., Tryggvadottir,R., Brown,S.,
            Montano,C., Aryee,M.J., Irizarry,R.A., Herbstman,J., Witter,F.R.,
            Goldman,L.R., Feinberg,A.P. and Fallin,M.D.
  TITLE     DNA methylation shows genome-wide association of NFIX, RAPGEF2 and
            MSRB3 with gestational age at birth
  JOURNAL   Int J Epidemiol 41 (1), 188-199 (2012)
   PUBMED   22422452
  REMARK    GeneRIF: DNA methylation shows genome-wide association of NFIX,
            RAPGEF2 and MSRB3 with gestational age at birth.
REFERENCE   4  (bases 1 to 5576)
  AUTHORS   Singh,S.K., Bhardwaj,R., Wilczynska,K.M., Dumur,C.I. and Kordula,T.
  TITLE     A complex of nuclear factor I-X3 and STAT3 regulates astrocyte and
            glioma migration through the secreted glycoprotein YKL-40
  JOURNAL   J. Biol. Chem. 286 (46), 39893-39903 (2011)
   PUBMED   21953450
  REMARK    GeneRIF: NFI-X3 and STAT3 control the migration of differentiating
            astrocytes as well as migration and invasion of glioma cells via
            regulating YKL-40 expression.
REFERENCE   5  (bases 1 to 5576)
  AUTHORS   Singh,S.K., Wilczynska,K.M., Grzybowski,A., Yester,J., Osrah,B.,
            Bryan,L., Wright,S., Griswold-Prenner,I. and Kordula,T.
  TITLE     The unique transcriptional activation domain of nuclear factor-I-X3
            is critical to specifically induce marker gene expression in
            astrocytes
  JOURNAL   J. Biol. Chem. 286 (9), 7315-7326 (2011)
   PUBMED   21189253
  REMARK    GeneRIF: NFI-X3 activates GFAP expression, in part, by inducing
            alterations in the nucleosome architecture that lead to the
            increased recruitment of RNA polymerase II
REFERENCE   6  (bases 1 to 5576)
  AUTHORS   Wendler,W.M., Kremmer,E., Forster,R. and Winnacker,E.L.
  TITLE     Identification of pirin, a novel highly conserved nuclear protein
  JOURNAL   J. Biol. Chem. 272 (13), 8482-8489 (1997)
   PUBMED   9079676
REFERENCE   7  (bases 1 to 5576)
  AUTHORS   Sumner,C., Shinohara,T., Durham,L., Traub,R., Major,E.O. and
            Amemiya,K.
  TITLE     Expression of multiple classes of the nuclear factor-1 family in
            the developing human brain: differential expression of two classes
            of NF-1 genes
  JOURNAL   J. Neurovirol. 2 (2), 87-100 (1996)
   PUBMED   8799200
REFERENCE   8  (bases 1 to 5576)
  AUTHORS   Qian,F., Kruse,U., Lichter,P. and Sippel,A.E.
  TITLE     Chromosomal localization of the four genes (NFIA, B, C, and X) for
            the human transcription factor nuclear factor I by FISH
  JOURNAL   Genomics 28 (1), 66-73 (1995)
   PUBMED   7590749
REFERENCE   9  (bases 1 to 5576)
  AUTHORS   Apt,D., Liu,Y. and Bernard,H.U.
  TITLE     Cloning and functional analysis of spliced isoforms of human
            nuclear factor I-X: interference with transcriptional activation by
            NFI/CTF in a cell-type specific manner
  JOURNAL   Nucleic Acids Res. 22 (19), 3825-3833 (1994)
   PUBMED   7937100
REFERENCE   10 (bases 1 to 5576)
  AUTHORS   Seisenberger,C., Winnacker,E.L. and Scherthan,H.
  TITLE     Localisation of the human nuclear factor I/X (NFI/X) gene to
            chromosome 19p13 and detection of five other related loci at
            1p21-22, 1q42-43, 5q15, 11p13 and 20q13 by FISH
  JOURNAL   Hum. Genet. 91 (6), 535-537 (1993)
   PUBMED   8340106
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BF115883.1, U18759.1 and
            AC007787.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 10, 2004 this sequence version replaced gi:4505380.
            
            Summary: The protein encoded by this gene is a transcription factor
            that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral
            and cellular promoters. The encoded protein can also stimulate
            adenovirus replication in vitro. Three transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Aug 2012].
            
            Transcript Variant: This variant (2) differs in the 5' UTR and
            coding sequence and lacks an alternate 3' exon compared to variant
            1, that causes a frameshift. The resulting isoform (2) has shorter
            and distinct N- and C-termini compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns ERS025081,
                              ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-493               BF115883.1         1-493
            494-1491            U18759.1           443-1440
            1492-5576           AC007787.1         32308-36392
FEATURES             Location/Qualifiers
     source          1..5576
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.3"
     gene            1..5576
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="nuclear factor I/X (CCAAT-binding transcription
                     factor)"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
     exon            1..95
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     CDS             69..1394
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="isoform 2 is encoded by transcript variant 2;
                     nuclear factor 1 X-type; CTF; NF1-X; NF-I/X; nuclear
                     factor 1/X; TGGCA-binding protein; CCAAT-box-binding
                     transcription factor"
                     /codon_start=1
                     /product="nuclear factor 1 X-type isoform 2"
                     /protein_id="NP_002492.2"
                     /db_xref="GI:56549649"
                     /db_xref="CCDS:CCDS45996.1"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
                     /translation="
MYSPYCLTQDEFHPFIEALLPHVRAFSYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKPEIKQKWASRLLAKLRKDIRPEFREDFVLTITGKKPPCCVLSNPDQKGKIRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLYKSPQCSNPGLCVQPHHIGVTIKELDLYLAYFVHTPESGQSDSSNQQGDADIKPLPNGHLSFQDCFVTSGVWNVTELVRVSQTPVATASGPNFSLADLESPSYYNINQVTLGRRSITSPPSTSTTKRPKSIDDSEMESPVDDVFYPGTGRSPAAGSSQSSGWPNDVDAGPASLKKSGKLDFCSALSSQGSSPRMAFTHHPLPVLAGVRPGSPRATASALHFPSTSIIQQSSPYFTHPTIRYHHHHGQDSLKEFVQFVCSDGSGQATGQHSQRQAPPLPTGLSASDPGTATF
"
     misc_feature    75..206
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="Nuclear factor I protein pre-N-terminus; Region:
                     NfI_DNAbd_pre-N; pfam10524"
                     /db_xref="CDD:151076"
     misc_feature    270..578
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="N-terminal Mad Homology 1 (MH1) domain; Region:
                     MH1; cl00055"
                     /db_xref="CDD:241576"
     misc_feature    705..>1376
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="CTF/NF-I family transcription modulation region;
                     Region: CTF_NFI; pfam00859"
                     /db_xref="CDD:144451"
     misc_feature    906..908
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q14938.2); phosphorylation site"
     exon            96..627
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       140
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368774795"
     variation       185
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148229471"
     variation       201
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:5827175"
     variation       209
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375719449"
     variation       221
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150443437"
     variation       247
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907254"
     variation       251
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369196245"
     STS             267..511
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="NFIX"
                     /db_xref="UniSTS:504112"
     variation       326
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375310739"
     variation       332
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373938156"
     variation       377
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376885081"
     variation       378
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370482598"
     variation       428
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369056833"
     variation       430
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:387907255"
     variation       450..451
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gggggg"
                     /db_xref="dbSNP:149894387"
     variation       457
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200603126"
     variation       461
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200313486"
     variation       536
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199762875"
     STS             558..1407
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="Nfix"
                     /db_xref="UniSTS:507089"
     variation       624
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372477615"
     exon            628..690
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       636
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907253"
     variation       668
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367591626"
     exon            691..765
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     exon            766..886
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       809
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201664313"
     variation       854
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199590032"
     variation       881
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369151512"
     exon            887..1023
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       911
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201741871"
     variation       919
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113721268"
     variation       923
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047135"
     variation       967
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374776005"
     variation       1001
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199631786"
     variation       1010
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372881529"
     exon            1024..1146
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1091
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373603800"
     variation       1092
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61754992"
     exon            1147..1322
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1208
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201174259"
     variation       1295
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374101865"
     variation       1304
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367955217"
     variation       1316
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372077833"
     exon            1323..1414
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1328
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372257657"
     variation       1369
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200499751"
     variation       1382
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287066"
     exon            1415..5576
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1502
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047144"
     variation       1587..1588
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34095276"
     STS             1620..1740
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH91530"
                     /db_xref="UniSTS:86722"
     variation       1668
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375166012"
     variation       1686
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144975330"
     variation       1707
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183935392"
     STS             1714..1921
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH18298"
                     /db_xref="UniSTS:30706"
     variation       1761
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112643821"
     variation       1988
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10416646"
     variation       2078
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57359947"
     variation       2149
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375305695"
     variation       2181
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80090842"
     variation       2281..2300
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gagggcctccttcctgccac"
                     /db_xref="dbSNP:375140220"
     variation       2294
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369047813"
     variation       2454
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145814634"
     variation       2569..2570
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34337363"
     variation       2573..2574
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:5827180"
     variation       2617
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77607471"
     variation       2676
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113027509"
     variation       2677
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111560188"
     variation       2749
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188413501"
     variation       2780
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181608618"
     variation       2842
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372616189"
     variation       2846..2847
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201158408"
     variation       2847
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35992708"
     variation       2991
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148149655"
     variation       2992..2995
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="tctc"
                     /db_xref="dbSNP:199726177"
     variation       2993..2996
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="ctct"
                     /db_xref="dbSNP:377649271"
     variation       3112
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555273"
     variation       3138
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367898239"
     variation       3148
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113396930"
     variation       3159
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184187752"
     variation       3197
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61270571"
     variation       3247
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369984914"
     variation       3250
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555274"
     variation       3363
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376300898"
     variation       3672
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:71798576"
     variation       3731
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:112879585"
     variation       3736..3737
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:71841362"
     variation       3839..3840
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:142626844"
     variation       3948
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190683071"
     variation       3968..3969
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71719751"
     variation       3968
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:112478002"
     variation       4038
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182072517"
     polyA_signal    4255..4260
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      4286
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     variation       4431
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150757731"
     variation       4503
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117198656"
     variation       4643
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75550675"
     variation       4703
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:10419483"
     variation       4749
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137978145"
     variation       5122
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186285075"
     variation       5129..5130
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34291647"
     variation       5387
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112707286"
     polyA_signal    5548..5553
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_signal    5556..5561
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      5576
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
ORIGIN      
gcggccgccgcctgccgggcctcccctcgccgcggccggccgccgcgctcccgcccgggcgcccagctatgtactccccgtactgcctcacccaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagctgctgggcgagaagcccgagatcaagcagaagtgggcatcccggctgctggccaagctgcgcaaggacatccggcccgagttccgcgaggacttcgtgctgaccatcacgggcaagaagcccccctgctgcgtgctctccaaccccgaccagaagggcaagatccggcggattgactgcctgcgccaggctgacaaggtgtggcggctggacctggtcatggtgattttgtttaaggggatccccctggaaagtactgatggggagcggctctacaagtcgcctcagtgctcgaaccccggcctgtgcgtccagccacatcacattggagtcacaatcaaagaactggatctttatctggcttactttgtccacactccggaatccggacaatcagatagttcaaaccagcaaggagatgcggacatcaaaccactgcccaacgggcacttaagtttccaggactgttttgtgacttccggggtctggaatgtgacggagctggtgagagtatcacagactcctgttgcaacagcatcagggcccaacttctccctggcggacctggagagtcccagctactacaacatcaaccaggtgaccctggggcggcggtccatcacctcccctccttccaccagcaccaccaagcgccccaagtccatcgatgacagtgagatggagagccctgttgatgacgtgttctatcccgggacaggccgttccccagcagctggcagcagccagtccagcgggtggcccaacgatgtggatgcaggcccggcttctctaaagaagtcaggaaagctggacttctgcagtgccctctcctctcagggcagctccccgcgcatggctttcacccaccacccgctgcctgtgcttgctggagtcagaccagggagcccccgggccacagcatcagccctgcacttcccctccacgtccatcatccagcagtcgagcccgtatttcacgcacccgaccatccgctaccaccaccaccacgggcaggactcactgaaggagtttgtgcagtttgtgtgctcggatggctcgggccaggccaccggacagcattcgcaacgacaggcgcctcctctgccaaccggtttgtcagcatcggaccccgggacggcaactttctgaacatcccacagcagtctcagtcctggttcctctgataagatcgacaaaagaaacaacaaaatgagaagaagaggttcctcgaaaggggggagaagaaattttgagaatggaaaaatcccccagcccagcccagccccaccgaaaagcaaaaattacacgtcgtcagccactcagcccttctctcctccagcccggggacccccgcgggccccagaagcagcccagttctcagagagcccttggaaggggtctcggtggagctgtgcaccagcagccaagcagaaagaaacacgcgacatggactctgtcaagtagaggacagaaagcaagaaaggatgcagaactgccttcctccccctgaccccgccccggccttctggggaaggaacaaagtccccaaacaaagcaaccagcacaattctgaaggggcctggcctccaccctcaccccttcctaggggaaccccaccctccacacagccggagctgccctagggagcctggagggccagcttgtaaagatgatggggtttagatccctcaggctctcccctccagactccgcccttccctccctccctccctccctccctctctgccaaggctccagcttcttcccccagctgctcccgaccaggagggggagagcagcctccacttaccccaccccacccttgggctaaaagcccccaggcgggcagggggtgacccctggagctagttgcgtgtcccagaatggagggtgttctgacaccccaccctgagccgcaagagcagtcctggggccctggacccctctgtacagtccgtaggaaaaagtcggaatgctctcgacggcctcgtcccagcctgggacaggccccctttcccctctctctgcaggccaggagggcctccttcctgccacgagggaggggagtcgggccccaggtcgcccccgcccccagccctgcatgcaggtgccctcgctccgccccatcagttcctgcccctgcccctcatgcagactgccctgctggggccgggccggagggtggagcagaaaggggaccccggagccgagcgaggaggaccaggcagccgccgctgccgcgctaagccaccacctgcgcttaggtaggcgtcctgctcgccgactttcagttccttgggagggtgttgggtgtcgtccttttcaaaagtgttttggagctttctgtgccccccgactttcccccgcctccccgccccccacgtggccacttttctctggattttagctgtaatgtctttactctttatttaggggtggggcattcattgtttgggtcttttgctgttggaatgggaactcctcctccatttgagcaacttgggaacaatttggtaacacaccacaggaagtagctctcccccccagccccctcctccctcaagggagggttggggggcctgtccagagggtcttcagaagcccccctgggagggaggggaggatgagcacgcccagctcccctccagggtgtgacttggcccctctggcttgtctttctgtgccttactcctcctcctgcgtctcccgttcctggccccttcttgagtccttgtgcctctctctttctctctctttcttaattgtatgaaaacacaaagcacaggtcaggatcctctgagagaaaatcaacattgcaccacgtaggggtgggctatgggctgtatttattgtgaatctagtttgtgaggctgtggccccgagctggcggagggagggaagaggagggagtgacgggaggggaggaggtcagcgacctggggccgtagcggcaggcgaacggtgcctgctacccagctggaagccacaaggtggctggctccaggggcggcttttgttggaagttgagtgaagccctccccctgtcctcagcgtgcagccctagaggaccccagggctgaggggcagtggatcctgcgggagtctcccggggcgtggggagtaaggccccgggggtggggggccgggtgggccgggcgtgacgcgcggtcaaagtgcaatgatttttcagttcggttggctaaacagggtcagagctgagagcgaagcagaaggggctccctgtccggcccacgtgccctttccctcgacgacagtcgagggctcgggctctgtgggactgtgggagctagggtctgcggggcgcctgcccgggcgaggtcggaagctgcaggccagctgggcccgggccggagcgtgcccggcggggctgcccgggcgggcagggggtgggggctgctcctttcccaagtggtgttgtgaggggcaatgagggcaacaggagatgtggggacgtgttaggagagaaaaaaaaaaaaacaaaaatatatatgggggaaattaacttttttttttcattgaaccaagtgcaatgcatcagagagttttcctatctttgtatgttaagagattaagaaaaaaaaattctatttttgttgtaatgtcctcgcggctctggggacgctaaaagaaccgggcctgccccgccctgcgcggggataacgaaagctgagtgtttttcccttttttttgttcgtttttagtttttttttttttaagtcgttttcctgcgttgacgaggatgatctggggtttttatttgtttcgtcgttcgttctgtttcggtgggagggctgaaggaaacgttcacattttagagtttaaaaaaaacacctcgacatttaaaaaatcaaccaacacaagatcaaaaaggaaaaggacgagagaaaaattatttttaagataattaaacataaaaccctggtgcttcttacattataaagtacgttttaaagaacccacaaactattatacataagtttatgaatcaattaaatatcctgcacttgttaggaatacgcatatcccttctttgttgagtttaacggaacgggacagcggcgtgcccccggcggctggactgctccggccgcgggtctccccgggcgcccctccctggggcccagcacccctcctcgccccatccccgtccgggtacgggggcgcggcaggggtccccggcccctcccccgcagaggtcaatgccaacgaacaaacgtcccctccctccctccctctccgccccgagcgcccttctttgagccagacgccaacttgaccctcaccagcattatcaggagcgcgctcagcaagttggtagtttcctcccccctttcccggcgcccctcccgcccccattcaacatctctcatcctatccccgaccccctccggggaacaccgggaaggctcgacgctccaggacaggaccagccacgcagacaggtcgatttgcccaggcccgcgcccgcacgcacgcacgcacacggccccgcacacagccccgccccaccccgcaaccagccctgtcgactgccttatacacccgcccccgcgctggccggccgacctagtgccttgttctcacccccgtgctggcggagcggacgccgcgctctgggtcccagaggggccgggtggctcagacgacccaccactcccccaccctgaccgtgctgaacagacccccccacacgagagaaaataaaggagcaataaagtcacgagaactttcgtcccccaatcgagagcccgaggggcaccccagccccgcctctgctcccccccaccccacccaccctcggggcgcccccctccccccgcaagccagcctgggccagccccgcttcggcccctcccgggagatccgtgcgcccgaccagcaccagcatcgcggaccgcaaaggccgcccgtcccgtcaaacaagtttcttcttaggctaagaaacgcagtatatacgagtatctctatatatagtactaatggatttggtgtgcttcccccttagcgtccccctccctctgctcctcctccttcagcctggtctccccctcttctctgccctccacccccgtctctgcactgagatacataagaaacaagggtagtttactgtctgttttgttttctgggttttcagtgtcctagcggaatgcaagtaggcagccagcccgtctgttccctctccgccccgccccgccccgcccccgtcactgcgcttctgttataccatctttgcctgactctctccggcttctccattgaatggctaatgtgtatgtgaaataaagaaataaagaaaaacaaacgcga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4784 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:4784 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Molecular function: GO:0003705 [RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0006260 [DNA replication] evidence: IEA
            GeneID:4784 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:4784 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA
            GeneID:4784 -> Biological process: GO:0021707 [cerebellar granule cell differentiation] evidence: IEA
            GeneID:4784 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0048708 [astrocyte differentiation] evidence: IEA
            GeneID:4784 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.