GGRNA Home | Help | Advanced search

2020-10-24 06:33:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002472               6038 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens myosin, heavy chain 8, skeletal muscle, perinatal
            (MYH8), mRNA.
ACCESSION   NM_002472
VERSION     NM_002472.2  GI:153945789
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6038)
  AUTHORS   Bonapace,G., Ceravolo,F., Piccirillo,A., Duro,G., Strisciuglio,P.
            and Concolino,D.
  TITLE     Germline mosaicism for the c.2021G > A (p.Arg674Gln) mutation in
            siblings with trismus pseudocamptodactyly
  JOURNAL   Am. J. Med. Genet. A 152A (11), 2898-2900 (2010)
   PUBMED   20949528
  REMARK    GeneRIF: a family in which two out three sibs affected with trismus
            pseudocamptodactyly, born from healthy nonconsanguineous parents,
            were heterozygous for the c.2021G > A mutation due to a possible
            germline mosaicism in MYH8
REFERENCE   2  (bases 1 to 6038)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   3  (bases 1 to 6038)
  AUTHORS   Shyy,W., Wang,K., Sheffield,V.C. and Morcuende,J.A.
  TITLE     Evaluation of embryonic and perinatal myosin gene mutations and the
            etiology of congenital idiopathic clubfoot
  JOURNAL   J Pediatr Orthop 30 (3), 231-234 (2010)
   PUBMED   20357587
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 6038)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am. J. Hum. Genet. 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 6038)
  AUTHORS   Jullian,E.H., Kelly,A.M., Pompidou,A.J., Hoffman,R., Schiaffino,S.,
            Stedman,H.H. and Rubinstein,N.A.
  TITLE     Characterization of a human perinatal myosin heavy-chain transcript
  JOURNAL   Eur. J. Biochem. 230 (3), 1001-1006 (1995)
   PUBMED   7601129
REFERENCE   6  (bases 1 to 6038)
  AUTHORS   Soussi-Yanicostas,N., Whalen,R.G. and Petit,C.
  TITLE     Five skeletal myosin heavy chain genes are organized as a multigene
            complex in the human genome
  JOURNAL   Hum. Mol. Genet. 2 (5), 563-569 (1993)
   PUBMED   8518795
REFERENCE   7  (bases 1 to 6038)
  AUTHORS   Bober,E., Lyons,G.E., Braun,T., Cossu,G., Buckingham,M. and
            Arnold,H.H.
  TITLE     The muscle regulatory gene, Myf-6, has a biphasic pattern of
            expression during early mouse development
  JOURNAL   J. Cell Biol. 113 (6), 1255-1265 (1991)
   PUBMED   2045411
REFERENCE   8  (bases 1 to 6038)
  AUTHORS   Karsch-Mizrachi,I., Feghali,R., Shows,T.B. and Leinwand,L.A.
  TITLE     Generation of a full-length human perinatal myosin
            heavy-chain-encoding cDNA
  JOURNAL   Gene 89 (2), 289-294 (1990)
   PUBMED   2373371
REFERENCE   9  (bases 1 to 6038)
  AUTHORS   Bober,E., Buchberger-Seidl,A., Braun,T., Singh,S., Goedde,H.W. and
            Arnold,H.H.
  TITLE     Identification of three developmentally controlled isoforms of
            human myosin heavy chains
  JOURNAL   Eur. J. Biochem. 189 (1), 55-65 (1990)
   PUBMED   1691980
REFERENCE   10 (bases 1 to 6038)
  AUTHORS   Feghali,R. and Leinwand,L.A.
  TITLE     Molecular genetic characterization of a developmentally regulated
            human perinatal myosin heavy chain
  JOURNAL   J. Cell Biol. 108 (5), 1791-1797 (1989)
   PUBMED   2715179
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB142109.1, M36769.1,
            AC005323.1 and Z38133.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jul 26, 2007 this sequence version replaced gi:4505300.
            
            Summary: Myosins are actin-based motor proteins that function in
            the generation of mechanical force in eukaryotic cells. Muscle
            myosins are heterohexamers composed of 2 myosin heavy chains and 2
            pairs of nonidentical myosin light chains. This gene encodes a
            member of the class II or conventional myosin heavy chains, and
            functions in skeletal muscle contraction. This gene is
            predominantly expressed in fetal skeletal muscle. This gene is
            found in a cluster of myosin heavy chain genes on chromosome 17. A
            mutation in this gene results in trismus-pseudocamptodactyly
            syndrome. [provided by RefSeq, Sep 2009].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: M36769.1, Z38133.1 [ECO:0000331]
            RNAseq introns       :: mixed/partial sample support ERS025088
                                    [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-417               DB142109.1         1-417
            418-808             M36769.1           396-786
            809-809             AC005323.1         7723-7723           c
            810-5834            Z38133.1           788-5812
            5835-6038           M36769.1           5813-6016
FEATURES             Location/Qualifiers
     source          1..6038
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p13.1"
     gene            1..6038
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="myosin, heavy chain 8, skeletal muscle, perinatal"
                     /db_xref="GeneID:4626"
                     /db_xref="HGNC:7578"
                     /db_xref="MIM:160741"
     exon            1..21
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            22..65
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            66..305
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    84..86
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="upstream in-frame stop codon"
     CDS             96..5909
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="myosin, heavy polypeptide 8, skeletal muscle,
                     perinatal; fetal-myosin heavy chain; myHC-perinatal;
                     myosin heavy chain 8; myosin heavy chain, skeletal muscle,
                     perinatal"
                     /codon_start=1
                     /product="myosin-8"
                     /protein_id="NP_002463.2"
                     /db_xref="GI:153945790"
                     /db_xref="CCDS:CCDS11153.1"
                     /db_xref="GeneID:4626"
                     /db_xref="HGNC:7578"
                     /db_xref="MIM:160741"
                     /translation="
MSASSDAEMAVFGEAAPYLRKSEKERIEAQNKPFDAKTSVFVAEPKESYVKSTIQSKEGGKVTVKTEGGATLTVREDQVFPMNPPKYDKIEDMAMMTHLHEPGVLYNLKERYAAWMIYTYSGLFCVTVNPYKWLPVYKPEVVAAYRGKKRQEAPPHIFSISDNAYQFMLTDRENQSILITGESGAGKTVNTKRVIQYFATIAVTGEKKKDESGKMQGTLEDQIISANPLLEAFGNAKTVRNDNSSRFGKFIRIHFGTTGKLASADIETYLLEKSRVTFQLKAERSYHIFYQITSNKKPDLIEMLLITTNPYDYAFVSQGEITVPSIDDQEELMATDSAIDILGFTPEEKVSIYKLTGAVMHYGNMKFKQKQREEQAEPDGTEVADKAAYLQSLNSADLLKALCYPRVKVGNEYVTKGQTVQQVYNAVGALAKAVYEKMFLWMVTRINQQLDTKQPRQYFIGVLDIAGFEIFDFNSLEQLCINFTNEKLQQFFNHHMFVLEQEEYKKEGIEWTFIDFGMDLAACIELIEKPLGIFSILEEECMFPKATDTSFKNKLYDQHLGKSANFQKPKVVKGKAEAHFSLIHYAGTVDYNITGWLDKNKDPLNDTVVGLYQKSAMKTLASLFSTYASAEADSSAKKGAKKKGSSFQTVSALFRENLNKLMTNLRSTHPHFVRCIIPNETKTPGAMEHELVLHQLRCNGVLEGIRICRKGFPSRILYGDFKQRYKVLNASAIPEGQFIDSKKASEKLLASIDIDHTQYKFGHTKVFFKAGLLGLLEEMRDEKLAQIITRTQAVCRGFLMRVEYQKMLQRREALFCIQYNVRAFMNVKHWPWMKLFFKIKPLLKSAETEKEMATMKEEFQKTKDELAKSEAKRKELEEKMVTLLKEKNDLQLQVQSEADSLADAEERCEQLIKNKIQLEAKIKEVTERAEEEEEINAELTAKKRKLEDECSELKKDIDDLELTLAKVEKEKHATENKVKNLTEEMAGLDETIAKLSKEKKALQETHQQTLDDLQAEEDKVNILTKAKTKLEQQVDDLEGSLEQEKKLRMDLERAKRKLEGDLKLAQESTMDMENDKQQLDEKLEKKEFEISNLISKIEDEQAVEIQLQKKIKELQARIEELGEEIEAERASRAKAEKQRSDLSRELEEISERLEEAGGATSAQVELNKKREAEFQKLRRDLEEATLQHEAMVAALRKKHADSMAELGEQIDNLQRVKQKLEKEKSELKMETDDLSSNAEAISKAKGNLEKMCRSLEDQVSELKTKEEEQQRLINDLTAQRARLQTEAGEYSRQLDEKDALVSQLSRSKQASTQQIEELKHQLEEETKAKNALAHALQSSRHDCDLLREQYEEEQEGKAELQRALSKANSEVAQWRTKYETDAIQRTEELEEAKKKLAQRLQEAEEHVEAVNAKCASLEKTKQRLQNEVEDLMLDVERSNAACAALDKKQRNFDKVLSEWKQKYEETQAELEASQKESRSLSTELFKVKNVYEESLDQLETLRRENKNLQQEISDLTEQIAEGGKQIHELEKIKKQVEQEKCEIQAALEEAEASLEHEEGKILRIQLELNQVKSEVDRKIAEKDEEIDQLKRNHTRVVETMQSTLDAEIRSRNDALRVKKKMEGDLNEMEIQLNHANRLAAESLRNYRNTQGILKETQLHLDDALRGQEDLKEQLAIVERRANLLQAEIEELWATLEQTERSRKIAEQELLDASERVQLLHTQNTSLINTKKKLENDVSQLQSEVEEVIQESRNAEEKAKKAITDAAMMAEELKKEQDTSAHLERMKKNLEQTVKDLQHRLDEAEQLALKGGKKQIQKLEARVRELEGEVENEQKRNAEAVKGLRKHERRVKELTYQTEEDRKNVLRLQDLVDKLQAKVKSYKRQAEEAEEQSNANLSKFRKLQHELEEAEERADIAESQVNKLRVKSREVHTKISAE
"
     misc_feature    204..329
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="Myosin N-terminal SH3-like domain; Region:
                     Myosin_N; pfam02736"
                     /db_xref="CDD:111612"
     misc_feature    342..2438
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="Myosin. Large ATPases; Region: MYSc; smart00242"
                     /db_xref="CDD:197599"
     misc_feature    345..2435
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="Myosin motor domain, type II myosins. Myosin II
                     mediates cortical contraction in cell motility, and is the
                     motor in smooth and skeletal muscle. This catalytic (head)
                     domain has ATPase activity and belongs to the larger group
                     of P-loop NTPases. Myosins...; Region: MYSc_type_II;
                     cd01377"
                     /db_xref="CDD:30099"
     misc_feature    order(480..491,495..500,642..665)
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="ATP-binding site [chemical binding]; other site"
                     /db_xref="CDD:30099"
     misc_feature    822..839
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="switch I region; other site"
                     /db_xref="CDD:30099"
     misc_feature    1488..1511
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="switch II region; other site"
                     /db_xref="CDD:30099"
     misc_feature    order(1572..1607,1614..1643)
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="relay loop; other site"
                     /db_xref="CDD:30099"
     misc_feature    2067..2135
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P13535.3);
                     Region: Actin-binding"
     misc_feature    2187..2231
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="SH1 helix; other site"
                     /db_xref="CDD:30099"
     misc_feature    order(2226..2231,2238..2240,2256..2258,2265..2270,
                     2277..2279,2370..2372,2379..2381,2385..2390,2394..2402,
                     2412..2414,2421..2429)
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="converter subdomain; other site"
                     /db_xref="CDD:30099"
     misc_feature    2373..2417
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P13535.3);
                     Region: Actin-binding"
     misc_feature    3363..5879
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /note="Myosin tail; Region: Myosin_tail_1; pfam01576"
                     /db_xref="CDD:144972"
     exon            306..449
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            450..606
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            607..634
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            635..743
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       635
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34613390"
     exon            744..836
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            837..900
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            901..999
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            1000..1103
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       1072
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34124921"
     exon            1104..1242
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       1128
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34419805"
     exon            1243..1361
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            1362..1511
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            1512..1682
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            1683..1992
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       1733
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053914"
     exon            1993..2060
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       2002
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34693726"
     exon            2061..2148
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            2149..2266
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            2267..2390
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            2391..2527
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            2528..2783
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            2784..3026
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       3003
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1140933"
     exon            3027..3203
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            3204..3349
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            3350..3440
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            3441..3830
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       3781
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35962914"
     exon            3831..3957
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       3852
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34953692"
     variation       3877
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1063926"
     exon            3958..4076
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       3984
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1063927"
     exon            4077..4273
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       4110
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201987005"
     exon            4274..4457
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            4458..4623
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       4606
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1140936"
     exon            4624..4748
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       4638
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34564342"
     exon            4749..5057
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            5058..5261
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            5262..5387
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       5350
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34433607"
     exon            5388..5558
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     exon            5559..5663
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     variation       5636
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053920"
     exon            5664..5759
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     STS             5755..5986
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /standard_name="STS-M36769"
                     /db_xref="UniSTS:15077"
     exon            5760..6038
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /inference="alignment:Splign:1.39.8"
     STS             5897..6008
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
                     /standard_name="RH74898"
                     /db_xref="UniSTS:86710"
     polyA_signal    6007..6012
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
     polyA_signal    6011..6016
                     /gene="MYH8"
                     /gene_synonym="gtMHC-F; MyHC-peri; MyHC-pn"
ORIGIN      
atttccaccaagaacccagagagtggaacacttctgaacctgcatttttatctggaactccagaggcagaatcctttgctaaataaatcgcagccatgagtgcgagctcagacgctgagatggctgtttttggcgaagctgctccctaccttcgaaaatcagaaaaggagcggattgaggcccaaaacaagccgtttgatgctaaaacatctgtctttgtggcggagcccaaggaatcctatgtgaagagcactatacaaagcaaagaaggagggaaagtaaccgtaaagactgaaggtggagcaactctaactgtcagggaagaccaagtcttccctatgaaccctccgaaatatgacaaaattgaggacatggccatgatgactcatctacacgagcctggagtgctgtacaacctcaaagagcgctatgcagcctggatgatctacacctactcaggcctcttctgtgtcaccgtcaacccctacaagtggctgccggtgtacaagcccgaggtggtggctgcctacagaggcaaaaagcgccaggaggccccgccccacatcttctccatctctgacaatgcctatcagttcatgttgactgatcgagagaatcagtccatcctgatcaccggagaatctggtgccggaaagactgtgaacaccaagcgtgtcatccaatactttgcaacaattgcagttactggagagaagaagaaggatgaatctggcaaaatgcaggggactctggaagatcaaatcatcagcgccaatcccctactggaggcctttggcaatgccaaaactgtgaggaatgacaactcctctcgctttggtaaattcattagaatccactttggtactacagggaagctggcatctgctgatatagaaacatatcttttagaaaagtccagagttactttccagctaaaggcggaaagaagctaccatattttttatcagatcacttccaataagaagccagatctaattgaaatgctcctgatcaccaccaacccatatgactatgccttcgtcagtcagggggagatcacagttcccagtattgatgaccaagaagagttgatggccactgatagtgccattgacatcctgggcttcactcctgaagagaaagtgtccatctataaactcacaggggctgtgatgcattatgggaacatgaaattcaagcaaaagcagcgtgaggagcaagctgagccagatggcacagaagtcgctgacaaggcagcctatctccagagtctgaactctgcagacctactcaaagccctctgctaccctagggtcaaggttggcaatgagtatgtcaccaaaggccagactgtgcagcaggtgtacaatgcggtgggtgctctggccaaagccgtctacgagaagatgttcctgtggatggtcacccgcatcaaccagcagctggacaccaagcagcccaggcagtacttcatcggggtcttggacattgctggctttgaaatctttgattttaacagcctggagcagctgtgcatcaacttcaccaacgagaaactgcaacagtttttcaaccaccacatgtttgtgctagagcaggaggagtacaagaaggaaggcatcgagtggacgttcattgactttgggatggacctggctgcctgcattgagctcattgagaagccactgggcatcttctccatcctggaagaggagtgcatgttccctaaggcaacggacacctccttcaagaacaagctgtatgaccagcacctgggcaagtctgccaacttccagaagcccaaggtggtcaaaggcaaggctgaggcccacttctctctgattcactatgctggcactgtggactacaacattactggctggctggacaaaaataaggaccccctgaatgatactgtggttgggctgtaccagaagtctgcaatgaagactctagccagtctcttttccacgtatgctagtgctgaagcagatagcagcgcgaagaaaggtgctaagaaaaagggctcttctttccagactgtgtctgcccttttcagggaaaatttaaataaattgatgacgaatctgaggagcacacaccctcacttcgtacggtgtatcattcccaatgaaaccaaaactcctggggcaatggaacatgaacttgtgttgcaccagctgaggtgtaatggtgtgctggaaggcatccgcatctgtaggaaaggattcccaagcagaatcttatatggtgatttcaaacaaagatacaaggttttaaatgcaagtgctattccagagggacagttcattgacagcaagaaggcttctgagaaacttcttgcatctattgatattgatcatactcaatataaatttggacataccaaggttttcttcaaagctggacttctgggtcttctggaagaaatgagagatgaaaaattagcccaaattataacaagaacacaagctgtctgtaggggattcctaatgagggtagaatatcagaagatgttgcaaaggagagaagcacttttctgcatccagtataatgtccgtgccttcatgaacgtcaagcactggccctggatgaaactctttttcaagattaagcccctcctcaagagtgcagagaccgagaaagagatggccaccatgaaggaagaattccagaaaaccaaagatgaactcgccaagtcagaggcaaaacggaaggagctagaggaaaaaatggtcactctcttaaaagagaaaaatgacctgcaactccaggttcaatctgaagcagatagcttggctgatgcagaggaaaggtgtgagcaactgattaaaaacaaaatccaacttgaggccaaaatcaaagaggtgactgaaagagctgaggaggaggaagagatcaatgctgagctgacagccaagaagagaaaactggaggatgaatgttcagaactcaagaaagacattgatgaccttgagctgacactggccaaggttgagaaggagaaacatgccacggagaacaaggtgaaaaatcttacagaagagatggcaggcctggatgaaaccattgcaaaactgtccaaggagaagaaggctctccaagagacccaccagcagaccctggatgacctgcaggcagaggaggacaaagtcaacatcctgaccaaagctaaaaccaagctagaacagcaagtggatgatcttgaagggtctctggaacaagaaaagaagcttcgaatggatctagaaagagcaaagcggaaactggagggtgacctcaaattggcccaagaatccacaatggatatggaaaatgacaaacagcaacttgatgaaaagcttgaaaagaaagaatttgaaatcagcaatttgataagcaaaattgaagatgagcaagctgtagaaattcaactacagaagaagatcaaagagttgcaggcccgcattgaggagctgggggaagaaatcgaggcagagagggcgtcccgagccaaagcggagaagcagcgctctgacctctcccgggaactggaggagatcagcgagaggctggaagaagccggtggggcaacttctgctcaggtggaattgaacaagaagcgggaggctgagtttcagaaactgcgcagggacctggaggaggccaccctgcagcatgaagctatggtggctgctcttcggaagaagcacgcagacagtatggctgagcttggggagcagattgacaacttgcagcgggtcaaacagaagctggagaaggagaagagtgagctgaagatggagactgatgacctcagcagtaacgcagaggccatttccaaagccaagggaaaccttgaaaagatgtgccgctctctagaagatcaagtgagtgagcttaagaccaaggaagaggagcagcagcggctgatcaatgacctcacagcacagagagcgcgcctgcagacagaagcgggtgaatattctcgacaattagatgagaaagatgctttagtctctcagctttcaaggagcaagcaagcatctactcagcagattgaagagctgaaacatcaactagaggaagaaactaaagccaagaacgccctggcacacgccctgcagtcctcccgccatgactgcgacctgctgcgggaacagtatgaggaagagcaggaaggcaaagctgagctgcagagggcgctgtccaaggccaacagtgaggttgcccagtggagaaccaaatacgagacggatgccatccagcgcacagaggagctggaggaggccaagaaaaagttggcccagcgcctgcaagaagctgaggaacatgtagaagctgtgaacgccaaatgtgcttcccttgagaagacgaagcagcggctccagaatgaagttgaagacctcatgcttgatgtggaaaggtctaatgcagcctgtgcagcccttgataagaagcaaaggaactttgacaaggtcctatcagaatggaagcagaagtatgaggaaactcaggctgaacttgaggcctcccagaaggagtcacgttctcttagcactgagctgttcaaggtgaagaatgtctatgaggaatccctggatcaactcgaaacgctaagaagagaaaataagaacttgcaacaggagatttctgacctcactgagcagattgcagagggaggaaagcaaattcatgaattggagaaaataaagaagcaagtagaacaagagaaatgtgaaattcaggctgctttagaggaagcagaggcatctcttgaacatgaagaaggaaagattctgcgtatccagcttgagttaaaccaagtcaagtctgaagttgatagaaaaatcgcagaaaaggatgaggaaattgaccagctgaagagaaaccacactagagtcgtggagacaatgcagagcacgctggatgcagagattagaagcagaaatgatgctctgagagtcaagaagaaaatggaaggagatctgaatgaaatggaaatccagctgaaccatgccaatcgcttagctgcagagagtttaaggaactacaggaacacccaaggaatcctgaaggaaacccagctccacctggatgatgctctccggggccaggaggacctcaaggaacagctggcaattgtggagcgcagagccaacctgctgcaggctgagatcgaggagctgtgggccactctggaacagacagagagaagcaggaaaatcgccgaacaggagctcctggatgccagtgagcgtgtccagctcctccacacccagaataccagtctcattaacaccaagaagaaattagaaaatgacgtttcccaactccaaagtgaagtggaagaagtaatccaagaatcacgcaatgcagaagagaaagccaagaaggccatcactgatgctgccatgatggctgaggagctgaagaaggaacaggacaccagcgcccacctggagcggatgaagaagaacctggagcagacggtgaaggacctgcagcatcgtctagatgaggccgagcagctggcgctgaagggtgggaagaagcagatccagaaactggaggccagggtacgtgagcttgaaggagaggttgaaaatgaacagaaacgtaatgcagaggctgttaaaggtttacggaaacatgagcgacgagtaaaagaactcacctaccagactgaagaagatcgcaagaatgttctcaggctgcaggacttggtagataaattacaggcgaaggtgaaatcatacaagagacaagctgaggaggctgaggaacaatccaatgctaatctatctaaattccgcaaactccagcatgagctggaggaggccgaggaacgggctgacattgctgagtcccaggtcaacaaattgcgagtgaagagccgagaggttcacacaaaaatcagtgcagagtaaacacacctgcctgatgctatcaagaggctgaagaaaggcacaaaatgtgctatttttggtcacttgctttatgacgtttattttcctgttaaagctgaataaataaaaactacagtaaatgtatacatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4626 -> Molecular function: GO:0003774 [motor activity] evidence: IEA
            GeneID:4626 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:4626 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IEA
            GeneID:4626 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:4626 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: NAS
            GeneID:4626 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:4626 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:4626 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:4626 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:4626 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:4626 -> Cellular component: GO:0005859 [muscle myosin complex] evidence: NAS
            GeneID:4626 -> Cellular component: GO:0005925 [focal adhesion] evidence: IDA
            GeneID:4626 -> Cellular component: GO:0030016 [myofibril] evidence: IEA
            GeneID:4626 -> Cellular component: GO:0032982 [myosin filament] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.