GGRNA Home | Help | Advanced search

2019-03-23 03:39:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002374               9445 bp    mRNA    linear   PRI 05-MAY-2013
DEFINITION  Homo sapiens microtubule-associated protein 2 (MAP2), transcript
            variant 1, mRNA.
ACCESSION   NM_002374
VERSION     NM_002374.3  GI:87578395
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 9445)
  AUTHORS   Zhang,J. and Dong,X.P.
  TITLE     Dysfunction of microtubule-associated proteins of MAP2/tau family
            in Prion disease
  JOURNAL   Prion 6 (4), 334-338 (2012)
   PUBMED   22874672
  REMARK    GeneRIF: Dysfunction of MAP2/tau family leads to disruption of
            microtubule structure and impairment of axonal transport, and
            eventually triggers apoptosis in neurons, which becomes an
            essential pathway for prion to induce the neuropathology.
REFERENCE   2  (bases 1 to 9445)
  AUTHORS   Sontag,J.M., Nunbhakdi-Craig,V., White,C.L. III, Halpain,S. and
            Sontag,E.
  TITLE     The protein phosphatase PP2A/Balpha binds to the
            microtubule-associated proteins Tau and MAP2 at a motif also
            recognized by the kinase Fyn: implications for tauopathies
  JOURNAL   J. Biol. Chem. 287 (18), 14984-14993 (2012)
   PUBMED   22403409
  REMARK    GeneRIF: The protein phosphatase PP2A/Balpha binds to the
            microtubule-associated proteins Tau and MAP2 at a motif also
            recognized by the kinase Fyn.
REFERENCE   3  (bases 1 to 9445)
  AUTHORS   Guo,Y., Gong,H.S., Zhang,J., Xie,W.L., Tian,C., Chen,C., Shi,Q.,
            Wang,S.B., Xu,Y., Zhang,B.Y. and Dong,X.P.
  TITLE     Remarkable reduction of MAP2 in the brains of scrapie-infected
            rodents and human prion disease possibly correlated with the
            increase of calpain
  JOURNAL   PLoS ONE 7 (1), E30163 (2012)
   PUBMED   22272295
  REMARK    GeneRIF: Data indicate that the decline of MAP2 is a common
            phenomenon in transmissible spongiform encephalopathies (TSEs),
            which seems to occur at an early stage of incubation period.
REFERENCE   4  (bases 1 to 9445)
  AUTHORS   Song,Z., He,C.D., Sun,C., Xu,Y., Jin,X., Zhang,Y., Xiao,T.,
            Wang,Y., Lu,P., Jiang,Y., Wei,H. and Chen,H.D.
  TITLE     Increased expression of MAP2 inhibits melanoma cell proliferation,
            invasion and tumor growth in vitro and in vivo
  JOURNAL   Exp. Dermatol. 19 (11), 958-964 (2010)
   PUBMED   20100193
  REMARK    GeneRIF: Increased MAP2 expression in malignant melanoma cells
            significantly inhibits tumor cell growth and neoplasm invasiveness,
            and induces apoptosis and cell cycle arrest.
REFERENCE   5  (bases 1 to 9445)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   6  (bases 1 to 9445)
  AUTHORS   Alberts,M.J., Kandt,R.S., Pericak-Vance,M.A., Bebout,J.,
            Speer,M.C., Siddique,T.S., Yamaoka,L., Hung,W.Y., Gaskell,P.C. and
            Roses,A.D.
  TITLE     MspI RFLP for microtubule associated protein-2 (MAP2)
  JOURNAL   Nucleic Acids Res. 19 (4), 960 (1991)
   PUBMED   1708129
REFERENCE   7  (bases 1 to 9445)
  AUTHORS   Dammerman,M., Yen,S.H. and Shafit-Zagardo,B.
  TITLE     Sequence of a human MAP-2 region sharing epitopes with Alzheimer
            neurofibrillary tangles
  JOURNAL   J. Neurosci. Res. 24 (4), 487-495 (1989)
   PUBMED   2481044
REFERENCE   8  (bases 1 to 9445)
  AUTHORS   Rubino,H.M., Dammerman,M., Shafit-Zagardo,B. and Erlichman,J.
  TITLE     Localization and characterization of the binding site for the
            regulatory subunit of type II cAMP-dependent protein kinase on MAP2
  JOURNAL   Neuron 3 (5), 631-638 (1989)
   PUBMED   2701845
REFERENCE   9  (bases 1 to 9445)
  AUTHORS   Obar,R.A., Dingus,J., Bayley,H. and Vallee,R.B.
  TITLE     The RII subunit of cAMP-dependent protein kinase binds to a common
            amino-terminal domain in microtubule-associated proteins 2A, 2B,
            and 2C
  JOURNAL   Neuron 3 (5), 639-645 (1989)
   PUBMED   2561973
REFERENCE   10 (bases 1 to 9445)
  AUTHORS   Kosik,K.S., Orecchio,L.D., Bakalis,S., Duffy,L. and Neve,R.L.
  TITLE     Partial sequence of MAP2 in the region of a shared epitope with
            Alzheimer neurofibrillary tangles
  JOURNAL   J. Neurochem. 51 (2), 587-598 (1988)
   PUBMED   2455776
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U01828.1, BX490896.1,
            BC066648.1, M25668.1, BX431335.2, U89330.1, BC027583.1, BC038857.1,
            AL833567.1, AK055674.1, CK903071.1 and AK056148.1.
            On Feb 16, 2006 this sequence version replaced gi:14195623.
            
            Summary: This gene encodes a protein that belongs to the
            microtubule-associated protein family. The proteins of this family
            are thought to be involved in microtubule assembly, which is an
            essential step in neurogenesis. The products of similar genes in
            rat and mouse are neuron-specific cytoskeletal proteins that are
            enriched in dentrites, implicating a role in determining and
            stabilizing dentritic shape during neuron development. A number of
            alternatively spliced variants encoding distinct isoforms have been
            described. [provided by RefSeq, Jan 2010].
            
            Transcript Variant: This longest variant (1) includes three
            alternate in-frame exons, compared to variant 2, resulting in the
            longest isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U01828.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-15                U01828.1           1-15
            16-298              BX490896.1         279-561
            299-3218            BC066648.1         440-3359
            3219-3313           M25668.1           1492-1586
            3314-3430           BC066648.1         3455-3571
            3431-3581           M25668.1           1704-1854
            3582-4052           BX431335.2         338-808
            4053-5211           U89330.1           3793-4951
            5212-5509           BC027583.1         1216-1513
            5510-5853           BC038857.1         1898-2241
            5854-6971           AL833567.1         1271-2388
            6972-8295           AK055674.1         295-1618
            8296-8824           AL833567.1         3712-4240
            8825-9161           CK903071.1         233-569
            9162-9445           AK056148.1         1841-2124
FEATURES             Location/Qualifiers
     source          1..9445
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q34-q35"
     gene            1..9445
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="microtubule-associated protein 2"
                     /db_xref="GeneID:4133"
                     /db_xref="HGNC:6839"
                     /db_xref="MIM:157130"
     exon            1..77
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     exon            78..142
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     exon            143..219
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       149
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186333656"
     variation       181
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189850574"
     exon            220..510
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    243..245
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="upstream in-frame stop codon"
     CDS             249..5732
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="isoform 1 is encoded by transcript variant 1;
                     MAP-2"
                     /codon_start=1
                     /product="microtubule-associated protein 2 isoform 1"
                     /protein_id="NP_002365.3"
                     /db_xref="GI:87578396"
                     /db_xref="CCDS:CCDS2384.1"
                     /db_xref="GeneID:4133"
                     /db_xref="HGNC:6839"
                     /db_xref="MIM:157130"
                     /translation="
MADERKDEAKAPHWTSAPLTEASAHSHPPEIKDQGGAGEGLVRSANGFPYREDEEGAFGEHGSQGTYSNTKENGINGELTSADRETAEEVSARIVQVVTAEAVAVLKGEQEKEAQHKDQTAALPLAAEETANLPPSPPPSPASEQTVTVEEDLLTASKMEFHDQQELTPSTAEPSDQKEKESEKQSKPGEDLKHAALVSQPETTKTYPDKKDMQGTEEEKAPLALFGHTLVASLEDMKQKTEPSLVVPGIDLPKEPPTPKEQKDWFIEMPTEAKKDEWGLVAPISPGPLTPMREKDVFDDIPKWEGKQFDSPMPSPFQGGSFTLPLDVMKNEIVTETSPFAPAFLQPDDKKSLQQTSGPATAKDSFKIEEPHEAKPDKMAEAPPSEAMTLPKDAHIPVVEEHVMGKVLEEEKEAINQETVQQRDTFTPSGQEPILTEKETELKLEEKTTISDKEAVPKESKPPKPADEEIGIIQTSTEHTFSEQKDQEPTTDMLKQDSFPVSLEQAVTDSAMTSKTLEKAMTEPSALIEKSSIQELFEMRVDDKDKIEGVGAATSAELDMPFYEDKSGMSKYFETSALKEEATKSIEPGSDYYELSDTRESVHESIDTMSPMHKNGDKEFQTGKESQPSPPAQEAGYSTLAQSYPSDLPEEPSSPQERMFTIDPKVYGEKRDLHSKNKDDLTLSRSLGLGGRSAIEQRSMSINLPMSCLDSIALGFNFGRGHDLSPLASDILTNTSGSMDEGDDYLPATTPALEKAPCFPVESKEEEQIEKVKATGEESTQAEISCESPFLAKDFYKNGTVMAPDLPEMLDLAGTRSRLASVSADAEVARRKSVPSETVVEDSRTGLPPVTDENHVIVKTDSQLEDLGYCVFNKYTVPLPSPVQDSENLSGESGTFYEGTDDKVRRDLATDLSLIEVKLAAAGRVKDEFSVDKEASAHISGDKSGLSKEFDQEKKANDRLDTVLEKSEEHADSKEHAKKTEEAGDEIETFGLGVTYEQALAKDLSIPTDASSEKAEKGLSSVPEIAEVEPSKKVEQGLDFAVQGQLDVKISDFGQMASGLNIDDRRATELKLEATQDMTPSSKAPQEADAFMGVESGHMKEGTKVSETEVKEKVAKPDLVHQEAVDKEESYESSGEHESLTMESLKADEGKKETSPESSLIQDEIAVKLSVEIPCPPAVSEADLATDERADVQMEFIQGPKEESKETPDISITPSDVAEPLHETIVSEPAEIQSEEEEIEAQGEYDKLLFRSDTLQITDLGVSGAREEFVETCPSEHKGVIESVVTIEDDFITVVQTTTDEGESGSHSVRFAALEQPEVERRPSPHDEEEFEVEEAAEAQAEPKDGSPEAPASPEREEVALSEYKTETYDDYKDETTIDDSIMDADSLWVDTQDDDRSIMTEQLETIPKEEKAEKEARRSSLEKHRKEKPFKTGRGRISTPERKVAKKEPSTVSRDEVRRKKAVYKKAELAKKTEVQAHSPSRKFILKPAIKYTRPTHLSCVKRKTTAAGGESALAPSVFKQAKDKVSDGVTKSPEKRSSLPRPSSILPPRRGVSGDRDENSFSLNSSISSSARRTTRSEPIRRAGKSGTSTPTTPGSTAITPGTPPSYSSRTPGTPGTPSYPRTPHTPGTPKSAILVPSEKKVAIIRTPPKSPATPKQLRLINQPLPDLKNVKSKIGSTDNIKYQPKGGQVQIVTKKIDLSHVTSKCGSLKNIRHRPGGGRVKIESVKLDFKEKAQAKVGSLDNAHHVPGGGNVKIDSQKLNFREHAKARVDHGAEIITQSPGRSSVASPRRLSNVSSSGSINLLESPQLATLAEDVTAALAKQGL
"
     misc_feature    435..437
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1377..4763
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="MAP2/Tau projection domain; Region: MAP2_projctn;
                     pfam08377"
                     /db_xref="CDD:203922"
     misc_feature    2076..2078
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2208..2210
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2433..2435
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2709..2711
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4287..4289
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11137.4); phosphorylation site"
     misc_feature    4287..4289
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4305..4307
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11137.4); phosphorylation site"
     misc_feature    4587..4649
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11137.4);
                     Region: Calmodulin-binding (Potential)"
     misc_feature    4866..4868
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     misc_feature    5028..5030
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5052..5054
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5061..5063
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5070..5072
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5226..5321
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="Tau and MAP protein, tubulin-binding repeat;
                     Region: Tubulin-binding; pfam00418"
                     /db_xref="CDD:144129"
     misc_feature    5229..5321
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11137.4);
                     Region: Tau/MAP 1"
     misc_feature    5271..5273
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03382"
     misc_feature    5283..5285
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     misc_feature    5322..5414
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11137.4);
                     Region: Tau/MAP 2"
     misc_feature    5322..5414
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="Tau and MAP protein, tubulin-binding repeat;
                     Region: Tubulin-binding; pfam00418"
                     /db_xref="CDD:144129"
     misc_feature    5376..5378
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     misc_feature    5415..5510
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11137.4);
                     Region: Tau/MAP 3"
     misc_feature    5415..5510
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /note="Tau and MAP protein, tubulin-binding repeat;
                     Region: Tubulin-binding; pfam00418"
                     /db_xref="CDD:144129"
     misc_feature    5631..5633
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     misc_feature    5640..5642
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5643..5645
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     misc_feature    5646..5648
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5652..5654
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:07353"
     variation       261
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138782038"
     variation       262
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148723167"
     variation       267
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201525773"
     variation       269
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2271252"
     variation       301
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145598155"
     variation       353
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149857613"
     variation       361
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188840497"
     variation       365
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148825736"
     variation       380
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143419670"
     variation       381
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181207847"
     variation       411
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139310749"
     variation       418
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35935403"
     variation       430
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370545736"
     variation       442
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138654038"
     variation       461
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201204279"
     variation       493
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2271251"
     exon            511..624
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       576
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138065981"
     variation       606
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370307941"
     variation       609
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147456890"
     exon            625..702
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       656
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201319995"
     exon            703..4428
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       712
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374954491"
     variation       719
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369308118"
     variation       734
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6720659"
     variation       749
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148774557"
     variation       750
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374208822"
     variation       760
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377700467"
     variation       767
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371129624"
     variation       774
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375849922"
     variation       782
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201765886"
     variation       784
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6749066"
     variation       896
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:741007"
     variation       919
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144699107"
     variation       929
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139978953"
     variation       985
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373380585"
     variation       997
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374108590"
     variation       1030
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148073159"
     variation       1050
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147043359"
     variation       1059
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200313728"
     variation       1061
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147274334"
     variation       1075
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370541070"
     variation       1113
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202130770"
     variation       1127
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373965031"
     variation       1166
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367976518"
     variation       1195
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149416048"
     variation       1225
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75373148"
     variation       1233
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144780312"
     variation       1261
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144486691"
     variation       1263
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368108274"
     variation       1272
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143122612"
     variation       1305
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371836048"
     variation       1363
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375194510"
     variation       1385
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140194857"
     variation       1412
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376544152"
     variation       1467
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755708"
     variation       1484
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201958756"
     variation       1488
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41265969"
     variation       1516
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:741006"
     variation       1586
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371770931"
     variation       1590
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193121376"
     variation       1605
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374131363"
     variation       1608
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376769791"
     variation       1612
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369176617"
     variation       1646
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377651062"
     variation       1653
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141459532"
     variation       1689
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199575901"
     variation       1723
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185552042"
     variation       1745
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285352"
     variation       1749
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200834782"
     variation       1753
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201025312"
     variation       1763
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199806559"
     variation       1797
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5838179"
     variation       1798
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369903670"
     variation       1805
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200288911"
     variation       1812
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373541213"
     variation       1834
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373786563"
     variation       2046
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111865603"
     variation       2063
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143216392"
     variation       2064
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191979907"
     variation       2095
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375864756"
     variation       2129
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148468330"
     variation       2213
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113862755"
     variation       2255
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148436232"
     variation       2265
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370470543"
     variation       2269
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111505040"
     variation       2285
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35994200"
     variation       2289
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368345253"
     variation       2327
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371506846"
     variation       2346
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147861980"
     variation       2362
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146432517"
     variation       2363
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376603789"
     variation       2404
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148922251"
     variation       2435
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369033681"
     variation       2436
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201346969"
     variation       2495
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376263721"
     variation       2502
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142338628"
     variation       2528
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34693874"
     variation       2541
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151284006"
     variation       2546
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139047749"
     variation       2593
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184529696"
     variation       2609
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373702192"
     variation       2621
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141522729"
     variation       2667
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140395814"
     variation       2674
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141466442"
     variation       2679
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201819060"
     variation       2711
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142716142"
     variation       2721
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370579546"
     variation       2751
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370133321"
     variation       2771
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150391168"
     variation       2779
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372993675"
     variation       2795
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138369259"
     variation       2841
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188844755"
     variation       2887
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200147409"
     variation       2983
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375700439"
     variation       2993
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145128145"
     variation       3014
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370274933"
     variation       3015
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142105837"
     variation       3059
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181175771"
     variation       3066
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141654180"
     variation       3071
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140435275"
     variation       3080
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147042067"
     variation       3082
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147371599"
     variation       3105
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373966847"
     variation       3137
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149920552"
     variation       3147
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377222605"
     variation       3173
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200567427"
     variation       3175
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:13425372"
     variation       3195
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200573921"
     variation       3196
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375248306"
     variation       3202
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377375608"
     variation       3208
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147736799"
     variation       3213
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368543818"
     variation       3219
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35927101"
     variation       3251
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184423634"
     variation       3256
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146804096"
     variation       3267
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200048191"
     variation       3300
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150454433"
     variation       3306
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149636178"
     variation       3312
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187200977"
     variation       3314
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2239672"
     variation       3328
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147381270"
     variation       3348
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202024964"
     variation       3376
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201382010"
     variation       3425
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202114371"
     variation       3434
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201420432"
     variation       3454
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200163105"
     variation       3457
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376509566"
     variation       3468
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199753872"
     variation       3503
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141758882"
     variation       3526
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139654422"
     variation       3543
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17745550"
     variation       3558
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143781991"
     variation       3569
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146908968"
     variation       3578
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113287686"
     variation       3635
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36091461"
     variation       3648
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200010488"
     variation       3688
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144069172"
     variation       3689
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181666710"
     variation       3709
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200843201"
     variation       3746
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376049781"
     variation       3767
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201672675"
     STS             3819..4760
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /standard_name="GDB:197515"
                     /db_xref="UniSTS:155933"
     variation       3829
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202122082"
     variation       3832
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141235153"
     variation       3844
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370180460"
     variation       3852
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143629615"
     variation       3859
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200150779"
     variation       3880
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139321161"
     variation       3916
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145228580"
     variation       3919
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149194467"
     variation       3924
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374394903"
     variation       3964
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200437236"
     variation       3972
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367929783"
     variation       3973
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200382253"
     variation       3990
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374935033"
     variation       3999
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141848998"
     variation       4000
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142649637"
     variation       4004
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185809016"
     variation       4083
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150116230"
     variation       4106
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141793873"
     variation       4142
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372111314"
     variation       4172
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368301391"
     variation       4193
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138157736"
     variation       4249
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142643213"
     variation       4253
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190220894"
     variation       4279
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35915945"
     variation       4325
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139772651"
     variation       4349
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113557467"
     variation       4358
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147926728"
     variation       4372
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201499809"
     variation       4411..4412
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35581436"
     exon            4429..4635
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       4460
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372011116"
     variation       4500
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200795471"
     variation       4549
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145390170"
     variation       4620
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368819881"
     variation       4628
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372071871"
     exon            4636..4770
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       4697
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201357901"
     variation       4703
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148758170"
     variation       4758
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369892280"
     variation       4759
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149033530"
     variation       4765..4766
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:11460425"
     exon            4771..4832
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       4828
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377593461"
     exon            4833..4980
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       4835
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143089892"
     variation       4836
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145501967"
     variation       4861
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200474600"
     variation       4862
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151128639"
     variation       4925
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371482707"
     variation       4954
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199728294"
     variation       4969
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376761772"
     exon            4981..5321
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       5004
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373881033"
     variation       5018
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377028684"
     variation       5046
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149674945"
     variation       5107
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370309886"
     variation       5180
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140691086"
     variation       5314
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199628162"
     exon            5322..5403
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       5399
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151301293"
     exon            5404..5516
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       5429
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376936549"
     exon            5517..9445
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /inference="alignment:Splign:1.39.8"
     variation       5528
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144328342"
     variation       5532
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148804064"
     variation       5536
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146867931"
     variation       5568
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377443387"
     variation       5569
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369928322"
     variation       5570
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146470554"
     variation       5663
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372398391"
     variation       5685
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375692292"
     variation       5696
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374130088"
     STS             5769..5961
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /standard_name="STS-U01828"
                     /db_xref="UniSTS:47976"
     variation       5775
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377596861"
     variation       5841
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370387493"
     variation       5935
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16843614"
     variation       5993..5994
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35306148"
     variation       6364
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116515304"
     variation       6390
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185373390"
     variation       6431
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:16843618"
     variation       6484
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16843621"
     variation       6616
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189690356"
     variation       6639
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116288447"
     variation       6691
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183379883"
     variation       6766
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186592423"
     variation       6786
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144149734"
     variation       6839
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147770023"
     variation       6946..6947
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369294009"
     STS             6971..7120
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /standard_name="WI-14008"
                     /db_xref="UniSTS:82070"
     variation       7040
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192256255"
     variation       7081
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141166524"
     variation       7156
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:79583267"
     variation       7182
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75843462"
     variation       7188..7189
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35418396"
     variation       7426
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183583631"
     variation       7436
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76792277"
     variation       7480
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188580062"
     variation       7497
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192754387"
     variation       7550..7551
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34608863"
     variation       7550
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147006373"
     variation       7556
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113505378"
     variation       7561
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114531804"
     variation       7605
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145124407"
     variation       7709
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183144733"
     variation       7789
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:186657740"
     variation       7842
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191454639"
     variation       7892
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149078889"
     variation       8079
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183588119"
     variation       8104
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143141412"
     variation       8136
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187882319"
     variation       8232
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:140319670"
     variation       8283
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148102787"
     variation       8294
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373722340"
     variation       8301
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367832102"
     variation       8335
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372258315"
     variation       8339
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12613838"
     variation       8340
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112627538"
     variation       8410
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78101873"
     variation       8411
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55677311"
     variation       8418
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141300266"
     variation       8441
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185252440"
     variation       8483
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11678041"
     variation       8544
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145081211"
     variation       8595
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73074730"
     variation       8756
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113589742"
     variation       8796..8799
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="caca"
                     /db_xref="dbSNP:112861196"
     variation       8797
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="ac"
                     /replace="acac"
                     /db_xref="dbSNP:10578247"
     variation       8805..8808
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="ac"
                     /replace="acac"
                     /db_xref="dbSNP:71395565"
     variation       8829..8830
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="acct"
                     /db_xref="dbSNP:372175517"
     variation       8875..8876
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35320310"
     variation       8878
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190103484"
     variation       8955
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199952940"
     variation       9083
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:13392748"
     STS             9133..9292
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /standard_name="RH66399"
                     /db_xref="UniSTS:31584"
     variation       9152
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138809066"
     variation       9216..9217
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:137944482"
     variation       9217
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:370182851"
     variation       9230
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45548435"
     STS             9244..9393
                     /gene="MAP2"
                     /gene_synonym="MAP2A; MAP2B; MAP2C"
                     /standard_name="MAP2"
                     /db_xref="UniSTS:503898"
ORIGIN      
gggataatgctcccggagaaggattctgcagcagttctcaaaggctagacttgagtggtattgctgcatatgcgctgattcttcagcttgtctctaaccgaggaagcattgattgggagctactcattcagaaaattaaaagaaagaagccagaaaatattatcaaccctttgagaacacgacacaacgaactttatattttaccacttccttgaatagttgcaggagaaataacaaggcattgaagaatggcagatgaacggaaagatgaagcaaaggcacctcactggacctcagcaccgctaacagaggcatctgcacactcacatccacctgagattaaggatcaaggcggagcaggggaaggacttgtccgaagcgccaatggattcccatacagggaggatgaagagggtgcctttggagagcatgggtcacagggcacctattcaaataccaaagagaatgggatcaacggagagctgacctcagctgacagagaaacagcagaggaggtgtctgcaaggatagttcaagtagtcactgctgaggctgtagcagtcctgaaaggtgaacaagagaaagaagctcaacataaagaccagactgcagctctgcctttagcagctgaagaaacagctaatctgcctccttctccacccccatcacctgcctcagaacagactgtcacagtggaggaagatttacttacagcctcgaagatggagttccacgatcaacaggaattgactccctctacagctgagccttcagaccagaaggaaaaggagtcagagaagcaaagtaagcctggtgaagaccttaaacatgctgccttagtttctcagccagagacaactaaaacttaccctgataaaaaggacatgcaaggcacggaagaagaaaaagcacccctagctttgtttgggcacactcttgttgccagcctggaagacatgaaacagaagacagaaccaagccttgtagtacctggcattgacctccctaaagagcctccaactccaaaagaacaaaaggactggttcatcgaaatgccaacggaagcaaaaaaggatgagtggggtttagttgcccccatatctcctggccctctgactcccatgagggaaaaagatgtatttgatgatatcccaaaatgggaagggaaacagtttgattctcccatgccaagtccctttcaagggggaagcttcactcttcctttagatgtcatgaagaatgaaatagttacagaaacatcgccctttgcccctgcctttttacagccagatgacaaaaaatctctgcaacaaaccagtggcccagctactgccaaagatagttttaaaattgaagagccccatgaggctaaacctgacaaaatggcagaagcaccaccctcagaggcaatgaccttacccaaagatgctcacattccagttgtagaagaacatgttatggggaaagttttagaggaagaaaaggaggccataaatcaagagactgtgcagcaaagggatactttcacccccagtggacaggaacctatacttactgaaaaggaaactgagctgaagcttgaagaaaaaaccaccatttctgacaaagaagctgtgccaaaagagagtaaacccccaaaacctgcagatgaagaaataggcataattcagacctccacagagcacactttctcagaacagaaagaccaagagcctaccacagatatgttgaaacaggactcgttccctgtaagtttggagcaagcagttacagattcagccatgacctctaaaacactggagaaagccatgaccgaaccatctgcattaattgaaaagagctcaattcaggaactttttgaaatgagagttgatgacaaagataagattgaaggagttggagctgcaacatcagctgagcttgatatgccattttatgaagataaatcaggaatgtccaagtactttgaaacatctgccttgaaagaagaagcaacaaaaagcattgagccaggcagtgattactatgaactgagtgacactagagaaagtgtccatgagtctattgataccatgtctcccatgcataaaaatggtgacaaggagtttcaaacaggaaaagaatcccagcccagtcctccagcacaagaagcagggtacagcactctcgcacagagttatccatcagatttacctgaagaacccagttctcctcaagaaagaatgttcactattgatccaaaagtgtatggagagaaaagggacctccacagtaagaataaggatgatttgacccttagcaggagtttaggacttggtggtaggtctgcaatagaacaaagaagcatgtcaatcaatttgccgatgtcttgcctagattccatagcccttggatttaactttggtcggggacatgatctttctcctctggcttccgatattctaaccaacactagtggaagtatggatgaaggggatgattaccttccagccaccacacctgcactggagaaagccccttgcttccctgtagaaagcaaagaggaagaacagatagagaaagtaaaagctactggagaagaaagtactcaagcggagatatcatgtgagtctcctttcctagccaaagatttttacaaaaatggtactgtcatggcacctgaccttcctgaaatgctagatctggcaggcacaaggtcaagattggcttctgtgagtgcagatgctgaggttgccaggaggaaatcagtcccatcagagactgtggttgaggatagtcgtactggcttgcccccggtaactgatgaaaaccatgtcattgtaaaaacggacagtcagctcgaagacctgggctactgtgtgttcaataagtacacagtcccattgccatcacctgttcaagacagtgagaatttatcaggggagagtggtaccttttacgaaggcactgatgataaagttcgaagagatttggccacagacctttcactgattgaagtgaaactggcagcagccggaagagtcaaagatgagttcagtgttgacaaagaagcatccgcgcatatctctggtgacaaatcaggactgagtaaggagtttgaccaagagaagaaagctaatgataggttggatactgtactagaaaagagtgaagaacatgctgattcaaaagaacatgccaagaaaactgaagaggctggtgatgaaatagaaacattcggattaggagtaacctatgagcaagctttggccaaagatttgtcaataccaacagatgcatcctctgagaaagcagagaagggtcttagttcagtgccagagatagctgaggtagaaccatccaaaaaggtggaacaaggtctggattttgctgtccagggtcaactagatgttaaaattagtgactttggacagatggcttcagggctaaacatagatgatagaagggcaacagagctaaaacttgaggctacacaggacatgaccccctcatccaaagcaccgcaggaggcagatgcatttatgggtgttgagtctggccacatgaaagaaggcactaaagttagtgagacagaagtcaaagagaaggtggccaagcctgacttggtgcaccaggaggctgtagacaaggaggagtcctatgaatctagtggtgagcatgaaagtctcaccatggagtccttgaaagctgatgagggcaagaaggaaacatctccagaatcatctctaattcaagatgagattgccgtcaaattgtcagtggaaataccttgcccacctgctgtttcagaggctgatttagccacagatgagagagctgatgtccagatggaatttattcaggggccaaaagaagaaagcaaagagaccccagatatatccatcacgccttctgatgttgcagagccattgcatgaaacgatcgtatctgaaccagcagagattcagagtgaggaagaagagatagaagcccagggagaatatgataaactgctcttccgctcagacacccttcagataactgacctgggtgtctcaggtgccagggaggaatttgtggagacctgcccaagtgaacacaaaggagtgattgagtctgttgtgaccatcgaggatgatttcatcactgtagtgcaaaccacaactgatgaaggggagtcagggtcccacagcgtgcgttttgcagccctagagcagcctgaggtggaaaggagaccatctcctcatgatgaagaagagtttgaagtagaagaggcagctgaagcccaggcagaacccaaagatggttccccagaggctccagcttcccctgagagagaagaggttgcactttctgaatataagacagaaacctatgacgattacaaagatgagaccaccattgacgactccatcatggacgctgacagcctctgggtggacactcaagatgatgataggagcatcatgacagaacagttagaaactattcctaaagaggagaaagctgaaaaggaagctcggagatcatctcttgagaaacatagaaaagaaaagccttttaaaaccgggagaggcagaatttccactcctgaaagaaaagtagctaaaaaggaacctagcacagtctccagagatgaagtgagaaggaaaaaagcagtttataagaaggctgaacttgctaaaaaaacagaagttcaggcccactctccctccaggaaattcattttaaaacctgctatcaaatatactagaccaactcatctctcctgtgttaagcggaaaaccacagcagcaggtggggaatcagctctggctcccagtgtatttaaacaggcaaaggacaaagtctctgacggagtaaccaagagcccagaaaagcgctcttctctcccaagaccttcctccattctccctcctcggcgaggtgtgtcaggagacagagatgagaattccttctctctcaacagttctatctcttcttcagcacggcggaccaccaggtcagagccaattcgcagagcagggaagagtggtacctcaacacccactacccctgggtctactgccatcactcctggcaccccaccaagttattcttcacgcacaccaggcactcctggaacccctagctatcccaggacccctcacacaccaggaacccccaagtctgccatcttggtgccgagtgagaagaaggtcgccatcatacgtactcctccaaaatctcctgcgactcccaagcagcttcggcttattaaccaaccactgccagacctgaagaatgtcaaatccaaaatcggatcaacagacaacatcaaataccagcctaaaggggggcaggtacaaattgttaccaagaaaatagacctaagccatgtgacatccaaatgtggctctctgaagaacatccgccacaggccaggtggcggacgtgtgaaaattgagagtgtaaaactagatttcaaagaaaaggcccaagctaaagttggttctcttgataatgctcatcatgtacctggaggtggtaatgtcaagattgacagccaaaagttgaacttcagagagcatgctaaagcccgtgtggaccatggggctgagatcattacacagtccccaggcagatccagcgtggcatcaccccgacgactcagcaatgtctcctcgtctggaagcatcaacctgctcgaatctcctcagcttgccactttggctgaggatgtcactgctgcactcgctaagcagggcttgtgaatatttctcatttagcattgaaataataatatttaggcatgagctcttggcaggagtgggctctgagcagttgttatattcattctttataaaccataaaataaataatctcatccccaaactgtagtaattgttacaattttctatttaaaaaatgaatagtacatgcagaaattgacctgatttccatttgcaacaggaagacactggctttacatgggttcaattggacaattatttttgctctgctctgttttgcatggagtattattattttaaaaattgcatttttacctttcatgtgcctgaaggctatccactacattctgaaggccttgttaaaatccaagctgctcatttcactattctgtttctgagtgagaagataaaaactgcccattgtaacttatttcaggttaaattaaaccaaggagtctgattgcaggaagggaagagcatgtaagaaataagtttttttaaagtgttattttgtataaatgggaagaaagattcaattaagttattaacatttgggacctggataattatatcagagtatgtcagtccaataaattatttaactaattaaaaaatagttgcaaagcatttgagctgtggttgaggaagtggtgtaaaagtgcatccattaggaatgatgcactttcattaggatggactcgtgtctgattagaatgtcagttgatcagctagatttgtgtccacactaccagtttcacaccccctttccatctgtttgatacagtattatagatataaatatatatatatttctctgtggccatttgtgatacttcctcatatacttgaatattatacttctttattcacagtatctgtgtctcctgcaccctttggtgttgcaattttagatatgtgaaagtagatgttagcagggttctctccctatttaaaaaaaatacattaaaaaagacaaaaaattttagcatgaagttgctttctgtaacaactcaaagccgtaaccctgttttagtgccagatacaagtctctcccgtgatgctagacaaaaaattatttttctttgctttcaccaacatggagtttgtgggggtgggtccagttatacatgaaagggtttacagattgttggtttaagattatggatttatctcatttttaatcacaggatagtttggggtttattcctattattattcatgaaaccgacttaagattttttctttatttttctttttttttccatttgctaaagttgaaagttgaaactaactataatagtttgaaacatgttttctcatttttccaaatagtatctgtttattaaattctctaatagaagatgtttgtctttcttacccaaagtaaagatcccctgatcagaaagaaaaaatacaatactttgggaagctatagctataaaacacttgagacacagatatctaaatcagtttttttccaagactccaacattgcactctgtaaagtaacacactgtgatctagtattatttatcagtagataatactgttctgactgtatatacagtctagaactcacaaatcaattagttcctctcacaaatcattcatcttagacttacaaataaggaatgaaatagtcaatggcctgattaaggcaaagagctaccaggctagatggacactttttaaaaattttatctgttctttttcttgctcagggctggtaggttggatctgaaccattaaaatcaaatggtccactaggcgtatgatctctttgagccaaatcagttcctgaatataaaggaggaaatgatgaggatgtactgaggcaacggggaagtatagaaacatccaagacaaaagccaagggatgcaaaggcagagacacaggtgctttttggtgacccagtggatatggcaaccagtgtaactgccatacaagaaaccctaggagcaaacccacaccactcattctcagctaagagattttacacaggcaaacgtgtcttaaaccatctataaatcagttattttatatgacagtcaaaaccttagaaaccttaggatcattatatctattttctgcctattaattgctgtgaggtttgatttgaccaatctgggcaatttattcatcagcttcccttgaagtgcaccagaaaatagaagaaaggtgtgtggagacttagggtattttattacatgttttcatagtcttaaatagtgattaaatttctctagaaagaagttaacagctcattagaaaagttttaacctgtgaaataagtatttttctcaacattctttaaagtttttatataagttaacactaggtaaacattctgcatactagaagtcagtttattacaaatacatgtcaaaaataaagattatacaaggcaccaaactactagatttggcattaaaacaaatgtttatttctaatcacaacaaaattataatgaataaatgttcttgctttgtatggaaatacaattctttattaaagttaacagaaaggaactgatcgtttgtaccagtaaaagagagaaacacacaggttaaatatcttcttgtggggttaaggggtagaacctatcttgccttcactctcaagataacgactcaaattaagctttttgagcaccactcttgtggggacacacatacgctgatctaggaatgaaatcttcgtggtctcaattctagatctactatgccagtttctctctggctttagcctttgagaacctgtataagaatacgtaagtaatccagagctgtgaagagtttaaaggccaacttctccagtgaactcaacctctgggtcacttgcaaccagaaattggatacctcataatgatgcaggaaagacccgagttcatgatgagtttcaaaggccacgttcatttaggaaccaactctctctggatttacctgctgagttccagcagcgtgatgggctgacatcccacctacaagtatgacacctgtgtaacaccagctaggtacggctggagaaggctgaagagagaatgccattaaatggaagaatgtactgattgtagtgaccttctccacacacacacacacacacacacacacacacacctacagtaatacagcaagcgtggaataatcagccaatatataacattccatcagtattttattaaggaaataacctgaatgtggttgattttgacatagctgcaattacagttttcttctatttttcaagccacaataaggaaaataaactactcatggtctaaatactagagataaagtagattcatggcttggtaaggaaattttaagcattccttcaaagattgacgtgctaaaataagcattgatgttttgagtttttttacacctaggatttttagcttgggtgtgtaggtgaaggccaagactctctgcaggaaaaagcttattttcaaactcagaaaataaaatgtcaatcataaaaatctacttcaactttagcaaaaagaaaaaaaaatcaacaaaaagtatactctgtatgctgggattccgaggttccaacacactgttacaaatctgtggggggtttctttcttctgataattctagagcctgttaccatagaaaggcatttcttcaatggctggttgtagttagttcatgtttttcaatcaaatttgcaaatgtatttgttgctgtatagtgattgttttgcaaaataaaattgcttgtcacct
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4133 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
            GeneID:4133 -> Molecular function: GO:0005198 [structural molecule activity] evidence: NAS
            GeneID:4133 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:4133 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IEA
            GeneID:4133 -> Molecular function: GO:0008017 [microtubule binding] evidence: IEA
            GeneID:4133 -> Biological process: GO:0001578 [microtubule bundle formation] evidence: IEA
            GeneID:4133 -> Biological process: GO:0007409 [axonogenesis] evidence: IEA
            GeneID:4133 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IEA
            GeneID:4133 -> Biological process: GO:0021954 [central nervous system neuron development] evidence: IEP
            GeneID:4133 -> Biological process: GO:0031175 [neuron projection development] evidence: IEP
            GeneID:4133 -> Biological process: GO:0048813 [dendrite morphogenesis] evidence: IEP
            GeneID:4133 -> Biological process: GO:0071310 [cellular response to organic substance] evidence: IEA
            GeneID:4133 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:4133 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
            GeneID:4133 -> Cellular component: GO:0005875 [microtubule associated complex] evidence: TAS
            GeneID:4133 -> Cellular component: GO:0034399 [nuclear periphery] evidence: IEA
            GeneID:4133 -> Cellular component: GO:0043025 [neuronal cell body] evidence: IEA
            GeneID:4133 -> Cellular component: GO:0043198 [dendritic shaft] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.