GGRNA Home | Help | Advanced search

2019-03-20 11:56:50, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002290               7355 bp    mRNA    linear   PRI 28-MAY-2013
DEFINITION  Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 2, mRNA.
ACCESSION   NM_002290
VERSION     NM_002290.4  GI:380503848
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7355)
  AUTHORS   Wang,Y., Fu,W., Xie,F., Wang,Y., Chu,X., Wang,H., Shen,M., Wang,Y.,
            Wang,Y., Sun,W., Lei,R., Yang,L., Wu,H., Foo,J., Liu,J., Jin,L. and
            Huang,W.
  TITLE     Common polymorphisms in ITGA2, PON1 and THBS2 are associated with
            coronary atherosclerosis in a candidate gene association study of
            the Chinese Han population
  JOURNAL   J. Hum. Genet. 55 (8), 490-494 (2010)
   PUBMED   20485444
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 7355)
  AUTHORS   Senyurek,I., Klein,G., Kalbacher,H., Deeg,M. and Schittek,B.
  TITLE     Peptides derived from the human laminin alpha4 and alpha5 chains
            exhibit antimicrobial activity
  JOURNAL   Peptides 31 (8), 1468-1472 (2010)
   PUBMED   20433883
  REMARK    GeneRIF: Data from experiment with peptide fragments suggest
            laminin alpha4 (and laminin alpha5) may be part of host defense
            response and may protect tissues from invading pathogens.
REFERENCE   3  (bases 1 to 7355)
  AUTHORS   Lugassy,C., Torres-Munoz,J.E., Kleinman,H.K., Ghanem,G., Vernon,S.
            and Barnhill,R.L.
  TITLE     Overexpression of malignancy-associated laminins and laminin
            receptors by angiotropic human melanoma cells in a chick
            chorioallantoic membrane model
  JOURNAL   J. Cutan. Pathol. 36 (12), 1237-1243 (2009)
   PUBMED   19469865
  REMARK    GeneRIF: LAMC2, LAMA4, ITGB1, ITGB3, RSPA and MMP2) are
            overexpressed in angiotropic melanoma cells vs. non-angiotropic
            melanoma cells from the same tumor
REFERENCE   4  (bases 1 to 7355)
  AUTHORS   Sprenger,C.C., Drivdahl,R.H., Woodke,L.B., Eyman,D., Reed,M.J.,
            Carter,W.G. and Plymate,S.R.
  TITLE     Senescence-induced alterations of laminin chain expression modulate
            tumorigenicity of prostate cancer cells
  JOURNAL   Neoplasia 10 (12), 1350-1361 (2008)
   PUBMED   19048114
  REMARK    GeneRIF: LM alpha4 and beta2 have roles in in vitro migration and
            in vivo tumorigenicity of prostate cancer cells
REFERENCE   5  (bases 1 to 7355)
  AUTHORS   Xiao,S., Lux,M.L., Reeves,R., Hudson,T.J. and Fletcher,J.A.
  TITLE     HMGI(Y) activation by chromosome 6p21 rearrangements in
            multilineage mesenchymal cells from pulmonary hamartoma
  JOURNAL   Am. J. Pathol. 150 (3), 901-910 (1997)
   PUBMED   9060828
REFERENCE   6  (bases 1 to 7355)
  AUTHORS   Richards,A., Al-Imara,L. and Pope,F.M.
  TITLE     The complete cDNA sequence of laminin alpha 4 and its relationship
            to the other human laminin alpha chains
  JOURNAL   Eur. J. Biochem. 238 (3), 813-821 (1996)
   PUBMED   8706685
REFERENCE   7  (bases 1 to 7355)
  AUTHORS   Iivanainen,A., Sainio,K., Sariola,H. and Tryggvason,K.
  TITLE     Primary structure and expression of a novel human laminin alpha 4
            chain
  JOURNAL   FEBS Lett. 365 (2-3), 183-188 (1995)
   PUBMED   7781776
REFERENCE   8  (bases 1 to 7355)
  AUTHORS   Ryan,M.C., Tizard,R., VanDevanter,D.R. and Carter,W.G.
  TITLE     Cloning of the LamA3 gene encoding the alpha 3 chain of the
            adhesive ligand epiligrin. Expression in wound repair
  JOURNAL   J. Biol. Chem. 269 (36), 22779-22787 (1994)
   PUBMED   8077230
REFERENCE   9  (bases 1 to 7355)
  AUTHORS   Richards,A.J., al-Imara,L., Carter,N.P., Lloyd,J.C., Leversha,M.A.
            and Pope,F.M.
  TITLE     Localization of the gene (LAMA4) to chromosome 6q21 and isolation
            of a partial cDNA encoding a variant laminin A chain
  JOURNAL   Genomics 22 (1), 237-239 (1994)
   PUBMED   7959779
REFERENCE   10 (bases 1 to 7355)
  AUTHORS   Burgeson,R.E., Chiquet,M., Deutzmann,R., Ekblom,P., Engel,J.,
            Kleinman,H., Martin,G.R., Meneguzzi,G., Paulsson,M., Sanes,J. et
            al.
  TITLE     A new nomenclature for the laminins
  JOURNAL   Matrix Biol. 14 (3), 209-211 (1994)
   PUBMED   7921537
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP234809.1, X91171.1,
            AB210027.1 and Z99289.1.
            On Mar 16, 2012 this sequence version replaced gi:157419121.
            
            Summary: Laminins, a family of extracellular matrix glycoproteins,
            are the major noncollagenous constituent of basement membranes.
            They have been implicated in a wide variety of biological processes
            including cell adhesion, differentiation, migration, signaling,
            neurite outgrowth and metastasis. Laminins are composed of 3 non
            identical chains: laminin alpha, beta and gamma (formerly A, B1,
            and B2, respectively) and they form a cruciform structure
            consisting of 3 short arms, each formed by a different chain, and a
            long arm composed of all 3 chains. Each laminin chain is a
            multidomain protein encoded by a distinct gene. Several isoforms of
            each chain have been described. Different alpha, beta and gamma
            chain isomers combine to give rise to different heterotrimeric
            laminin isoforms which are designated by Arabic numerals in the
            order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is
            laminin 1. The biological functions of the different chains and
            trimer molecules are largely unknown, but some of the chains have
            been shown to differ with respect to their tissue distribution,
            presumably reflecting diverse functions in vivo. This gene encodes
            the alpha chain isoform laminin, alpha 4. The domain structure of
            alpha 4 is similar to that of alpha 3, both of which resemble
            truncated versions of alpha 1 and alpha 2, in that approximately
            1,200 residues at the N-terminus (domains IV, V and VI) have been
            lost. Laminin, alpha 4 contains the C-terminal G domain which
            distinguishes all alpha chains from the beta and gamma chains. The
            RNA analysis from adult and fetal tissues revealed developmental
            regulation of expression, however, the exact function of laminin,
            alpha 4 is not known. Tissue-specific utilization of alternative
            polyA-signal has been described in literature. Alternative splicing
            results in multiple transcript variants encoding distinct isoforms.
            [provided by RefSeq, Aug 2011].
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            splice site in the 5' coding region, compared to variant 1,
            resulting in a shorter protein (isoform 2), compared to isoform 1.
            Variants 2 and 3 encode the same isoform (2).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S78569.1, X91171.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-115               BP234809.1         1-115
            116-1868            X91171.1           1-1753
            1869-6154           AB210027.1         1742-6027
            6155-7355           Z99289.1           50993-52193         c
FEATURES             Location/Qualifiers
     source          1..7355
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q21"
     gene            1..7355
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="laminin, alpha 4"
                     /db_xref="GeneID:3910"
                     /db_xref="HGNC:6484"
                     /db_xref="MIM:600133"
     exon            1..257
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            258..593
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    309..311
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="upstream in-frame stop codon"
     CDS             399..5849
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; laminin subunit alpha-4; laminin alpha 4 chain"
                     /codon_start=1
                     /product="laminin subunit alpha-4 isoform 2 precursor"
                     /protein_id="NP_002281.3"
                     /db_xref="GI:380503849"
                     /db_xref="CCDS:CCDS34514.1"
                     /db_xref="GeneID:3910"
                     /db_xref="HGNC:6484"
                     /db_xref="MIM:600133"
                     /translation="
MALSSAWRSVLPLWLLWSAACSRAASGDDNAFPFDIEGSSAVGRQDPPETSEPRVALGRLPPAAEKCNAGFFHTLSGECVPCDCNGNSNECLDGSGYCVHCQRNTTGEHCEKCLDGYIGDSIRGAPQFCQPCPCPLPHLANFAESCYRKNGAVRCICNENYAGPNCERCAPGYYGNPLLIGSTCKKCDCSGNSDPNLIFEDCDEVTGQCRNCLRNTTGFKCERCAPGYYGDARIAKNCAVCNCGGGPCDSVTGECLEEGFEPPTGCDKCVWDLTDDLRLAALSIEEGKSGVLSVSSGAAAHRHVNEINATIYLLKTKLSERENQYALRKIQINNAENTMKSLLSDVEELVEKENQASRKGQLVQKESMDTINHASQLVEQAHDMRDKIQEINNKMLYYGEEHELSPKEISEKLVLAQKMLEEIRSRQPFFTQRELVDEEADEAYELLSQAESWQRLHNETRTLFPVVLEQLDDYNAKLSDLQEALDQALNYVRDAEDMNRATAARQRDHEKQQERVREQMEVVNMSLSTSADSLTTPRLTLSELDDIIKNASGIYAEIDGAKSELQVKLSNLSNLSHDLVQEAIDHAQDLQQEANELSRKLHSSDMNGLVQKALDASNVYENIVNYVSEANETAEFALNTTDRIYDAVSGIDTQIIYHKDESENLLNQARELQAKAESSSDEAVADTSRRVGGALARKSALKTRLSDAVKQLQAAERGDAQQRLGQSRLITEEANRTTMEVQQATAPMANNLTNWSQNLQHFDSSAYNTAVNSARDAVRNLTEVVPQLLDQLRTVEQKRPASNVSASIQRIRELIAQTRSVASKIQVSMMFDGQSAVEVHSRTSMDDLKAFTSLSLYMKPPVKRPELTETADQFILYLGSKNAKKEYMGLAIKNDNLVYVYNLGTKDVEIPLDSKPVSSWPAYFSIVKIERVGKHGKVFLTVPSLSSTAEEKFIKKGEFSGDDSLLDLDPEDTVFYVGGVPSNFKLPTSLNLPGFVGCLELATLNNDVISLYNFKHIYNMDPSTSVPCARDKLAFTQSRAASYFFDGSGYAVVRDITRRGKFGQVTRFDIEVRTPADNGLILLMVNGSMFFRLEMRNGYLHVFYDFGFSGGPVHLEDTLKKAQINDAKYHEISIIYHNDKKMILVVDRRHVKSMDNEKMKIPFTDIYIGGAPPEILQSRALRAHLPLDINFRGCMKGFQFQKKDFNLLEQTETLGVGYGCPEDSLISRRAYFNGQSFIASIQKISFFDGFEGGFNFRTLQPNGLLFYYASGSDVFSISLDNGTVIMDVKGIKVQSVDKQYNDGLSHFVISSVSPTRYELIVDKSRVGSKNPTKGKIEQTQASEKKFYFGGSPISAQYANFTGCISNAYFTRVDRDVEVEDFQRYTEKVHTSLYECPIESSPLFLLHKKGKNLSKPKASQNKKGGKSKDAPSWDPVALKLPERNTPRNSHCHLSNSPRAIEHAYQYGGTANSRQEFEHLKGDFGAKSQFSIRLRTRSSHGMIFYVSDQEENDFMTLFLAHGRLVYMFNVGHKKLKIRSQEKYNDGLWHDVIFIRERSSGRLVIDGLRVLEESLPPTEATWKIKGPIYLGGVAPGKAVKNVQINSIYSFSGCLSNLQLNGASITSASQTFSVTPCFEGPMETGTYFSTEGGYVVLDESFNIGLKFEIAFEVRPRSSSGTLVHGHSVNGEYLNVHMKNGQVIVKVNNGIRDFSTSVTPKQSLCDGRWHRITVIRDSNVVQLDVDSEVNHVVGPLNPKPIDHREPVFVGGVPESLLTPRLAPSKPFTGCIRHFVIDGHPVSFSKAALVSGAVSINSCPAA
"
     sig_peptide     399..479
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     480..5846
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /product="laminin subunit alpha-4 isoform 2"
     misc_feature    639..770
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin-type epidermal growth factor-like domain;
                     laminins are the major noncollagenous components of
                     basement membranes that mediate cell adhesion, growth
                     migration, and differentiation; the laminin-type epidermal
                     growth factor-like module occurs in...; Region: EGF_Lam;
                     cd00055"
                     /db_xref="CDD:28937"
     misc_feature    642..761
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin EGF-like (Domains III and V); Region:
                     Laminin_EGF; pfam00053"
                     /db_xref="CDD:200961"
     misc_feature    order(642..644,648..650,669..671,690..692,699..701,
                     726..728)
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="EGF-like motif; other site"
                     /db_xref="CDD:28937"
     misc_feature    810..950
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin EGF-like (Domains III and V); Region:
                     Laminin_EGF; pfam00053"
                     /db_xref="CDD:200961"
     misc_feature    816..953
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin-type epidermal growth factor-like domain;
                     laminins are the major noncollagenous components of
                     basement membranes that mediate cell adhesion, growth
                     migration, and differentiation; the laminin-type epidermal
                     growth factor-like module occurs in...; Region: EGF_Lam;
                     cd00055"
                     /db_xref="CDD:28937"
     misc_feature    order(834..836,861..863,867..869,894..896)
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="EGF-like motif; other site"
                     /db_xref="CDD:28937"
     misc_feature    957..1112
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin-type epidermal growth factor-like domain;
                     laminins are the major noncollagenous components of
                     basement membranes that mediate cell adhesion, growth
                     migration, and differentiation; the laminin-type epidermal
                     growth factor-like module occurs in...; Region: EGF_Lam;
                     cd00055"
                     /db_xref="CDD:28937"
     misc_feature    957..1097
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin EGF-like (Domains III and V); Region:
                     Laminin_EGF; pfam00053"
                     /db_xref="CDD:200961"
     misc_feature    order(957..959,963..965,1002..1004,1023..1025,1032..1034,
                     1059..1061)
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="EGF-like motif; other site"
                     /db_xref="CDD:28937"
     misc_feature    1299..2042
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin Domain I; Region: Laminin_I; pfam06008"
                     /db_xref="CDD:191425"
     misc_feature    1392..1982
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    1665..1682
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    1698..2549
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Uncharacterized archaeal coiled-coil protein
                     [Function unknown]; Region: COG1340"
                     /db_xref="CDD:31531"
     misc_feature    2400..>2948
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="HlyD family secretion protein; Region: HlyD;
                     pfam00529"
                     /db_xref="CDD:109580"
     misc_feature    2577..2960
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin Domain II; Region: Laminin_II; pfam06009"
                     /db_xref="CDD:203372"
     misc_feature    2880..3413
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin G domain; Laminin G-like domains are
                     usually Ca++ mediated receptors that can have binding
                     sites for steroids, beta1 integrins, heparin, sulfatides,
                     fibulin-1, and alpha-dystroglycans. Proteins that contain
                     LamG domains serve a variety of...; Region: LamG; cd00110"
                     /db_xref="CDD:29010"
     misc_feature    3522..3998
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin G domain; Laminin G-like domains are
                     usually Ca++ mediated receptors that can have binding
                     sites for steroids, beta1 integrins, heparin, sulfatides,
                     fibulin-1, and alpha-dystroglycans. Proteins that contain
                     LamG domains serve a variety of...; Region: LamG; cd00110"
                     /db_xref="CDD:29010"
     misc_feature    4086..4505
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin G domain; Laminin G-like domains are
                     usually Ca++ mediated receptors that can have binding
                     sites for steroids, beta1 integrins, heparin, sulfatides,
                     fibulin-1, and alpha-dystroglycans. Proteins that contain
                     LamG domains serve a variety of...; Region: LamG; cd00110"
                     /db_xref="CDD:29010"
     misc_feature    4842..5249
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin G domain; Laminin G-like domains are
                     usually Ca++ mediated receptors that can have binding
                     sites for steroids, beta1 integrins, heparin, sulfatides,
                     fibulin-1, and alpha-dystroglycans. Proteins that contain
                     LamG domains serve a variety of...; Region: LamG; cd00110"
                     /db_xref="CDD:29010"
     misc_feature    5322..5774
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /note="Laminin G domain; Laminin G-like domains are
                     usually Ca++ mediated receptors that can have binding
                     sites for steroids, beta1 integrins, heparin, sulfatides,
                     fibulin-1, and alpha-dystroglycans. Proteins that contain
                     LamG domains serve a variety of...; Region: LamG; cd00110"
                     /db_xref="CDD:29010"
     variation       505
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:70940809"
     exon            594..695
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       678
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35349917"
     exon            696..820
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            821..901
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            902..1116
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            1117..1191
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            1192..1343
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            1344..1454
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       1349
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:70940813"
     exon            1455..1566
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            1567..1734
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            1735..1928
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       1869
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050348"
     exon            1929..2045
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2046..2194
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2195..2336
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2337..2433
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2434..2550
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       2522
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:70940810"
     exon            2551..2730
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2731..2870
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            2871..3044
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       3032
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35772073"
     exon            3045..3190
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       3187
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35605307"
     exon            3191..3353
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            3354..3487
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            3488..3659
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            3660..3791
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       3733
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050349"
     exon            3792..3934
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            3935..4073
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            4074..4211
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            4212..4345
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       4320
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:70940811"
     exon            4346..4510
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       4442
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34753919"
     exon            4511..4664
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       4550
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35042032"
     exon            4665..4852
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            4853..5042
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       4935
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34256052"
     exon            5043..5198
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       5093
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35679345"
     exon            5199..5358
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            5359..5489
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            5490..5583
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     variation       5537
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1050353"
     exon            5584..5703
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     exon            5704..7355
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /inference="alignment:Splign:1.39.8"
     STS             5819..5929
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /standard_name="D6S1133E"
                     /db_xref="UniSTS:35049"
     variation       5820
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3734292"
     variation       5896
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11495"
     STS             5971..6097
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /standard_name="RH18133"
                     /db_xref="UniSTS:76207"
     variation       6066
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1050447"
     polyA_signal    6131..6136
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
     polyA_site      6157
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
     STS             7188..7287
                     /gene="LAMA4"
                     /gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
                     /standard_name="A006N46"
                     /db_xref="UniSTS:28608"
ORIGIN      
gaatattcttctggagcccttggaggggctccaaactgagaggggagggaagaccgcagggaaaggcggacctcagtgtctgaaaagccagcttagagtgggagggcctgggagtagaaggtaaaaagggagtggtgagaatgaatgtgagaaggaagccaggacagcgcagtccccagtcccgaacggccagggagaggaggtggcctagcgctggcggggctcaccccaatccgtctgccttttgatgccgtactctgctggttgcgcagccacctcgggatactgcacacggagaggagggaaaataagcgaggcaccgccgcaccacgcgggagacctacggagacccacagcgcccgagccctggaagagcactactggatgtcagcggagaaatggctttgagctcagcctggcgctcggttctgcctctgtggctcctctggagcgctgcctgctcccgcgccgcgtccggggacgacaacgcttttccttttgacattgaagggagctcagcggttggcaggcaagacccgcctgagacgagcgaaccccgcgtggctctgggacgcctgccgcctgcggccgagaaatgcaatgctggattctttcacaccctgtcgggagaatgtgtgccctgcgactgtaatggcaattccaacgagtgtttggacggctcaggatactgtgtgcactgccagcggaacacaacaggagagcactgtgaaaagtgtctggatggttatatcggagattccatcaggggagcaccccaattctgccagccgtgcccctgtcccctgccccacttggccaattttgcagaatcctgctataggaaaaatggagctgttcggtgcatttgtaacgaaaattatgctggacctaactgtgaaagatgtgctcccggttactatggaaaccccttactcattggaagcacctgtaagaaatgtgactgcagtggaaattcagatcccaacctgatctttgaagattgtgatgaagtcactggccagtgtaggaattgcttacgcaacaccaccggattcaagtgtgaacgttgcgctcctggctactatggggacgccaggatagccaagaactgtgcagtgtgcaactgcgggggaggcccatgtgacagtgtaaccggagaatgcttggaagaaggttttgaaccccctacaggctgtgataagtgcgtctgggacctgactgatgacctgcggttagcagcgctctccatcgaggaaggcaaatccggggtgctgagcgtatcctctggggccgccgctcataggcacgtgaatgaaatcaacgccaccatctacctcctcaaaacaaaattgtcagaaagagaaaaccaatacgccctaagaaagatacaaatcaacaatgctgagaacacgatgaaaagccttctgtctgacgtagaggaattagttgaaaaggaaaatcaagcctccagaaaaggacaacttgttcagaaggaaagcatggacaccattaaccacgcaagtcagctggtagagcaagcccatgatatgagggataaaatccaagagatcaacaacaagatgctctattatggggaagagcatgaacttagccccaaggaaatctctgagaagctggtgttggcccagaagatgcttgaagagattagaagccgtcaaccatttttcacccaacgggagctcgtggatgaggaggcagatgaggcttacgaactactgagccaggctgagagctggcagcggctgcacaatgagacccgcactctgtttcctgtcgtcctggagcagctggatgactacaatgctaagttgtcagatctccaggaagcacttgaccaggcccttaactatgtcagggatgccgaagacatgaacagggccacagcagccaggcagcgggaccatgagaaacaacaggaaagagtgagggaacaaatggaagtggtgaacatgtctctgagcacatctgcggactctctgacaacacctcgtctaactctttcagaacttgatgatataataaagaatgcgtcagggatttatgcagaaatagatggagccaaaagtgaactacaagtaaaactatctaacctaagtaacctcagccatgatttagtccaagaagctattgaccatgcacaggaccttcaacaagaagctaatgaattgagcaggaagttgcacagttcagatatgaacgggctggtacagaaggctttggatgcatcaaatgtctatgaaaatattgttaattatgttagtgaagccaatgaaacagcagaatttgctttgaacaccactgaccgaatttatgatgcggtgagtgggattgatactcaaatcatttaccataaagatgaaagtgagaacctcctcaatcaagccagagaactgcaagcaaaggcagagtctagcagtgatgaagcagtggctgacactagcaggcgtgtgggtggagccctagcaaggaaaagtgcccttaaaaccagactcagtgatgccgttaagcaactacaagcagcagagagaggggatgcccagcagcgcctggggcagtctagactgatcaccgaggaagccaacaggacgacgatggaggtgcagcaggccactgcccccatggccaacaatctaaccaactggtcacagaatcttcaacattttgactcttctgcttacaacactgcagtgaactctgctagggatgcagtaagaaatctgaccgaggttgtccctcagctcctggatcagcttcgtacggttgagcagaagcgacctgcaagcaacgtttctgccagcatccagaggatccgagagctcattgctcagaccagaagtgttgccagcaagatccaagtctccatgatgtttgatggccagtcagctgtggaagtgcactcgagaaccagtatggatgacttaaaggccttcacgtctctgagcctgtacatgaaaccccctgtgaagcggccggaactgaccgagactgcagatcagtttatcctgtacctcggaagcaaaaacgccaaaaaagagtatatgggtcttgcaatcaaaaatgataatctggtatacgtctataatttgggaactaaagatgtggagattcccctggactccaagcccgtcagttcctggcctgcttacttcagcattgtcaagattgaaagggtgggaaaacatggaaaggtgtttttaacagtcccgagtctaagtagcacagcagaggaaaagttcattaaaaagggggaattttcgggagatgactctctgctggacctggaccctgaggacacagtgttttatgttggtggagtgccttccaacttcaagctccctaccagcttaaacctgcctggctttgttggctgcctggaactggccactttgaataatgatgtgatcagcttgtacaactttaagcacatctataatatggacccctccacatcagtgccatgtgcccgagataagctggccttcactcagagtcgggctgccagttacttcttcgatggctccggttatgccgtggtgagagacatcacaaggagagggaaatttggtcaggtgactcgctttgacatagaagttcgaacaccagctgacaacggccttattctcctgatggtcaatggaagtatgtttttcagactggaaatgcgcaatggttacctacatgtgttctatgattttggattcagcggtggccctgtgcatcttgaagatacgttaaagaaagctcaaattaatgatgcaaaataccatgagatctcaatcatttaccacaatgataagaaaatgatcttggtagttgacagaaggcatgtcaagagcatggataatgaaaagatgaaaataccttttacagatatatacattggaggagctcctccagaaatcttacaatccagggccctcagagcacaccttcccctagatatcaacttcagaggatgcatgaagggcttccagttccaaaagaaggacttcaatttactggagcagacagaaaccctgggagttggttatggatgcccagaagactcacttatatctcgcagagcatatttcaatggacagagcttcattgcttcaattcagaaaatatctttctttgatggctttgaaggaggttttaatttccgaacattacaaccaaatgggttactattctattatgcttcagggtcagacgtgttctccatctcactggataatggtactgtcatcatggatgtaaagggaatcaaagttcagtcagtagataagcagtacaatgatgggctgtcccacttcgtcattagctctgtctcacccacaagatatgaactgatagtagataaaagcagagttgggagtaagaatcctaccaaagggaaaatagaacagacacaagcaagtgaaaagaagttttacttcggtggctcaccaatcagtgctcagtatgctaatttcactggctgcataagtaatgcctactttaccagggtggatagagatgtggaggttgaagatttccaacggtatactgaaaaggtccacacttctctttatgagtgtcccattgagtcttcaccattgtttctcctccataaaaaaggaaaaaatttatccaagcctaaagcaagtcagaataaaaagggagggaaaagtaaagatgcaccttcatgggatcctgttgctctgaaactcccagagcggaatactccaagaaactctcattgccacctttccaacagccctagagcaatagagcacgcctatcaatatggaggaacagccaacagccgccaagagtttgaacacttaaaaggagattttggtgccaaatctcagttttccattcgtctgagaactcgttcctcccatggcatgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggcccatggccgcttggtttacatgtttaatgttggtcacaaaaaactgaagattagaagccaggagaaatacaatgatggcctgtggcatgatgtgatatttattcgagaaaggagcagtggccgactggtaattgatggtctccgagtcctagaagaaagtcttcctcctactgaagctacctggaaaatcaagggtcccatttatttgggaggtgtggctcctggaaaggctgtgaaaaatgttcagattaactccatctacagttttagtggctgtctcagcaatctccagctcaatggggcctccatcacctctgcttctcagacattcagtgtgaccccttgctttgaaggccccatggaaacaggaacttacttttcaacagaaggaggatacgtggttctagatgaatctttcaatattggattgaagtttgaaattgcatttgaagtccgtcccagaagcagttccggaaccctggtccacggccacagtgtcaatggggagtacctaaatgttcacatgaaaaatggacaggtcatagtgaaagtcaataatggcatcagagatttttccacctcagttacacccaagcagagtctctgtgatggcagatggcacagaattacagttattagagattctaatgtggttcagttggatgtggactctgaagtgaaccatgtggttggacccctgaatccaaaaccaattgatcacagggagcctgtgtttgttggaggtgttccagaatctctactgacaccacgcttggcccccagcaaacccttcacaggctgcatacgccactttgtgattgatggacacccagtgagcttcagtaaagcagccctggtcagcggcgccgtaagcatcaactcctgtccagcagcctgacatgacagagcacagctgcccaaatacaaagttctttagagcactgaaagaaacacaaagccagccaggaggaacagtaactcttccttcgggtggaagctttcatcgagttgaacaggacttaaacgaatcatcagggaccggatatttcttatttctcatttggattcttaaccttgaatccaaagtgtctgcaatggacaacaattgaaggagtggcaaacttacttgtattgagagcacacgcaattcctactggtgaaattactgtttctgtttctaataaaatagaagggattccaaataaacacttgcacacatttttgaagtgcggctagattctcagattcacctttcttccagggaagataactttcaatctatataaaaatctctgtcctaaaactacctttctttattttgaagagacttactaacttacatataatctaaattagatgatagatttgtttttagcccttttgtttggtctatcagtataagaagaatattttaggtttatagctgaagttatcaaggtttaataaagtaaatttctaacagaatactagaaaaatgcagtataatttaattttttctaaataagaaacacaggaaatcaactactttttccccttccttatctccttaaaagaaaaataaaattgtacatgagaggaggcttctgtaggttattattaccattattgtgtgttctatgggaatcattgaggatatcacagcaaaaacagtaggacaaaatcataaaattcaatttaagagtacacaagtccttttattaaaagtttgctcctagcctgggcaacataatgagatcccatctctgcaaaaaaatttgtacatgggcatacacctgtagtcccagctacttgggaggctgagacgggaggatcgcttaagctcaggagttcaaggctgcagtgagctatgactgctgactgtacctgcactccagcctgggcaacagagtgagatcctgtctcaaaaacaaagtgtgctctccacatacctgcaacacaactagtcttatttctaaaatgttataatcttttttccaagtagctacattaatatagtctagaaaaaaatggacttgaatagctggtagaatattaaaatatagaaatgaaataaaagaattatatctaaaaacctcaactcagaagacagaaaaagagaaaataggccctgatatcaacagaattaacaatacataaaaggagtaacttttgaggggagaggatataaaatattttgaggaattaccaaggggaataaaacaatgttaccttgaaatgattatatatatattacatattggtatatatgtccatacctacctatatcccctgctacccttctgtctgaaatatacaaataatgataatgttgaagatatcgataaacatagctaatgtctgttcatagaggacttactaagtgccagccaccatgataagctaaagttaattattttatttgttc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3910 -> Molecular function: GO:0005102 [receptor binding] evidence: IEA
            GeneID:3910 -> Molecular function: GO:0005201 [extracellular matrix structural constituent] evidence: TAS
            GeneID:3910 -> Biological process: GO:0001568 [blood vessel development] evidence: IEA
            GeneID:3910 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
            GeneID:3910 -> Biological process: GO:0030155 [regulation of cell adhesion] evidence: IEA
            GeneID:3910 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:3910 -> Biological process: GO:0030334 [regulation of cell migration] evidence: IEA
            GeneID:3910 -> Biological process: GO:0045995 [regulation of embryonic development] evidence: IEA
            GeneID:3910 -> Biological process: GO:0050873 [brown fat cell differentiation] evidence: IEA
            GeneID:3910 -> Cellular component: GO:0005604 [basement membrane] evidence: IDA
            GeneID:3910 -> Cellular component: GO:0005605 [basal lamina] evidence: TAS
            GeneID:3910 -> Cellular component: GO:0005606 [laminin-1 complex] evidence: IEA
            GeneID:3910 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS
            GeneID:3910 -> Cellular component: GO:0070062 [extracellular vesicular exosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.