GGRNA Home | Help | Advanced search

2020-10-26 19:29:20, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002258                740 bp    mRNA    linear   PRI 02-JUN-2013
DEFINITION  Homo sapiens killer cell lectin-like receptor subfamily B, member 1
            (KLRB1), mRNA.
ACCESSION   NM_002258
VERSION     NM_002258.2  GI:58761538
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 740)
  AUTHORS   Pesenacker,A.M., Bending,D., Ursu,S., Wu,Q., Nistala,K. and
            Wedderburn,L.R.
  TITLE     CD161 defines the subset of FoxP3+ T cells capable of producing
            proinflammatory cytokines
  JOURNAL   Blood 121 (14), 2647-2658 (2013)
   PUBMED   23355538
  REMARK    GeneRIF: Here we present a distinct population of Treg, defined by
            CD161 expression, as the major source of FoxP3+ Treg-derived
            proinflammatory cytokines.
REFERENCE   2  (bases 1 to 740)
  AUTHORS   Schirmer,L., Rothhammer,V., Hemmer,B. and Korn,T.
  TITLE     Enriched CD161high CCR6+ gammadelta T cells in the cerebrospinal
            fluid of patients with multiple sclerosis
  JOURNAL   JAMA Neurol 70 (3), 345-351 (2013)
   PUBMED   23599932
  REMARK    GeneRIF: The fraction of CD161high T cells is significantly higher
            in cerebrospinal fluid of patients with multiple sclerosis in
            relapse than those of controls.
REFERENCE   3  (bases 1 to 740)
  AUTHORS   Samson,M., Audia,S., Fraszczak,J., Trad,M., Ornetti,P., Lakomy,D.,
            Ciudad,M., Leguy,V., Berthier,S., Vinit,J., Manckoundia,P.,
            Maillefert,J.F., Besancenot,J.F., Aho-Glele,S., Olsson,N.O.,
            Lorcerie,B., Guillevin,L., Mouthon,L., Saas,P., Bateman,A.,
            Martin,L., Janikashvili,N., Larmonier,N. and Bonnotte,B.
  TITLE     Th1 and Th17 lymphocytes expressing CD161 are implicated in giant
            cell arteritis and polymyalgia rheumatica pathogenesis
  JOURNAL   Arthritis Rheum. 64 (11), 3788-3798 (2012)
   PUBMED   22833233
  REMARK    GeneRIF: CD161+CD4+ T lymphocytes, differentiated into Th1 cells
            and Th17 cells, are involved in the pathogenesis of giant cell
            arteritis and polymyalgia rheumatica.
REFERENCE   4  (bases 1 to 740)
  AUTHORS   Germain,C., Meier,A., Jensen,T., Knapnougel,P., Poupon,G.,
            Lazzari,A., Neisig,A., Hakansson,K., Dong,T., Wagtmann,N.,
            Galsgaard,E.D., Spee,P. and Braud,V.M.
  TITLE     Induction of lectin-like transcript 1 (LLT1) protein cell surface
            expression by pathogens and interferon-gamma contributes to
            modulate immune responses
  JOURNAL   J. Biol. Chem. 286 (44), 37964-37975 (2011)
   PUBMED   21930700
  REMARK    GeneRIF: LLT1 and CD161 have roles in modulating immune responses
            to pathogens; and interferon-gamma contributes to modulate immune
            responses
REFERENCE   5  (bases 1 to 740)
  AUTHORS   Mjosberg,J.M., Trifari,S., Crellin,N.K., Peters,C.P., van
            Drunen,C.M., Piet,B., Fokkens,W.J., Cupedo,T. and Spits,H.
  TITLE     Human IL-25- and IL-33-responsive type 2 innate lymphoid cells are
            defined by expression of CRTH2 and CD161
  JOURNAL   Nat. Immunol. 12 (11), 1055-1062 (2011)
   PUBMED   21909091
  REMARK    GeneRIF: expression defines IL-25- and IL-33-responsive type 2
            innate lymphoid cells
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 740)
  AUTHORS   Poggi,A., Rubartelli,A., Moretta,L. and Zocchi,M.R.
  TITLE     Expression and function of NKRP1A molecule on human monocytes and
            dendritic cells
  JOURNAL   Eur. J. Immunol. 27 (11), 2965-2970 (1997)
   PUBMED   9394825
REFERENCE   7  (bases 1 to 740)
  AUTHORS   Poggi,A., Costa,P., Zocchi,M.R. and Moretta,L.
  TITLE     Phenotypic and functional analysis of CD4+ NKRP1A+ human T
            lymphocytes. Direct evidence that the NKRP1A molecule is involved
            in transendothelial migration
  JOURNAL   Eur. J. Immunol. 27 (9), 2345-2350 (1997)
   PUBMED   9341779
REFERENCE   8  (bases 1 to 740)
  AUTHORS   Renedo,M., Arce,I., Rodriguez,A., Carretero,M., Lanier,L.L.,
            Lopez-Botet,M. and Fernandez-Ruiz,E.
  TITLE     The human natural killer gene complex is located on chromosome
            12p12-p13
  JOURNAL   Immunogenetics 46 (4), 307-311 (1997)
   PUBMED   9218532
REFERENCE   9  (bases 1 to 740)
  AUTHORS   Poggi,A., Costa,P., Morelli,L., Cantoni,C., Pella,N., Spada,F.,
            Biassoni,R., Nanni,L., Revello,V., Tomasello,E., Mingari,M.C.,
            Moretta,A. and Moretta,L.
  TITLE     Expression of human NKRP1A by CD34+ immature thymocytes:
            NKRP1A-mediated regulation of proliferation and cytolytic activity
  JOURNAL   Eur. J. Immunol. 26 (6), 1266-1272 (1996)
   PUBMED   8647203
REFERENCE   10 (bases 1 to 740)
  AUTHORS   Lanier,L.L., Chang,C. and Phillips,J.H.
  TITLE     Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin
            superfamily expressed by a subset of NK and T lymphocytes
  JOURNAL   J. Immunol. 153 (6), 2417-2428 (1994)
   PUBMED   8077657
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BF432813.1 and U11276.1.
            On Feb 8, 2005 this sequence version replaced gi:4504878.
            
            Summary: Natural killer (NK) cells are lymphocytes that mediate
            cytotoxicity and secrete cytokines after immune stimulation.
            Several genes of the C-type lectin superfamily, including the
            rodent NKRP1 family of glycoproteins, are expressed by NK cells and
            may be involved in the regulation of NK cell function. The KLRB1
            protein contains an extracellular domain with several motifs
            characteristic of C-type lectins, a transmembrane domain, and a
            cytoplasmic domain. The KLRB1 protein is classified as a type II
            membrane protein because it has an external C terminus. [provided
            by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U11276.1, AK292022.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025083 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-6                 BF432813.1         2-7
            7-740               U11276.1           5-738
FEATURES             Location/Qualifiers
     source          1..740
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13"
     gene            1..740
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /note="killer cell lectin-like receptor subfamily B,
                     member 1"
                     /db_xref="GeneID:3820"
                     /db_xref="HGNC:6373"
                     /db_xref="HPRD:04201"
                     /db_xref="MIM:602890"
     exon            1..147
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     STS             13..740
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /db_xref="UniSTS:489719"
     variation       complement(14)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371674424"
     misc_feature    39..41
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /note="upstream in-frame stop codon"
     variation       complement(46)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34694858"
     CDS             63..740
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /note="C-type lectin domain family 5 member B; natural
                     killer cell surface protein P1A"
                     /codon_start=1
                     /product="killer cell lectin-like receptor subfamily B
                     member 1"
                     /protein_id="NP_002249.1"
                     /db_xref="GI:4504879"
                     /db_xref="CCDS:CCDS8601.1"
                     /db_xref="GeneID:3820"
                     /db_xref="HGNC:6373"
                     /db_xref="HPRD:04201"
                     /db_xref="MIM:602890"
                     /translation="
MDQQAIYAELNLPTDSGPESSSPSSLPRDVCQGSPWHQFALKLSCAGIILLVLVVTGLSVSVTSLIQKSSIEKCSVDIQQSRNKTTERPGLLNCPIYWQQLREKCLLFSHTVNPWNNSLADCSTKESSLLLIRDKDELIHTQNLIRDKAILFWIGLNFSLSEKNWKWINGSFLNSNDLEIRGDAKENSCISISQTSVYSEYCSTEIRWICQKELTPVRNKVYPDS
"
     misc_feature    198..260
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q12918.1);
                     transmembrane region"
     misc_feature    342..698
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /note="C-type lectin-like domain (CTLD) of the type found
                     in natural killer cell receptors (NKRs); Region:
                     CLECT_NK_receptors_like; cd03593"
                     /db_xref="CDD:153063"
     misc_feature    order(513..515,597..599,648..650,654..659)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153063"
     variation       complement(83)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375339427"
     variation       complement(117)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144231382"
     variation       complement(118)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374663582"
     variation       complement(124)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201764859"
     exon            148..246
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(148)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199501569"
     variation       complement(154)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139525269"
     variation       complement(164)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200584129"
     variation       complement(170)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376673125"
     variation       complement(206)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200576922"
     exon            247..321
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(260)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149244748"
     variation       complement(262)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142063673"
     variation       complement(282)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372327595"
     variation       complement(296)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148761043"
     exon            322..476
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(340)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144354266"
     variation       complement(350)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200532656"
     variation       complement(359)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367849252"
     variation       complement(369)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141057839"
     variation       complement(400)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138352143"
     variation       complement(444)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34919993"
     variation       complement(445)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373666093"
     variation       complement(470)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143372540"
     exon            477..592
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(478)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137930946"
     variation       complement(499)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146949020"
     variation       complement(509)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80165137"
     variation       complement(565)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1135816"
     variation       complement(569)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34291189"
     exon            593..740
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(642)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368637659"
     variation       complement(682)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368537511"
     variation       complement(703)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371875963"
     variation       complement(705)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369315470"
     variation       complement(715)
                     /gene="KLRB1"
                     /gene_synonym="CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1;
                     NKR-P1A; NKRP1A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367658071"
ORIGIN      
gcctcacagaattgagagtttgttcttacacacaagtttaatgccaccttcctctgtctgccatggaccaacaagcaatatatgctgagttaaacttacccacagactcaggcccagaaagttcttcaccttcatctcttcctcgggatgtctgtcagggttcaccttggcatcaatttgccctgaaacttagctgtgctgggattattctccttgtcttggttgttactgggttgagtgtttcagtgacatccttaatacagaaatcatcaatagaaaaatgcagtgtggacattcaacagagcaggaataaaacaacagagagaccgggtctcttaaactgcccaatatattggcagcaactccgagagaaatgcttgttattttctcacactgtcaacccttggaataacagtctagctgattgttccaccaaagaatccagcctgctgcttattcgagataaggatgaattgatacacacacagaacctgatacgtgacaaagcaattctgttttggattggattaaatttttcattatcagaaaagaactggaagtggataaacggctcttttttaaattctaatgacttagaaattagaggtgatgctaaagaaaacagctgtatttccatctcacagacatctgtgtattctgagtactgtagtacagaaatcagatggatctgccaaaaagaactaacacctgtgagaaataaagtgtatcctgactcttga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3820 -> Molecular function: GO:0004888 [transmembrane signaling receptor activity] evidence: TAS
            GeneID:3820 -> Molecular function: GO:0030246 [carbohydrate binding] evidence: IEA
            GeneID:3820 -> Biological process: GO:0007166 [cell surface receptor signaling pathway] evidence: TAS
            GeneID:3820 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:3820 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.