GGRNA Home | Help | Advanced search

2019-03-23 03:30:02, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002254               5431 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens kinesin family member 3C (KIF3C), mRNA.
ACCESSION   NM_002254
VERSION     NM_002254.6  GI:133930788
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5431)
  AUTHORS   Davidovic,L., Jaglin,X.H., Lepagnol-Bestel,A.M., Tremblay,S.,
            Simonneau,M., Bardoni,B. and Khandjian,E.W.
  TITLE     The fragile X mental retardation protein is a molecular adaptor
            between the neurospecific KIF3C kinesin and dendritic RNA granules
  JOURNAL   Hum. Mol. Genet. 16 (24), 3047-3058 (2007)
   PUBMED   17881655
  REMARK    GeneRIF: FMRP acts also as a molecular adaptor between RNA granules
            and the neurospecific kinesin KIF3C.
REFERENCE   2  (bases 1 to 5431)
  AUTHORS   Muresan,V., Abramson,T., Lyass,A., Winter,D., Porro,E., Hong,F.,
            Chamberlin,N.L. and Schnapp,B.J.
  TITLE     KIF3C and KIF3A form a novel neuronal heteromeric kinesin that
            associates with membrane vesicles
  JOURNAL   Mol. Biol. Cell 9 (3), 637-652 (1998)
   PUBMED   9487132
REFERENCE   3  (bases 1 to 5431)
  AUTHORS   Sardella,M., Navone,F., Rocchi,M., Rubartelli,A., Viggiano,L.,
            Vignali,G., Consalez,G.G., Sitia,R. and Cabibbo,A.
  TITLE     KIF3C, a novel member of the kinesin superfamily: sequence,
            expression, and mapping to human chromosome 2 at 2p23
  JOURNAL   Genomics 47 (3), 405-408 (1998)
   PUBMED   9480755
REFERENCE   4  (bases 1 to 5431)
  AUTHORS   Yang,Z. and Goldstein,L.S.
  TITLE     Characterization of the KIF3C neural kinesin-like motor from mouse
  JOURNAL   Mol. Biol. Cell 9 (2), 249-261 (1998)
   PUBMED   9450952
REFERENCE   5  (bases 1 to 5431)
  AUTHORS   Telford,E.A., Wightman,P., Leek,J., Markham,A.F., Lench,N.J. and
            Bonthron,D.T.
  TITLE     cDNA cloning, genomic organization, and chromosomal localization of
            a novel human gene that encodes a kinesin-related protein highly
            similar to mouse Kif3C
  JOURNAL   Biochem. Biophys. Res. Commun. 242 (2), 407-412 (1998)
   PUBMED   9446808
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC013449.8, BC092406.1, AC064847.4 and DB303776.1.
            On Mar 22, 2007 this sequence version replaced gi:41352704.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX571741.1, AF035621.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-115               AC013449.8         53046-53160         c
            116-803             BC092406.1         1-688
            804-804             AC013449.8         52357-52357         c
            805-3242            BC092406.1         690-3127
            3243-4112           AC064847.4         135419-136288       c
            4113-4237           BC092406.1         3998-4122
            4238-4917           AC064847.4         134614-135293       c
            4918-5431           DB303776.1         1-514               c
FEATURES             Location/Qualifiers
     source          1..5431
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2p23"
     gene            1..5431
                     /gene="KIF3C"
                     /note="kinesin family member 3C"
                     /db_xref="GeneID:3797"
                     /db_xref="HGNC:6321"
                     /db_xref="HPRD:04164"
                     /db_xref="MIM:602845"
     exon            1..2202
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     variation       150..151
                     /gene="KIF3C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2165195"
     variation       363
                     /gene="KIF3C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1465877"
     variation       451
                     /gene="KIF3C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2119105"
     variation       496
                     /gene="KIF3C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2119106"
     misc_feature    601..603
                     /gene="KIF3C"
                     /note="upstream in-frame stop codon"
     CDS             658..3039
                     /gene="KIF3C"
                     /note="KIF3C variant protein"
                     /codon_start=1
                     /product="kinesin-like protein KIF3C"
                     /protein_id="NP_002245.4"
                     /db_xref="GI:41352705"
                     /db_xref="CCDS:CCDS1719.1"
                     /db_xref="GeneID:3797"
                     /db_xref="HGNC:6321"
                     /db_xref="HPRD:04164"
                     /db_xref="MIM:602845"
                     /translation="
MASKTKASEALKVVARCRPLSRKEEAAGHEQILTMDVKLGQVTLRNPRAAPGELPKTFTFDAVYDASSKQADLYDETVRPLIDSVLQGFNGTVFAYGQTGTGKTYTMQGTWVEPELRGVIPNAFEHIFTHISRSQNQQYLVRASYLEIYQEEIRDLLSKEPGKRLELKENPETGVYIKDLSSFVTKNVKEIEHVMNLGNQTRAVGSTHMNEVSSRSHAIFIITVECSERGSDGQDHIRVGKLNLVDLAGSERQNKAGPNTAGGAATPSSGGGGGGGGSGGGAGGERPKEASKINLSLSALGNVIAALAGNRSTHIPYRDSKLTRLLQDSLGGNAKTIMVATLGPASHSYDESLSTLRFANRAKNIKNKPRVNEDPKDTLLREFQEEIARLKAQLEKRGMLGKRPRRKSSRRKKAVSAPPGYPEGPVIEAWVAEEEDDNNNNHRPPQPILESALEKNMENYLQEQKERLEEEKAAIQDDRSLVSEEKQKLLEEKEKMLEDLRREQQATELLAAKYKAMESKLLIGGRNIMDHTNEQQKMLELKRQEIAEQKRREREMQQEMMLRDEETMELRGTYTSLQQEVEVKTKKLKKLYAKLQAVKAEIQDQHDEYIRVRQDLEEAQNEQTRELKLKYLIIENFIPPEEKNKIMNRLFLDCEEEQWKFQPLVPAGVSSSQMKKRPTSAVGYKRPISQYARVAMAMGSHPRYRAENIMFLELDVSPPAVFEMEFSHDQEQDPRALHMERLMRLDSFLERPSTSKVRKSRSWCQSPQRPPPSTTHASLASASLRPATVADHE
"
     misc_feature    682..1752
                     /gene="KIF3C"
                     /note="Myosin and Kinesin motor domain. These ATPases
                     belong to the P-loop NTPase family and provide the driving
                     force in myosin and kinesin mediated processes; Region:
                     Motor_domain; cl00286"
                     /db_xref="CDD:212601"
     misc_feature    685..1773
                     /gene="KIF3C"
                     /note="Kinesin motor, catalytic domain. ATPase; Region:
                     KISc; smart00129"
                     /db_xref="CDD:197527"
     misc_feature    order(709..714,952..975)
                     /gene="KIF3C"
                     /note="ATP-binding site [chemical binding]; other site"
                     /db_xref="CDD:73261"
     misc_feature    2545..3036
                     /gene="KIF3C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O14782.3);
                     Region: Globular (Potential)"
     variation       1766
                     /gene="KIF3C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465878"
     variation       2070
                     /gene="KIF3C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1062937"
     exon            2203..2304
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     exon            2305..2427
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     variation       2389
                     /gene="KIF3C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1802132"
     exon            2428..2546
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     variation       2545
                     /gene="KIF3C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1139892"
     exon            2547..2663
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     exon            2664..2772
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     exon            2773..2945
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     exon            2946..5431
                     /gene="KIF3C"
                     /inference="alignment:Splign:1.39.8"
     variation       3243
                     /gene="KIF3C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2072695"
     STS             3398..4254
                     /gene="KIF3C"
                     /standard_name="KIF3C_8426"
                     /db_xref="UniSTS:467738"
     STS             3958..4174
                     /gene="KIF3C"
                     /standard_name="HSC2CB052"
                     /db_xref="UniSTS:51408"
     STS             4061..4201
                     /gene="KIF3C"
                     /standard_name="RH12717"
                     /db_xref="UniSTS:32747"
     variation       4312
                     /gene="KIF3C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1061449"
     STS             5124..5402
                     /gene="KIF3C"
                     /db_xref="UniSTS:67245"
     STS             5192..5335
                     /gene="KIF3C"
                     /standard_name="RH66315"
                     /db_xref="UniSTS:47688"
     variation       5384
                     /gene="KIF3C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1061485"
     polyA_signal    5394..5399
                     /gene="KIF3C"
     polyA_site      5415
                     /gene="KIF3C"
                     /note="This is a major polyA site. The 3'-most polyA site
                     has not been determined."
ORIGIN      
agtcgggaggcttagctggggccgcagcgcggcggcaacatcactctcgctgccgctgctccgccccatccccttctgtttttctctctcattctccagtggcggcggcggggaaggcggaggcagaggcagcagcagccgcgctggctgcaatgaatgatcccccagcttggggggaggactccaggtgagcctctgccctcgggaggcccgggacccccggccgcccacgaccggcagcccacgctatggatccctagaggaaggaggagaagacagctcgccgcccacccccatcccattttcctcttcctttatctcattgttgccgaagctgtttacggcagcgctccctctgctccagcatggggcgggctccgggcacggctgctcggcaggcgctgctcccgcggcgactgggggattctgcctaattcacctcccagccggtgcagagaggaccggagagcggtggaggcccggactgcagcagcgttggggccacctcccagcgtccccaccctaggaggctgcatgcggattgaagagctgcgcctgggggctgggccggccccgctgatcccgacctagcgagcaggatagcaggaccgcccaggctgcggaggggctcgggggcaggaaggtcagagcagcaagatggccagtaagaccaaggccagcgaggccctcaaggtggtggcccggtgccgccccctcagcaggaaggaggaggctgctggtcacgagcagatcctgaccatggacgtgaaactgggccaggtgaccctgcggaacccccgcgccgccccgggggagctgcccaagaccttcacctttgacgccgtgtatgatgccagctccaagcaggccgacctgtatgacgaaaccgtgaggcccctgatagactccgtgctccagggtttcaatggcacggtgtttgcctatggccagacgggcactggcaagacctataccatgcaggggacctgggtggagcccgagctgcgcggggtcatcccgaatgcctttgagcacatcttcacccacatctcccgctcccagaaccaacagtacctggtccgggcctcctatttggagatctaccaggaagagattcgagacctgctctccaaggagccgggcaagaggctagagctgaaagagaaccccgagactggcgtctacatcaaggacctctcctccttcgtcaccaagaatgtcaaggagattgagcatgtgatgaacctggggaaccagacccgggctgtgggcagcacccacatgaatgaggtcagctcccgctcccatgccatcttcatcatcactgtggagtgcagcgaacgtggctctgatggccaggaccacatccgagtgggcaagctcaacctcgtggacctggctggcagcgagaggcagaacaaggcaggccccaacacagcgggaggggcagccacaccatcctcgggtggcggtggtggcggtggaggcagtggtggtggtgctggtggagagaggcctaaggaagcctccaaaatcaacctctcattatctgccctgggcaacgtgattgctgccctggcgggcaacaggagcacccacattccctaccgggactccaagctgacccggctgctccaggactccctgggggggaatgccaagaccatcatggtagccacactggggccagcttctcacagctacgatgagagcctctccaccttgcgctttgccaaccgagccaagaacatcaagaacaagccccgggtgaacgaggaccccaaggacacactgctgcgggaattccaagaggagattgcccgcctgaaggcccagctggagaagagggggatgctggggaagcggccccggaggaagagcagccgcaggaagaaggccgtgtccgccccgcctgggtaccctgagggcccagtgattgaggcctgggtggcagaagaggaggatgacaacaacaacaaccaccgcccgccccagcccatcctggagtcagccttggagaagaacatggagaattacctgcaggaacagaaggagcggctggaggaggagaaggcagccatccaggatgaccgcagcctggtgagcgaggagaagcagaagctgctggaggagaaggagaagatgctggaggacctgcggcgggaacagcaggccacagagctgcttgcggccaagtacaaggccatggagagcaagctcctcatcgggggcaggaacatcatggatcacaccaacgaacagcagaagatgttggaactgaagaggcaggagattgccgagcagaaacgtcgtgagcgggagatgcagcaggagatgatgctccgggacgaggagactatggagctccggggcacctacacatccctgcagcaggaggtggaggtcaaaaccaagaaactcaagaagctctacgccaagctgcaggcggtgaaggcggagatccaggaccagcatgatgagtatatccgcgtgcggcaggacctggaggaggcgcagaacgagcagacccgcgaactcaagctcaagtacctaatcatcgagaacttcatcccgccggaggagaagaacaagatcatgaaccggcttttcctggactgtgaggaggagcagtggaagttccagccactggtgccagccggcgtcagtagcagccagatgaagaagcggccaacatctgcagtgggctacaagaggcctatcagccagtatgctcgggttgccatggcaatggggtcccaccccaggtacagggctgaaaacataatgtttctggagttggatgtgtcccctccagctgtctttgagatggaattctctcacgaccaagaacaagaccctcgtgcgctacacatggagaggctcatgcgattggacagctttctggaaagaccttccacgtctaaagtccgaaagtccagatcctggtgccagagtcctcagcggcctccaccttccaccacacatgcctccctggcctctgcttctctgcgccctgcaacagtggcggaccatgagtgacaaccatcacgtcaggctgcccatccaatagactcctgggatggggcagccaaccctggctcatctcatctgccgcttggtgcgtgtgcgtgtgcgtgcatgtgcgtgtgcgtgtgtgcaggggtgagaatctggcagatggtgcctctgcctgctcttcttcgcctcctttatttaattcatgttatttattcgcggagctctgttcgtgttggggagatgccctcgcctgagccgtctgggcctaccgtggtcactgcgtagcctctttttcttctgacttgagagctcccccagtcagatctcaggcttgtccccctgtcagctgcctccagaagggaaggtagccagtgcctgagaagacagtcccttttctacccaccgcactccataacctccatcttctcccacactgatggcgagcagcccctgagcactttctgggactgggagactgcttggtgttccctgaggacaagagacatcctgacagtgttgggcatctgctccccgtggacacagccccactctccactttctgagcctcagacaacctcattcagcctcttgggctccttttcaaggacattaataacctcaccaacatagctcatgcccttcagctttgacaagaactcacagcttcccaaactctgctttctgcccaccttggatgggaactgtggaccaagcaattaccatcgccttggaacctgcaggaaatggaacagcaattgagacaacttgaacagtcatcaacggaagtccctccactggattcctttgtttctgtcccctccgaggagtcattttggtcgacaggctctcaaggcaactccccattttcaagaggctgctcctgcctgcttcgatcatttctccctgcagctgcctagaccccgttcacagtgggaggagtcaatgtcattctacccctcgctaaacgaagatattaacatctattgctttttcccttcatctgtcacaggaaacagaagcccaggcacaatcttttccagctttgcctgttacccctgtttctgaattgcatctttaaggtattattttgttgacaatagatcctttattcactagttacgcaaattggttcctagggggatactccttaccttcctttgtgatggcccaaaatgtctctaggtatctcaagtgataagtaaatttctacaaaaaaaaatggttaatgttcattgactggctttttaagtgtatattttggaggacgggtgaagaggtcataacgaaagcaagcgagtgaattaggatttcaaagtgccctaatagtgtgagtctccagttcctagaatatgaagagtgctgtcgttggggtgaaaccatgagactgacagatctgcctgaaatggggggtgtgggaggtggtggcgggggttattctctttccttcaggaaatgaacccttcttacatcattcaagttctgctctgaggatcaagcttgggtctgatttaactcagcgacactgtcatttctgcttcattactggactagagggttgagccacccacttgccatttgctcctgtccttccaggaaatcacaattttcatcagagcccaagagattatttgagactcaggattcagatcagaggttcgactgtggctgggacaggagttgtgtgtagaaattcaccaggtggcctgagcgcagggggacctccagggctgcgttgagcagcctctcccactgacctctttctcgtttgtggacaaagcagcacgtatcacctcattcatcacttggacacatcgcctttgcattgtcttgtcacacctccctcacagtcttatagcacaatatacccaaatcagcccccccagtccgagggctgggcccaaggtatggtcggaggaggagctcctgcctgcggttttgtgtatgtgtgtatgtgtgtgcgtgtttgtgtgcgtgtttacctccacaggggacactctacactcagtgtaagatctgctgggaacagggccaccaggagtggctggatctcagtctctctgtctctctttctctccttttccttttggtgtatcaaatatttgattgacaaagtaagggccttgattaggaccaaattctcgtgtgttgctatggtctttatttaggacaacaattaacaatgcagtggcccattcttgtcactctacacatatgactatacgggacatatgtaatatataaatatatatataaaacattcccctctgtccccttggcttcggatggaggcctttctgttgagctgaaatgcacctgcagctgggtgctgccagcagcttgcaggccccagccctgttccaatcaatgcagttgacaataaaggaatgagtatcgtcacggagttgactgcctt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3797 -> Molecular function: GO:0003774 [motor activity] evidence: TAS
            GeneID:3797 -> Molecular function: GO:0003777 [microtubule motor activity] evidence: IEA
            GeneID:3797 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:3797 -> Molecular function: GO:0008017 [microtubule binding] evidence: IEA
            GeneID:3797 -> Biological process: GO:0007018 [microtubule-based movement] evidence: TAS
            GeneID:3797 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:3797 -> Biological process: GO:0019886 [antigen processing and presentation of exogenous peptide antigen via MHC class II] evidence: TAS
            GeneID:3797 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:3797 -> Cellular component: GO:0005871 [kinesin complex] evidence: IEA
            GeneID:3797 -> Cellular component: GO:0005874 [microtubule] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.