GGRNA Home | Help | Advanced search

2019-03-22 05:40:09, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002040               5182 bp    mRNA    linear   PRI 24-JUN-2013
DEFINITION  Homo sapiens GA binding protein transcription factor, alpha subunit
            60kDa (GABPA), transcript variant 1, mRNA.
ACCESSION   NM_002040
VERSION     NM_002040.3  GI:163644305
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5182)
  AUTHORS   Khan,A.O., Alrashed,M. and Alkuraya,F.S.
  TITLE     Clinical characterisation of the CABP4-related retinal phenotype
  JOURNAL   Br J Ophthalmol 97 (3), 262-265 (2013)
   PUBMED   23099293
  REMARK    GeneRIF: The phenotype is best uniformly termed congenital cone-rod
            synaptic disorder. In Saudi Arabia a founder homozygous c.81_82insA
            CABP4 mutation is a recurrent cause.
REFERENCE   2  (bases 1 to 5182)
  AUTHORS   Odrowaz,Z. and Sharrocks,A.D.
  TITLE     The ETS transcription factors ELK1 and GABPA regulate different
            gene networks to control MCF10A breast epithelial cell migration
  JOURNAL   PLoS ONE 7 (12), E49892 (2012)
   PUBMED   23284628
  REMARK    GeneRIF: although ELK1 and GABPA ultimately control the same
            biological process, they do so by regulating different cohorts of
            target genes associated with cytoskeletal functions and cell
            migration contro
REFERENCE   3  (bases 1 to 5182)
  AUTHORS   Weng,C.J., Chen,M.J., Yeh,C.T. and Yen,G.C.
  TITLE     Hepatoprotection of quercetin against oxidative stress by induction
            of metallothionein expression through activating MAPK and PI3K
            pathways and enhancing Nrf2 DNA-binding activity
  JOURNAL   N Biotechnol 28 (6), 767-777 (2011)
   PUBMED   21624509
  REMARK    GeneRIF: Hepatoprotection of quercetin against oxidative stress by
            induction of metallothionein expression through activating MAPK and
            PI3K pathways and enhancing Nrf2 DNA-binding activity.
REFERENCE   4  (bases 1 to 5182)
  AUTHORS   Zhang,Y.Q., Li,K.N., Cui,J.H., Liu,Y.F. and Yang,S.J.
  TITLE     Abnormal expression of NRF-2alpha in hepatocellular carcinoma
            identified with a newly prepared monoclonal antibody against human
            NRF-2alpha protein
  JOURNAL   Mol. Biol. Rep. 38 (5), 3083-3088 (2011)
   PUBMED   20127517
  REMARK    GeneRIF: expression of NRF-2alpha in hepatocellular carcinoma (HCC)
            and tumor-adjacent specimens; higher-grade frequency of expression
            of NRF-2alpha in tumor-adjacent tissues was higher than tumor
            tissues, suggesting NRF-2alpha may play important role in
            carcinogenesis of HCC
REFERENCE   5  (bases 1 to 5182)
  AUTHORS   Masuko,H., Sakamoto,T., Kaneko,Y., Iijima,H., Naito,T., Noguchi,E.,
            Hirota,T., Tamari,M. and Hizawa,N.
  TITLE     An interaction between Nrf2 polymorphisms and smoking status
            affects annual decline in FEV1: a longitudinal retrospective cohort
            study
  JOURNAL   BMC Med. Genet. 12, 97 (2011)
   PUBMED   21774808
  REMARK    GeneRIF: an Nrf2-dependent response to exogenous stimuli may affect
            annual FEV1 decline
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5182)
  AUTHORS   Goto,M., Shimizu,T., Sawada,J., Sawa,C., Watanabe,H., Ichikawa,H.,
            Ohira,M., Ohki,M. and Handa,H.
  TITLE     Assignment of the E4TF1-60 gene to human chromosome 21q21.2-q21.3
  JOURNAL   Gene 166 (2), 337-338 (1995)
   PUBMED   8543189
REFERENCE   7  (bases 1 to 5182)
  AUTHORS   Chrast,R., Chen,H., Morris,M.A. and Antonarakis,S.E.
  TITLE     Mapping of the human transcription factor GABPA (E4TF1-60) gene to
            chromosome 21
  JOURNAL   Genomics 28 (1), 119-122 (1995)
   PUBMED   7590737
REFERENCE   8  (bases 1 to 5182)
  AUTHORS   Gugneja,S., Virbasius,J.V. and Scarpulla,R.C.
  TITLE     Four structurally distinct, non-DNA-binding subunits of human
            nuclear respiratory factor 2 share a conserved transcriptional
            activation domain
  JOURNAL   Mol. Cell. Biol. 15 (1), 102-111 (1995)
   PUBMED   7799916
REFERENCE   9  (bases 1 to 5182)
  AUTHORS   Sawada,J., Goto,M., Watanabe,H., Handa,H. and Yoshida,M.C.
  TITLE     Regional mapping of two subunits of transcription factor E4TF1 to
            human chromosome
  JOURNAL   Jpn. J. Cancer Res. 86 (1), 10-12 (1995)
   PUBMED   7737900
REFERENCE   10 (bases 1 to 5182)
  AUTHORS   Watanabe,H., Sawada,J., Yano,K., Yamaguchi,K., Goto,M. and Handa,H.
  TITLE     cDNA cloning of transcription factor E4TF1 subunits with Ets and
            notch motifs
  JOURNAL   Mol. Cell. Biol. 13 (3), 1385-1391 (1993)
   PUBMED   8441384
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CD674081.1, BC035031.2, BX647755.1, CV575645.1, BG542623.1,
            CB132898.1, BX117934.1 and AI917898.1.
            On Dec 20, 2007 this sequence version replaced gi:34452720.
            
            Summary: This gene encodes one of three GA-binding protein
            transcription factor subunits which functions as a DNA-binding
            subunit. Since this subunit shares identity with a subunit encoding
            the nuclear respiratory factor 2 gene, it is likely involved in
            activation of cytochrome oxidase expression and nuclear control of
            mitochondrial function. This subunit also shares identity with a
            subunit constituting the transcription factor E4TF1, responsible
            for expression of the adenovirus E4 gene. Because of its
            chromosomal localization and ability to form heterodimers with
            other polypeptides, this gene may play a role in the Down Syndrome
            phenotype. Two transcript variants encoding the same protein have
            been found for this gene. [provided by RefSeq, Oct 2010].
            
            Transcript Variant: This variant (1) represents the longer
            transcript. Variants 1 and 2 both encode the same protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC035031.2, AK223164.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-370               CD674081.1         72-441              c
            371-1916            BC035031.2         4-1549
            1917-3825           BX647755.1         1858-3766
            3826-4071           CV575645.1         4-249
            4072-4112           BG542623.1         149-189
            4113-4625           CB132898.1         28-540
            4626-5048           BX117934.1         52-474
            5049-5182           AI917898.1         1-134               c
FEATURES             Location/Qualifiers
     source          1..5182
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="21"
                     /map="21q21.3"
     gene            1..5182
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="GA binding protein transcription factor, alpha
                     subunit 60kDa"
                     /db_xref="GeneID:2551"
                     /db_xref="HGNC:4071"
                     /db_xref="HPRD:11793"
                     /db_xref="MIM:600609"
     exon            1..561
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150566464"
     variation       183
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:67850549"
     variation       185
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71649641"
     variation       189
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:71649642"
     variation       221
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71649643"
     variation       241
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113359903"
     variation       262
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144492173"
     variation       295
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114422129"
     variation       337
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147440551"
     variation       388
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376154905"
     variation       413..414
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:372213340"
     variation       440
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140704996"
     variation       452
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:67572468"
     variation       468
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:71649644"
     exon            562..664
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    573..575
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="upstream in-frame stop codon"
     variation       582
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201162106"
     CDS             588..1952
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="human nuclear respiratory factor-2 subunit alpha;
                     nuclear respiratory factor 2 alpha subunit; GABP subunit
                     alpha; transcription factor E4TF1-60; nuclear respiratory
                     factor 2 subunit alpha; GA binding protein transcription
                     factor alpha subunit 60kDa"
                     /codon_start=1
                     /product="GA-binding protein alpha chain"
                     /protein_id="NP_002031.2"
                     /db_xref="GI:34452721"
                     /db_xref="CCDS:CCDS13575.1"
                     /db_xref="GeneID:2551"
                     /db_xref="HGNC:4071"
                     /db_xref="HPRD:11793"
                     /db_xref="MIM:600609"
                     /translation="
MTKREAEELIEIEIDGTEKAECTEESIVEQTYAPAECVSQAIDINEPIGNLKKLLEPRLQCSLDAHEICLQDIQLDPERSLFDQGVKTDGTVQLSVQVISYQGIEPKLNILEIVKPADTVEVVIDPDAHHAESEAHLVEEAQVITLDGTKHITTISDETSEQVTRWAAALEGYRKEQERLGIPYDPIQWSTDQVLHWVVWVMKEFSMTDIDLTTLNISGRELCSLNQEDFFQRVPRGEILWSHLELLRKYVLASQEQQMNEIVTIDQPVQIIPASVQSATPTTIKVINSSAKAAKVQRAPRISGEDRSSPGNRTGNNGQIQLWQFLLELLTDKDARDCISWVGDEGEFKLNQPELVAQKWGQRKNKPTMNYEKLSRALRYYYDGDMICKVQGKRFVYKFVCDLKTLIGYSAAELNRLVTECEQKKLAKMQLHGIAQPVTAVALATASLQTEKDN
"
     misc_feature    690..950
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="GA-binding protein alpha chain; Region: GABP-alpha;
                     pfam11620"
                     /db_xref="CDD:152056"
     misc_feature    1089..1349
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="Sterile alpha motif (SAM)/Pointed domain of
                     GA-binding protein (GABP) alpha chain; Region:
                     SAM_PNT-GABP-alpha; cd08534"
                     /db_xref="CDD:176084"
     misc_feature    1542..1793
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="Ets-domain; Region: Ets; pfam00178"
                     /db_xref="CDD:143944"
     exon            665..809
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       680
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143783879"
     variation       685
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200493501"
     variation       686
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734758"
     variation       734
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201420702"
     variation       798
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111555508"
     exon            810..894
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       839
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182635910"
     variation       851
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9981487"
     variation       889
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142853007"
     exon            895..1140
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       895
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199641457"
     variation       1095
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201578633"
     variation       1122
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201624532"
     variation       1124
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114798549"
     exon            1141..1335
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1211
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111301212"
     variation       1212
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151066489"
     variation       1213
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140912056"
     variation       1216
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200365343"
     variation       1231
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112195834"
     variation       1293
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144668707"
     variation       1302
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147848277"
     exon            1336..1389
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1340
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201347218"
     variation       1364
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141466398"
     variation       1377
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370739443"
     variation       1388
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373747685"
     exon            1390..1530
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1446
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376096956"
     variation       1459
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2829897"
     variation       1477
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200165925"
     variation       1484
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147015240"
     exon            1531..1723
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1553
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138014763"
     variation       1556
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829898"
     variation       1565
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78950085"
     variation       1593
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115851866"
     variation       1601
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2829899"
     variation       1620
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829900"
     variation       1661
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829901"
     variation       1673
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149087448"
     variation       1676
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376559681"
     variation       1691
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143054530"
     exon            1724..5180
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1739
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372224151"
     variation       1766
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734759"
     STS             1776..2323
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="GABPA_8360"
                     /db_xref="UniSTS:468432"
     variation       1787
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371993253"
     variation       1844
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141519478"
     variation       1862
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61750211"
     variation       1917
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17853379"
     variation       1936
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144078894"
     STS             1949..2194
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="SHGC-52145"
                     /db_xref="UniSTS:79570"
     variation       1949
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374974940"
     STS             1952..2190
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="RH18000"
                     /db_xref="UniSTS:13351"
     variation       1956
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202051040"
     variation       1966
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368818775"
     variation       2028
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45602531"
     STS             2046..2370
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="D21S1963"
                     /db_xref="UniSTS:81900"
     variation       2050
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376856537"
     variation       2120
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369063682"
     variation       2147
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2694"
     variation       2166
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371743228"
     variation       2218
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55846831"
     variation       2285
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1062461"
     variation       2384..2385
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34459326"
     variation       2511
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188275683"
     STS             2523..2645
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="RH69339"
                     /db_xref="UniSTS:91245"
     variation       2623
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139934166"
     variation       2816
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191917080"
     variation       2839
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184207125"
     variation       2856
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370006698"
     variation       3028
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143469868"
     variation       3042
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151233050"
     variation       3091
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61156591"
     variation       3179
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188492582"
     variation       3189
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182061978"
     variation       3217..3218
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:200795121"
     variation       3246
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185031969"
     variation       3257
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112093941"
     variation       3323
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897808"
     variation       3339
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115790549"
     variation       3418
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373887995"
     variation       3571
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2154472"
     variation       3590
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11910323"
     variation       3655
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190765412"
     variation       3688
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11910413"
     variation       3691
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71651662"
     variation       3858
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71651663"
     variation       3957
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11910425"
     variation       3977..3980
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="tgtg"
                     /db_xref="dbSNP:142668569"
     variation       4064
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35429903"
     variation       4072
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189760448"
     variation       4099
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:148811101"
     variation       4164
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201353954"
     variation       4195
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180691813"
     variation       4230
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141668617"
     variation       4244
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71651665"
     variation       4280
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147069073"
     variation       4318
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370384324"
     variation       4349
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138464454"
     variation       4358
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117179423"
     variation       4361..4365
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="ctttg"
                     /db_xref="dbSNP:199776826"
     variation       4411
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191051389"
     variation       4555
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183804750"
     variation       4636
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112288038"
     variation       4717
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376957538"
     variation       4724
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71651668"
     variation       4900..4901
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35609693"
     variation       4948
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188295759"
     variation       4950
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368427310"
     variation       4977..4978
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34074450"
     variation       5014
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375530790"
     variation       5029
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192499722"
     variation       5041..5042
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34230234"
     variation       5092..5093
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:36008029"
     variation       5117
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71651669"
ORIGIN      
cgaccggacgggtctaggtgagacagaagccaaacaggaggaggaagtggagggtaagtgcttccgggtcccctggcacagcctccgccatcttttcttcgcctaatttgacccgttctttttcccctccttgaaaccttgctctgtacgcatgcgctctttgagtggcctttcccctagttcaagctcccctccgagtcagcgtcctgttcgttagggttatcgaagtgtataaaggtgcagggaaagtgagactgtgtaaaacaaagcggattggggcgttgtgcttccttgtacctcgtgagcctccgttgccttgggcggtcgttttgcgcaccctgccgggagttgtagtcctggacccgaaggtgcctgggaggcgggaggggggttggggcttctcagcgccgattccgcgggaagggccctgggacctcacacttctagtcgcgggagctgcaggtcttacccggagagacgctgcacgtggagccctcgccgctgccgttctcagccggctctggagtgcgggcgggggcgacagggccgattccggagtgggactgatcctttgaaatactccagccatgactaaaagagaagcagaggagctgatagaaattgagattgatggaacagagaaagcagagtgcacagaagaaagcattgtagaacaaacctacgcgccagctgaatgtgtaagccaggccatagacatcaatgaaccaataggcaatttaaagaaactgctagaaccaagactacagtgttctttggatgctcatgaaatttgtctgcaagatatccagctggatccagaacgaagtttatttgaccaaggagtaaaaacagatggaactgtacagcttagtgtacaggtaatttcttaccaaggaattgaaccaaagttaaacatccttgaaattgttaaacctgcggacactgttgaggttgttattgatccagatgcccaccatgctgaatcagaagcacatcttgttgaagaagctcaagtgataactcttgatggcacaaaacacatcacaaccatttcagatgaaacttcagaacaagtgacaagatgggctgctgcactggaaggctataggaaagaacaagaacgccttgggataccctatgatcccatacagtggtccacagaccaagtcctgcattgggtggtttgggtaatgaaggaattcagcatgaccgatatagacctcaccacactcaacatttcggggagagaattatgtagtctcaaccaagaagatttttttcagcgggttcctcggggagaaattctctggagtcatctggaacttctccgaaaatatgtattggcaagtcaagaacaacagatgaatgaaatagttacaattgatcaacctgtgcaaattattccagcatcagtgcaatctgctacacctactaccattaaagttataaatagtagtgcgaaagcagccaaagtacaaagagcgccgaggatttcaggagaagatagaagctcacctgggaacagaacaggaaacaatggccaaatccaactatggcagtttttgctagaacttcttactgataaggacgctcgagactgcatttcttgggttggtgatgaaggtgaatttaagctaaatcagcctgaactggttgcacagaaatggggacagcgtaaaaataagcctacgatgaactatgagaaactcagtcgtgcattaagatattattacgatggggacatgatttgtaaagttcaaggcaagagatttgtgtacaagtttgtctgtgacttgaagactcttattggatacagtgcagcggagttgaaccgtttggtcacagaatgtgaacagaagaaacttgcaaagatgcagctccatggaattgcccagccagtcacagcagtagctctggctactgcttctctgcaaacggaaaaggataattgagccccaggacattctgagactccaaagtctttcttaaaatgtttagagcaagtatagctcttacctttattactgaatttgaatcttcttttatttctaggctgtacagtctgatgcatgatttttttataaatatttcatactcttgtgaatttggatctttttactttgagcatatattttagaatatgtgtatgttaaaggatctccacaatgtctgcagtgtgaaggcaggttcattgtggaatagtttaacagtcaggaaggctaaactggtcagtattaatgtgtagccctaccaaaaatagccagtagtatctgaaaatgaaaaataaatgaagtatctctaggaaacagtctggcttaactatttttgaaaatataactgtttcccctctctgctgctttagatgttgctttacatagaaccagaaaatggaatttctcagctaaagcatgtgtgcctgtttcatctaatcaagcagagctaaaatgttcataccgaataaatttatattaataaattactaaactaagagtatcaggttatttatatatttgcaagcaaaggacagtaagaagttgactggcaaaagagcagtgctgaaggaggagatccaggtttaaatctggcttattaactcaagccaattttaaggattttctgtatagattactcatgtcagaccaagaatttaaattattttgagagaggcatttaattctaataaaccagctgttataaaaattataaaatgatctctgtttttcctgtcagagatttaaaaaactgaaaaggtatacctcaacccaaaaataaaggtttgttttggtttgttatggcttccttttttaaaaaattaccctgtagtgccagtttattatgcaaagcagcttatattcctttgtttctgataaaatgaagactttaaatcagtcagtagtactttacctttcaaggcattagtaaattacttgcaaatagttttaaaaggaaaatacgacctttgttataggcagtcttctctttaagacaatacttttccacttgttttccttttccatattatatatgtgtattcatatagctgtatacatattcagttgatcattttataaacatatgaaggcataaagatatacagaagaaaaattattaaacaactcattttaagattcaaattaactaattcctgcatatatgacattccttacataagcgaacactaaacaaaaatggctagaaatgtctttttctttcttttctctctttgttgtttaaggtattaagcacgaattattacatgagactggcagatagctattaatcctcttacagatttgagaaagttgattctcaaatatttatgcaccttctccttcattgttttctttaaatctgtcctcttaaaaagcttcttaagagctcagttaatgcttttgacttaactaggagaaaaaggcatgataatacaggcaagatggcattgttagcaattctggtagtggtttggaatgaatcctaagaggcagggatcttaaggacaaggaagagaagagagagagggagggatctttgatctctttctctggtaatcttaatgcataattttactaaaacatgttctcaattcattcatattattaagctcttcctgcagttgatatctgagcagagtaagatttgtatttccatttttacttttttgaaagagaatatatggacagattattagtacaatttgggcactgtggttttaagaatatctgagtaaaataacaatatgaaataataaacagaagctctaacgtcaggtaacaaatagacagcaagaaaggttttgcaccatcctcttacggcctagagagttgacaagttgcttgtagttttaaaaaaataataaagtatacccttctggtatatcatcaagagcttaagaatcttggctttcatatttaaaatgcttttggggagacatatattaaaattttagccaagatgatagacatgtctcaattatatatgtgtgtgtatgtttttaaagctaaaaacattacttttagatccctagaatgaaaatttttttctcatctatgcaattcccatatggtttttttttaaatcatattttattcattttctccctttagcaattttcattttatttctcataatttgaacagagacagttctcatacatgatcagatgctttttttttcttcttaccatcatttatgcatgacataggtaatgtgactaatttctccagttgattcaagaaactcattactttgcctcaaattatatgtaaaatatttgttttacttaggttacagttatcagaaaggtagtttttttcttctattaaaatataacattgtgaaagaaaataaaatttatgctattctttgctttgtttttataaatgaatttttcatagaatttacagtatattcaaaggaagaaagataaaattattggtcatcatttgtaccttagaagtacaagaatttaagtaaaagaaatgttcatttttgttttaaaatttgttttccatgtgaagtttttattgagccaactttcatacatatcttgctagcctaaagtctaaatatttgtgttggcatcagaaaaacaaatgaggcagaattgctatgtgtggttgatcttcagataaattgactgatcacagttatttttgtatcagtctatgttattaggaaaaattgtttagttgttttctcccctgattaatggtgatattcaagtatgatacaaaaagaattgtaccaccaaatatttttgtgaggtctgctgttttccatattcattttatgctactgcctttaagaaagaactagtgtatccttgaaatagcacaaaaatgttttaaaattcataattgcaaaacaaatctgtgactaacttaatgtcttcagatctaaagggtgtaaaaatattgatacttcaatatttcacttgctgccaggaaaaacaaaattctcaatcttttgtaaatgggaggaggacttttgcatacatttttactctttaaataacgacaacgacacttatactgtcataataacaattatgtatttctttgtggttttaattttttttgtaattttacataaaacagttattttctatttttacgcagataaatatttgtgcataaaatgtaaaaatagtaaaatgagaaaaataaaactattatacagtaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2551 -> Molecular function: GO:0000978 [RNA polymerase II core promoter proximal region sequence-specific DNA binding] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0001228 [RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
            GeneID:2551 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:2551 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IDA
            GeneID:2551 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:2551 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:2551 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:2551 -> Biological process: GO:0045653 [negative regulation of megakaryocyte differentiation] evidence: IEA
            GeneID:2551 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.