2024-04-26 13:18:19, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001904 3720 bp mRNA linear PRI 01-JUL-2013 DEFINITION Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, mRNA. ACCESSION NM_001904 XM_942045 XM_945648 XM_945650 XM_945651 XM_945652 XM_945653 XM_945654 XM_945655 XM_945657 VERSION NM_001904.3 GI:148228165 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3720) AUTHORS Li,Y. and Shively,J.E. TITLE CEACAM1 regulates Fas-mediated apoptosis in Jurkat T-cells via its interaction with beta-catenin JOURNAL Exp. Cell Res. 319 (8), 1061-1072 (2013) PUBMED 23499736 REMARK GeneRIF: CEACAM1 regulates Fas-mediated apoptosis in Jurkat T-cells via its interaction with beta-catenin. REFERENCE 2 (bases 1 to 3720) AUTHORS Chiang,C.H., Hou,M.F. and Hung,W.C. TITLE Up-regulation of miR-182 by beta-catenin in breast cancer increases tumorigenicity and invasiveness by targeting the matrix metalloproteinase inhibitor RECK JOURNAL Biochim. Biophys. Acta 1830 (4), 3067-3076 (2013) PUBMED 23333633 REMARK GeneRIF: data demonstrate for the first time that miR-182 expression is controlled by beta-catenin REFERENCE 3 (bases 1 to 3720) AUTHORS Lee,H.J., Lee,O.J., Jang,K.T., Bae,Y.K., Chung,J.Y., Eom,D.W., Kim,J.M., Yu,E. and Hong,S.M. TITLE Combined loss of E-cadherin and aberrant beta-catenin protein expression correlates with a poor prognosis for small intestinal adenocarcinomas JOURNAL Am. J. Clin. Pathol. 139 (2), 167-176 (2013) PUBMED 23355201 REMARK GeneRIF: Loss of E-cadherin and aberrant beta-catenin expression could be a prognostic factor in patients with small intestinal adeno-carcinomas. REFERENCE 4 (bases 1 to 3720) AUTHORS Zanna,P., Maida,I., Grieco,C., Guida,S., Turpin Sevilla,M.C., De Summa,S., Tommasi,S., Vena,G.A., Filotico,R. and Guida,G. TITLE Three novel human sporadic melanoma cell lines: signaling pathways controlled by MC1R, BRAF and beta-catenins JOURNAL J. Biol. Regul. Homeost. Agents 27 (1), 131-141 (2013) PUBMED 23489693 REMARK GeneRIF: Quantity and subcellular localization of beta-catenin were analyzed in both novel and control cell lines. REFERENCE 5 (bases 1 to 3720) AUTHORS Wangefjord,S., Brandstedt,J., Lindquist,K.E., Nodin,B., Jirstrom,K. and Eberhard,J. TITLE Associations of beta-catenin alterations and MSI screening status with expression of key cell cycle regulating proteins and survival from colorectal cancer JOURNAL Diagn Pathol 8, 10 (2013) PUBMED 23337059 REMARK GeneRIF: Report association of microsatellite instability and beta-catenin alterations with prognosis in colorectal cancer. Publication Status: Online-Only REFERENCE 6 (bases 1 to 3720) AUTHORS Sacco,P.A., McGranahan,T.M., Wheelock,M.J. and Johnson,K.R. TITLE Identification of plakoglobin domains required for association with N-cadherin and alpha-catenin JOURNAL J. Biol. Chem. 270 (34), 20201-20206 (1995) PUBMED 7650039 REFERENCE 7 (bases 1 to 3720) AUTHORS Brady-Kalnay,S.M., Rimm,D.L. and Tonks,N.K. TITLE Receptor protein tyrosine phosphatase PTPmu associates with cadherins and catenins in vivo JOURNAL J. Cell Biol. 130 (4), 977-986 (1995) PUBMED 7642713 REFERENCE 8 (bases 1 to 3720) AUTHORS Kanai,Y., Ochiai,A., Shibata,T., Oyama,T., Ushijima,S., Akimoto,S. and Hirohashi,S. TITLE c-erbB-2 gene product directly associates with beta-catenin and plakoglobin JOURNAL Biochem. Biophys. Res. Commun. 208 (3), 1067-1072 (1995) PUBMED 7702605 REFERENCE 9 (bases 1 to 3720) AUTHORS van Hengel,J., Nollet,F., Berx,G., van Roy,N., Speleman,F. and van Roy,F. TITLE Assignment of the human beta-catenin gene (CTNNB1) to 3p22-->p21.3 by fluorescence in situ hybridization JOURNAL Cytogenet. Cell Genet. 70 (1-2), 68-70 (1995) PUBMED 7736793 REFERENCE 10 (bases 1 to 3720) AUTHORS Aberle,H., Butz,S., Stappert,J., Weissig,H., Kemler,R. and Hoschuetzky,H. TITLE Assembly of the cadherin-catenin complex in vitro with recombinant proteins JOURNAL J. Cell. Sci. 107 (PT 12), 3655-3663 (1994) PUBMED 7706414 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA216720.1, X87838.1 and AC104307.2. This sequence is a reference standard in the RefSeqGene project. On May 23, 2007 this sequence version replaced gi:40254459. Summary: The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Three transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC058926.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-54 DA216720.1 1-54 55-2626 X87838.1 1-2572 2627-3720 AC104307.2 83770-84863 FEATURES Location/Qualifiers source 1..3720 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3p21" gene 1..3720 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="catenin (cadherin-associated protein), beta 1, 88kDa" /db_xref="GeneID:1499" /db_xref="HGNC:2514" /db_xref="HPRD:00286" /db_xref="MIM:116806" exon 1..220 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 87 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:369634833" variation 103 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="g" /replace="t" /db_xref="dbSNP:13067968" variation 126 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:13067975" variation 151 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:11564434" variation 213 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:11564435" exon 221..281 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 224 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:4135376" misc_feature 227..229 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="upstream in-frame stop codon" STS 257..543 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="PMC130963P2" /db_xref="UniSTS:270617" variation 260 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:5743390" CDS 269..2614 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /codon_start=1 /product="catenin beta-1" /protein_id="NP_001895.1" /db_xref="GI:4503131" /db_xref="CCDS:CCDS2694.1" /db_xref="GeneID:1499" /db_xref="HGNC:2514" /db_xref="HPRD:00286" /db_xref="MIM:116806" /translation="
MATQADLMELDMAMEPDRKAAVSHWQQQSYLDSGIHSGATTTAPSLSGKGNPEEEDVDTSQVLYEWEQGFSQSFTQEQVADIDGQYAMTRAQRVRAAMFPETLDEGMQIPSTQFDAAHPTNVQRLAEPSQMLKHAVVNLINYQDDAELATRAIPELTKLLNDEDQVVVNKAAVMVHQLSKKEASRHAIMRSPQMVSAIVRTMQNTNDVETARCTAGTLHNLSHHREGLLAIFKSGGIPALVKMLGSPVDSVLFYAITTLHNLLLHQEGAKMAVRLAGGLQKMVALLNKTNVKFLAITTDCLQILAYGNQESKLIILASGGPQALVNIMRTYTYEKLLWTTSRVLKVLSVCSSNKPAIVEAGGMQALGLHLTDPSQRLVQNCLWTLRNLSDAATKQEGMEGLLGTLVQLLGSDDINVVTCAAGILSNLTCNNYKNKMMVCQVGGIEALVRTVLRAGDREDITEPAICALRHLTSRHQEAEMAQNAVRLHYGLPVVVKLLHPPSHWPLIKATVGLIRNLALCPANHAPLREQGAIPRLVQLLVRAHQDTQRRTSMGGTQQQFVEGVRMEEIVEGCTGALHILARDVHNRIVIRGLNTIPLFVQLLYSPIENIQRVAAGVLCELAQDKEAAEAIEAEGATAPLTELLHSRNEGVATYAAAVLFRMSEDKPQDYKKRLSVELTSSLFRTEPMAWNETADLGLDIGAQGEPLGYRQDDPSYRSFHSGGYGQDALGMDPMMEHEMGGHHPGADYPVDGLPDLGHAQDLMDGLPPGDSNQLAWFDTDL
" misc_feature 269..337 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: Interaction with VCL (By similarity)" misc_feature 335..337 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by GSK3-beta; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 353..355 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by GSK3-beta; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 353..355 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00277" misc_feature 353..355 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00278" misc_feature 365..367 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by GSK3-beta and HIPK2; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 365..367 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05418" misc_feature 377..379 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by GSK3-beta and HIPK2; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 377..379 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05418" misc_feature 389..391 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by GSK3-beta; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 389..391 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:05418" misc_feature 401..403 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 401..403 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02739" misc_feature 401..403 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02920" misc_feature 401..403 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:04533" misc_feature 413..415 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="acetylation site" /db_xref="HPRD:02534" misc_feature 458..460 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by PTK6; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 524..526 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by CSK; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 524..526 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01819" misc_feature 572..574 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00277" misc_feature 572..574 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00278" misc_feature 590..934 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cd00020" /db_xref="CDD:237987" misc_feature 602..604 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00277" misc_feature 602..604 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00278" misc_feature order(608..610,626..628,638..640,764..766,776..778, 785..787,797..799,905..907,914..916,923..928) /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:237987" misc_feature 692..694 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by FYN and PTK6; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 692..694 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00655" misc_feature 692..694 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01491" misc_feature 719..841 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 1" misc_feature 839..841 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK5; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 845..970 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 2" misc_feature 953..1312 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cd00020" /db_xref="CDD:237987" misc_feature 971..1096 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 3" misc_feature 1004..1006 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK5; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature order(1025..1027,1037..1039,1049..1051,1142..1144, 1154..1156,1163..1165,1175..1177,1283..1285,1292..1294, 1301..1306) /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:237987" misc_feature 1097..1222 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 4" misc_feature 1223..1348 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 5" misc_feature 1259..1261 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by PTK6; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 1316..1438 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats; Region: ARM; smart00185" /db_xref="CDD:214547" misc_feature 1349..1435 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 6" misc_feature 1445..1447 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00277" misc_feature 1463..1822 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cd00020" /db_xref="CDD:237987" misc_feature 1466..1591 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 7" misc_feature order(1520..1522,1532..1534,1544..1546,1643..1645, 1655..1657,1664..1666,1676..1678,1793..1795,1802..1804, 1811..1816) /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:237987" misc_feature 1592..1720 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 8" misc_feature 1718..2137 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cd00020" /db_xref="CDD:237987" misc_feature 1733..1858 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 9" misc_feature order(1790..1792,1802..1804,1814..1816,1970..1972, 1982..1984,1991..1993,2003..2005,2105..2107,2114..2116, 2123..2128,2135..2137) /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:237987" misc_feature 1859..1981 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 10" misc_feature 1919..1921 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 1922..1924 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 1922..1924 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1934..1936 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 2033..>2272 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cd00020" /db_xref="CDD:237987" misc_feature 2048..2176 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 11" misc_feature order(2102..2104,2114..2116,2126..2128,2216..2218, 2228..2230,2237..2239,2249..2251) /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:237987" misc_feature 2177..2266 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: ARM 12" misc_feature 2228..2230 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine, by CSK; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 2228..2230 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01819" misc_feature 2291..2293 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P35222.1); phosphorylation site" misc_feature 2291..2293 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2582..2611 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35222.1); Region: Interaction with SCRIB (By similarity)" exon 282..509 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" STS 285..510 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="PMC15782P2" /db_xref="UniSTS:271431" STS 286..457 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="PMC123056P1" /db_xref="UniSTS:270433" variation 305 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:121913394" variation 329 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:121913395" variation 332..382 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt" /db_xref="dbSNP:121913416" variation 333 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:77064436" variation 342..365 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="ggcagcaacagtcttacctggact" /db_xref="dbSNP:121913417" variation 349 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:369714835" variation 362 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:28931588" variation 363 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913396" variation 366 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913400" variation 368 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:121913399" variation 369 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:28931589" variation 377 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913228" variation 378 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913403" variation 389 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913412" variation 390 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:121913413" variation 401 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913407" variation 402 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:121913409" variation 505 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:113120762" exon 510..763 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 650 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:202217100" variation 688 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:3856746" variation 720 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:200968230" variation 751 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:369510063" variation 754 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:5743392" exon 764..1002 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" STS 766..996 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="PMC15782P1" /db_xref="UniSTS:271430" variation 769 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:142472167" variation 804 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /db_xref="dbSNP:77624106" variation 820 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:375776725" variation 826 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:373990577" STS 847..1116 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="Ctnnb1" /db_xref="UniSTS:508428" variation 851 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:147382769" variation 866 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:139085081" variation 901 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:148600849" variation 903 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:200890083" variation 910 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:3856747" variation 911 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:369771822" variation 942 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:144087793" variation 986 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:373574509" exon 1003..1204 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 1029..1030 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="t" /db_xref="dbSNP:67701980" variation 1108 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:13086686" variation 1109..1110 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="a" /db_xref="dbSNP:68115726" variation 1128 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:35288908" variation 1159 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:370662884" variation 1174 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:375262741" variation 1193 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:376393123" exon 1205..1349 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 1246 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:138154972" variation 1291 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:34343353" variation 1306 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:367845313" variation 1333 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:200709497" exon 1350..1453 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 1423 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /db_xref="dbSNP:74692094" exon 1454..1792 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 1540 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:4135379" variation 1660 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:141678313" variation 1724 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:113411271" variation 1784 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:3856748" exon 1793..1951 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 1831 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:370135014" variation 1921 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:138539284" variation 1925 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:199593411" variation 1932 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:186068630" STS 1949..2084 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="GDB:435507" /db_xref="UniSTS:157235" exon 1952..2071 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" STS 2042..2135 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="PMC21165P1" /db_xref="UniSTS:272017" exon 2072..2222 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 2098 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:374923885" variation 2195 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:141493100" exon 2223..2344 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 2250..2251 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="a" /db_xref="dbSNP:35523547" variation 2251 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /db_xref="dbSNP:1800663" variation 2263 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /db_xref="dbSNP:77750814" variation 2269 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:374853593" variation 2293 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:201061014" variation 2330 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:4135384" exon 2345..2405 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 2353 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:199856558" variation 2397 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:200308943" exon 2406..3720 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /inference="alignment:Splign:1.39.8" variation 2443 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:191410018" variation 2467 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:148654224" variation 2494 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:201583088" variation 2523 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:373158451" variation 2533 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="t" /db_xref="dbSNP:200991012" variation 2571 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:377050808" variation 2583 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:138501547" variation 2588 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:4135386" variation 2608 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:2293303" variation 2646 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:116875446" variation 2779..2780 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="t" /db_xref="dbSNP:201058354" variation 2780 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="a" /db_xref="dbSNP:11564479" variation 2781 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:146896526" variation 2793 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:181927582" variation 2842..2843 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="t" /db_xref="dbSNP:377591875" variation 2842 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="g" /db_xref="dbSNP:150533740" variation 2843 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="t" /db_xref="dbSNP:4135244" variation 2908..2910 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="agc" /db_xref="dbSNP:4135243" variation 2911..2913 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="gct" /db_xref="dbSNP:79024415" variation 2911..2912 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="gct" /db_xref="dbSNP:201309476" variation 2920 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:4135388" variation 2940..2941 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="a" /db_xref="dbSNP:34854135" variation 2986 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:4135389" STS 2990..3196 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="G42968" /db_xref="UniSTS:94848" variation 3018..3019 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="ac" /db_xref="dbSNP:143836144" variation 3093 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:371800780" variation 3105 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:375050845" variation 3169 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="g" /replace="t" /db_xref="dbSNP:2953" variation 3190..3191 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="a" /db_xref="dbSNP:150512515" variation 3193..3194 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="t" /db_xref="dbSNP:34653633" variation 3194 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="t" /db_xref="dbSNP:4135387" variation 3258 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:201175238" variation 3259..3262 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="tttt" /replace="tttttt" /db_xref="dbSNP:34534133" variation 3259..3260 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="tt" /replace="tttt" /db_xref="dbSNP:71961438" variation 3348..3349 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="taat" /db_xref="dbSNP:376566844" variation 3358 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:11708064" variation 3381..3382 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="taat" /db_xref="dbSNP:16339" variation 3382..3383 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="aatt" /replace="taat" /db_xref="dbSNP:71623294" variation 3385..3386 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="taat" /db_xref="dbSNP:3834205" variation 3387..3388 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="aatt" /db_xref="dbSNP:71727399" variation 3387 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="c" /db_xref="dbSNP:202194019" variation 3398..3401 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="" /replace="taat" /db_xref="dbSNP:72273140" STS 3464..3672 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /standard_name="EST12H1" /db_xref="UniSTS:263086" variation 3467 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:145906085" variation 3471 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:1798792" variation 3511 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="g" /replace="t" /db_xref="dbSNP:1722851" variation 3519 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="g" /replace="t" /db_xref="dbSNP:148378295" variation 3576 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="a" /replace="g" /db_xref="dbSNP:1058355" variation 3654 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:116035162" variation 3655 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="g" /db_xref="dbSNP:141130241" variation 3715 /gene="CTNNB1" /gene_synonym="armadillo; CTNNB; MRD19" /replace="c" /replace="t" /db_xref="dbSNP:150729932" ORIGIN
aggatacagcggcttctgcgcgacttataagagctccttgtgcggcgccattttaagcctctcggtctgtggcagcagcgttggcccggccccgggagcggagagcgaggggaggcggagacggaggaaggtctgaggagcagcttcagtccccgccgagccgccaccgcaggtcgaggacggtcggactcccgcggcgggaggagcctgttcccctgagggtatttgaagtataccatacaactgttttgaaaatccagcgtggacaatggctactcaagctgatttgatggagttggacatggccatggaaccagacagaaaagcggctgttagtcactggcagcaacagtcttacctggactctggaatccattctggtgccactaccacagctccttctctgagtggtaaaggcaatcctgaggaagaggatgtggatacctcccaagtcctgtatgagtgggaacagggattttctcagtccttcactcaagaacaagtagctgatattgatggacagtatgcaatgactcgagctcagagggtacgagctgctatgttccctgagacattagatgagggcatgcagatcccatctacacagtttgatgctgctcatcccactaatgtccagcgtttggctgaaccatcacagatgctgaaacatgcagttgtaaacttgattaactatcaagatgatgcagaacttgccacacgtgcaatccctgaactgacaaaactgctaaatgacgaggaccaggtggtggttaataaggctgcagttatggtccatcagctttctaaaaaggaagcttccagacacgctatcatgcgttctcctcagatggtgtctgctattgtacgtaccatgcagaatacaaatgatgtagaaacagctcgttgtaccgctgggaccttgcataacctttcccatcatcgtgagggcttactggccatctttaagtctggaggcattcctgccctggtgaaaatgcttggttcaccagtggattctgtgttgttttatgccattacaactctccacaaccttttattacatcaagaaggagctaaaatggcagtgcgtttagctggtgggctgcagaaaatggttgccttgctcaacaaaacaaatgttaaattcttggctattacgacagactgccttcaaattttagcttatggcaaccaagaaagcaagctcatcatactggctagtggtggaccccaagctttagtaaatataatgaggacctatacttacgaaaaactactgtggaccacaagcagagtgctgaaggtgctatctgtctgctctagtaataagccggctattgtagaagctggtggaatgcaagctttaggacttcacctgacagatccaagtcaacgtcttgttcagaactgtctttggactctcaggaatctttcagatgctgcaactaaacaggaagggatggaaggtctccttgggactcttgttcagcttctgggttcagatgatataaatgtggtcacctgtgcagctggaattctttctaacctcacttgcaataattataagaacaagatgatggtctgccaagtgggtggtatagaggctcttgtgcgtactgtccttcgggctggtgacagggaagacatcactgagcctgccatctgtgctcttcgtcatctgaccagccgacaccaagaagcagagatggcccagaatgcagttcgccttcactatggactaccagttgtggttaagctcttacacccaccatcccactggcctctgataaaggctactgttggattgattcgaaatcttgccctttgtcccgcaaatcatgcacctttgcgtgagcagggtgccattccacgactagttcagttgcttgttcgtgcacatcaggatacccagcgccgtacgtccatgggtgggacacagcagcaatttgtggagggggtccgcatggaagaaatagttgaaggttgtaccggagcccttcacatcctagctcgggatgttcacaaccgaattgttatcagaggactaaataccattccattgtttgtgcagctgctttattctcccattgaaaacatccaaagagtagctgcaggggtcctctgtgaacttgctcaggacaaggaagctgcagaagctattgaagctgagggagccacagctcctctgacagagttacttcactctaggaatgaaggtgtggcgacatatgcagctgctgttttgttccgaatgtctgaggacaagccacaagattacaagaaacggctttcagttgagctgaccagctctctcttcagaacagagccaatggcttggaatgagactgctgatcttggacttgatattggtgcccagggagaaccccttggatatcgccaggatgatcctagctatcgttcttttcactctggtggatatggccaggatgccttgggtatggaccccatgatggaacatgagatgggtggccaccaccctggtgctgactatccagttgatgggctgccagatctggggcatgcccaggacctcatggatgggctgcctccaggtgacagcaatcagctggcctggtttgatactgacctgtaaatcatcctttaggtaagaagttttaaaaagccagtttgggtaaaatacttttactctgcctacagaacttcagaaagacttggttggtagggtgggagtggtttaggctatttgtaaatctgccacaaaaacaggtatatactttgaaaggagatgtcttggaacattggaatgttctcagatttctggttgttatgtgatcatgtgtggaagttattaactttaatgttttttgccacagcttttgcaacttaatactcaaatgagtaacatttgctgttttaaacattaatagcagcctttctctctttatacagctgtattgtctgaacttgcattgtgattggcctgtagagttgctgagagggctcgaggggtgggctggtatctcagaaagtgcctgacacactaaccaagctgagtttcctatgggaacaattgaagtaaactttttgttctggtcctttttggtcgaggagtaacaatacaaatggattttgggagtgactcaagaagtgaagaatgcacaagaatggatcacaagatggaatttatcaaaccctagccttgcttgttaaatttttttttttttttttttaagaatatctgtaatggtactgactttgcttgctttgaagtagctctttttttttttttttttttttttttgcagtaactgttttttaagtctctcgtagtgttaagttatagtgaatactgctacagcaatttctaatttttaagaattgagtaatggtgtagaacactaattcataatcactctaattaattgtaatctgaataaagtgtaacaattgtgtagcctttttgtataaaatagacaaatagaaaatggtccaattagtttcctttttaatatgcttaaaataagcaggtggatctatttcatgtttttgatcaaaaactatttgggatatgtatgggtagggtaaatcagtaagaggtgttatttggaaccttgttttggacagtttaccagttgccttttatcccaaagttgttgtaacctgctgtgatacgatgcttcaagagaaaatgcggttataaaaaatggttcagaattaaacttttaattcattcgattg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1499 -> Molecular function: GO:0001102 [RNA polymerase II activating transcription factor binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA GeneID:1499 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IEA GeneID:1499 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:1499 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: IDA GeneID:1499 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: IMP GeneID:1499 -> Molecular function: GO:0004871 [signal transducer activity] evidence: NAS GeneID:1499 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IBA GeneID:1499 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0008134 [transcription factor binding] evidence: TAS GeneID:1499 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0019900 [kinase binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IBA GeneID:1499 -> Molecular function: GO:0019903 [protein phosphatase binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0030331 [estrogen receptor binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0032403 [protein complex binding] evidence: IEA GeneID:1499 -> Molecular function: GO:0035255 [ionotropic glutamate receptor binding] evidence: IEA GeneID:1499 -> Molecular function: GO:0035257 [nuclear hormone receptor binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0035257 [nuclear hormone receptor binding] evidence: TAS GeneID:1499 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA GeneID:1499 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0045294 [alpha-catenin binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0045296 [cadherin binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0046332 [SMAD binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0050681 [androgen receptor binding] evidence: NAS GeneID:1499 -> Molecular function: GO:0070411 [I-SMAD binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0070412 [R-SMAD binding] evidence: IPI GeneID:1499 -> Molecular function: GO:0070491 [repressing transcription factor binding] evidence: IEA GeneID:1499 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IBA GeneID:1499 -> Biological process: GO:0000578 [embryonic axis specification] evidence: IBA GeneID:1499 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IBA GeneID:1499 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IC GeneID:1499 -> Biological process: GO:0001658 [branching involved in ureteric bud morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:1499 -> Biological process: GO:0001702 [gastrulation with mouth forming second] evidence: IBA GeneID:1499 -> Biological process: GO:0001708 [cell fate specification] evidence: IEA GeneID:1499 -> Biological process: GO:0001711 [endodermal cell fate commitment] evidence: IBA GeneID:1499 -> Biological process: GO:0001764 [neuron migration] evidence: IEA GeneID:1499 -> Biological process: GO:0001837 [epithelial to mesenchymal transition] evidence: TAS GeneID:1499 -> Biological process: GO:0001840 [neural plate development] evidence: IEA GeneID:1499 -> Biological process: GO:0001889 [liver development] evidence: IBA GeneID:1499 -> Biological process: GO:0002052 [positive regulation of neuroblast proliferation] evidence: IEA GeneID:1499 -> Biological process: GO:0002053 [positive regulation of mesenchymal cell proliferation] evidence: IEA GeneID:1499 -> Biological process: GO:0002089 [lens morphogenesis in camera-type eye] evidence: IEA GeneID:1499 -> Biological process: GO:0003136 [negative regulation of heart induction by canonical Wnt receptor signaling pathway] evidence: IBA GeneID:1499 -> Biological process: GO:0003266 [regulation of secondary heart field cardioblast proliferation] evidence: IEA GeneID:1499 -> Biological process: GO:0003337 [mesenchymal to epithelial transition involved in metanephros morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:1499 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:1499 -> Biological process: GO:0006921 [cellular component disassembly involved in execution phase of apoptosis] evidence: TAS GeneID:1499 -> Biological process: GO:0007016 [cytoskeletal anchoring at plasma membrane] evidence: IBA GeneID:1499 -> Biological process: GO:0007155 [cell adhesion] evidence: IMP GeneID:1499 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IBA GeneID:1499 -> Biological process: GO:0007398 [ectoderm development] evidence: IBA GeneID:1499 -> Biological process: GO:0007403 [glial cell fate determination] evidence: IBA GeneID:1499 -> Biological process: GO:0007494 [midgut development] evidence: IEA GeneID:1499 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA GeneID:1499 -> Biological process: GO:0009948 [anterior/posterior axis specification] evidence: IEA GeneID:1499 -> Biological process: GO:0009950 [dorsal/ventral axis specification] evidence: IBA GeneID:1499 -> Biological process: GO:0009954 [proximal/distal pattern formation] evidence: IBA GeneID:1499 -> Biological process: GO:0010909 [positive regulation of heparan sulfate proteoglycan biosynthetic process] evidence: IMP GeneID:1499 -> Biological process: GO:0014010 [Schwann cell proliferation] evidence: IBA GeneID:1499 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IDA GeneID:1499 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IMP GeneID:1499 -> Biological process: GO:0022009 [central nervous system vasculogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0030316 [osteoclast differentiation] evidence: IEA GeneID:1499 -> Biological process: GO:0030326 [embryonic limb morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0030521 [androgen receptor signaling pathway] evidence: NAS GeneID:1499 -> Biological process: GO:0030539 [male genitalia development] evidence: IBA GeneID:1499 -> Biological process: GO:0030900 [forebrain development] evidence: IEA GeneID:1499 -> Biological process: GO:0030902 [hindbrain development] evidence: IBA GeneID:1499 -> Biological process: GO:0030997 [regulation of centriole-centriole cohesion] evidence: IDA GeneID:1499 -> Biological process: GO:0031016 [pancreas development] evidence: IBA GeneID:1499 -> Biological process: GO:0031069 [hair follicle morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0031641 [regulation of myelination] evidence: IEA GeneID:1499 -> Biological process: GO:0032331 [negative regulation of chondrocyte differentiation] evidence: IBA GeneID:1499 -> Biological process: GO:0032355 [response to estradiol stimulus] evidence: IDA GeneID:1499 -> Biological process: GO:0032481 [positive regulation of type I interferon production] evidence: TAS GeneID:1499 -> Biological process: GO:0033077 [T cell differentiation in thymus] evidence: IBA GeneID:1499 -> Biological process: GO:0033234 [negative regulation of protein sumoylation] evidence: IDA GeneID:1499 -> Biological process: GO:0034097 [response to cytokine stimulus] evidence: IEA GeneID:1499 -> Biological process: GO:0034333 [adherens junction assembly] evidence: IMP GeneID:1499 -> Biological process: GO:0034394 [protein localization to cell surface] evidence: IMP GeneID:1499 -> Biological process: GO:0035050 [embryonic heart tube development] evidence: IEA GeneID:1499 -> Biological process: GO:0035112 [genitalia morphogenesis] evidence: IEA GeneID:1499 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA GeneID:1499 -> Biological process: GO:0035116 [embryonic hindlimb morphogenesis] evidence: IEA GeneID:1499 -> Biological process: GO:0035315 [hair cell differentiation] evidence: TAS GeneID:1499 -> Biological process: GO:0036023 [embryonic skeletal limb joint morphogenesis] evidence: ISS GeneID:1499 -> Biological process: GO:0042129 [regulation of T cell proliferation] evidence: IBA GeneID:1499 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: IBA GeneID:1499 -> Biological process: GO:0042493 [response to drug] evidence: IEP GeneID:1499 -> Biological process: GO:0042692 [muscle cell differentiation] evidence: TAS GeneID:1499 -> Biological process: GO:0042733 [embryonic digit morphogenesis] evidence: IEA GeneID:1499 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA GeneID:1499 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IBA GeneID:1499 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IBA GeneID:1499 -> Biological process: GO:0043587 [tongue morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0044334 [canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition] evidence: IMP GeneID:1499 -> Biological process: GO:0044336 [canonical Wnt receptor signaling pathway involved in negative regulation of apoptotic process] evidence: IMP GeneID:1499 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:1499 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IEA GeneID:1499 -> Biological process: GO:0045453 [bone resorption] evidence: IEA GeneID:1499 -> Biological process: GO:0045603 [positive regulation of endothelial cell differentiation] evidence: IEA GeneID:1499 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: IBA GeneID:1499 -> Biological process: GO:0045671 [negative regulation of osteoclast differentiation] evidence: IBA GeneID:1499 -> Biological process: GO:0045743 [positive regulation of fibroblast growth factor receptor signaling pathway] evidence: IBA GeneID:1499 -> Biological process: GO:0045765 [regulation of angiogenesis] evidence: TAS GeneID:1499 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP GeneID:1499 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA GeneID:1499 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IMP GeneID:1499 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:1499 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP GeneID:1499 -> Biological process: GO:0046686 [response to cadmium ion] evidence: IEA GeneID:1499 -> Biological process: GO:0048145 [regulation of fibroblast proliferation] evidence: TAS GeneID:1499 -> Biological process: GO:0048262 [determination of dorsal/ventral asymmetry] evidence: IBA GeneID:1499 -> Biological process: GO:0048469 [cell maturation] evidence: IEA GeneID:1499 -> Biological process: GO:0048489 [synaptic vesicle transport] evidence: IBA GeneID:1499 -> Biological process: GO:0048538 [thymus development] evidence: IBA GeneID:1499 -> Biological process: GO:0048599 [oocyte development] evidence: IBA GeneID:1499 -> Biological process: GO:0048617 [embryonic foregut morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0048660 [regulation of smooth muscle cell proliferation] evidence: IMP GeneID:1499 -> Biological process: GO:0048715 [negative regulation of oligodendrocyte differentiation] evidence: IEA GeneID:1499 -> Biological process: GO:0050808 [synapse organization] evidence: IBA GeneID:1499 -> Biological process: GO:0051145 [smooth muscle cell differentiation] evidence: IBA GeneID:1499 -> Biological process: GO:0051149 [positive regulation of muscle cell differentiation] evidence: TAS GeneID:1499 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA GeneID:1499 -> Biological process: GO:0060066 [oviduct development] evidence: IEA GeneID:1499 -> Biological process: GO:0060070 [canonical Wnt receptor signaling pathway] evidence: IDA GeneID:1499 -> Biological process: GO:0060440 [trachea formation] evidence: IBA GeneID:1499 -> Biological process: GO:0060441 [epithelial tube branching involved in lung morphogenesis] evidence: IEA GeneID:1499 -> Biological process: GO:0060479 [lung cell differentiation] evidence: IBA GeneID:1499 -> Biological process: GO:0060484 [lung-associated mesenchyme development] evidence: IBA GeneID:1499 -> Biological process: GO:0060492 [lung induction] evidence: IBA GeneID:1499 -> Biological process: GO:0060742 [epithelial cell differentiation involved in prostate gland development] evidence: IEA GeneID:1499 -> Biological process: GO:0060769 [positive regulation of epithelial cell proliferation involved in prostate gland development] evidence: IBA GeneID:1499 -> Biological process: GO:0060789 [hair follicle placode formation] evidence: IBA GeneID:1499 -> Biological process: GO:0060916 [mesenchymal cell proliferation involved in lung development] evidence: IBA GeneID:1499 -> Biological process: GO:0061047 [positive regulation of branching involved in lung morphogenesis] evidence: IBA GeneID:1499 -> Biological process: GO:0061154 [endothelial tube morphogenesis] evidence: IMP GeneID:1499 -> Biological process: GO:0061198 [fungiform papilla formation] evidence: IEA GeneID:1499 -> Biological process: GO:0061324 [canonical Wnt receptor signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation] evidence: ISS GeneID:1499 -> Biological process: GO:0070602 [regulation of centromeric sister chromatid cohesion] evidence: IMP GeneID:1499 -> Biological process: GO:0071363 [cellular response to growth factor stimulus] evidence: IMP GeneID:1499 -> Biological process: GO:0071681 [cellular response to indole-3-methanol] evidence: IDA GeneID:1499 -> Biological process: GO:0072033 [renal vesicle formation] evidence: IBA GeneID:1499 -> Biological process: GO:0072053 [renal inner medulla development] evidence: IBA GeneID:1499 -> Biological process: GO:0072054 [renal outer medulla development] evidence: IBA GeneID:1499 -> Biological process: GO:0072079 [nephron tubule formation] evidence: IBA GeneID:1499 -> Biological process: GO:0072182 [regulation of nephron tubule epithelial cell differentiation] evidence: ISS GeneID:1499 -> Biological process: GO:0090279 [regulation of calcium ion import] evidence: IDA GeneID:1499 -> Biological process: GO:2000008 [regulation of protein localization to cell surface] evidence: IDA GeneID:1499 -> Biological process: GO:2000017 [positive regulation of determination of dorsal identity] evidence: IEA GeneID:1499 -> Cellular component: GO:0000922 [spindle pole] evidence: IEA GeneID:1499 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1499 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:1499 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IDA GeneID:1499 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:1499 -> Cellular component: GO:0005813 [centrosome] evidence: IDA GeneID:1499 -> Cellular component: GO:0005829 [cytosol] evidence: IDA GeneID:1499 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1499 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:1499 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IDA GeneID:1499 -> Cellular component: GO:0005912 [adherens junction] evidence: IDA GeneID:1499 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: IDA GeneID:1499 -> Cellular component: GO:0005915 [zonula adherens] evidence: IBA GeneID:1499 -> Cellular component: GO:0005916 [fascia adherens] evidence: IBA GeneID:1499 -> Cellular component: GO:0005924 [cell-substrate adherens junction] evidence: IDA GeneID:1499 -> Cellular component: GO:0005938 [cell cortex] evidence: IDA GeneID:1499 -> Cellular component: GO:0009898 [internal side of plasma membrane] evidence: IBA GeneID:1499 -> Cellular component: GO:0016020 [membrane] evidence: ISS GeneID:1499 -> Cellular component: GO:0016323 [basolateral plasma membrane] evidence: IEA GeneID:1499 -> Cellular component: GO:0016328 [lateral plasma membrane] evidence: IDA GeneID:1499 -> Cellular component: GO:0016342 [catenin complex] evidence: IDA GeneID:1499 -> Cellular component: GO:0030018 [Z disc] evidence: IBA GeneID:1499 -> Cellular component: GO:0030027 [lamellipodium] evidence: IBA GeneID:1499 -> Cellular component: GO:0030054 [cell junction] evidence: IDA GeneID:1499 -> Cellular component: GO:0030054 [cell junction] evidence: TAS GeneID:1499 -> Cellular component: GO:0030057 [desmosome] evidence: IBA GeneID:1499 -> Cellular component: GO:0030877 [beta-catenin destruction complex] evidence: IDA GeneID:1499 -> Cellular component: GO:0031528 [microvillus membrane] evidence: IBA GeneID:1499 -> Cellular component: GO:0032993 [protein-DNA complex] evidence: IDA GeneID:1499 -> Cellular component: GO:0034750 [Scrib-APC-beta-catenin complex] evidence: IEA GeneID:1499 -> Cellular component: GO:0043198 [dendritic shaft] evidence: IBA GeneID:1499 -> Cellular component: GO:0045177 [apical part of cell] evidence: IEA GeneID:1499 -> Cellular component: GO:0045202 [synapse] evidence: IBA GeneID:1499 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA GeneID:1499 -> Cellular component: GO:0070369 [beta-catenin-TCF7L2 complex] evidence: IDA GeneID:1499 -> Cellular component: GO:0071944 [cell periphery] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.