2024-04-20 18:32:51, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001879 6476 bp mRNA linear PRI 02-JUN-2013 DEFINITION Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 1, mRNA. ACCESSION NM_001879 VERSION NM_001879.5 GI:294997266 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 6476) AUTHORS Megyeri,M., Harmat,V., Major,B., Vegh,A., Balczer,J., Heja,D., Szilagyi,K., Datz,D., Pal,G., Zavodszky,P., Gal,P. and Dobo,J. TITLE Quantitative characterization of the activation steps of mannan-binding lectin (MBL)-associated serine proteases (MASPs) points to the central role of MASP-1 in the initiation of the complement lectin pathway JOURNAL J. Biol. Chem. 288 (13), 8922-8934 (2013) PUBMED 23386610 REMARK GeneRIF: autoactivation of MASP-1 is crucial for the activation of MBL/ficolin.MASP complexes, and in the proenzymic phase zymogen MASP-1 controls the process REFERENCE 2 (bases 1 to 6476) AUTHORS Sekine,H., Takahashi,M., Iwaki,D. and Fujita,T. TITLE The role of MASP-1/3 in complement activation JOURNAL Adv. Exp. Med. Biol. 735, 41-53 (2013) PUBMED 23402018 REMARK GeneRIF: MASP-1 seems to be involved in activation of both the lectin and alternative complement pathways--{review} Review article REFERENCE 3 (bases 1 to 6476) AUTHORS Degn,S.E., Jensen,L., Hansen,A.G., Duman,D., Tekin,M., Jensenius,J.C. and Thiel,S. TITLE Mannan-binding lectin-associated serine protease (MASP)-1 is crucial for lectin pathway activation in human serum, whereas neither MASP-1 nor MASP-3 is required for alternative pathway function JOURNAL J. Immunol. 189 (8), 3957-3969 (2012) PUBMED 22966085 REMARK GeneRIF: A crucial role of MASP-1 is demonstrated in the activation of MASP-2, as well as of MASP-3, based on a patient harboring a nonsense mutation in the common part of the MASP1 gene. REFERENCE 4 (bases 1 to 6476) AUTHORS Skjoedt,M.O., Roversi,P., Hummelshoj,T., Palarasah,Y., Rosbjerg,A., Johnson,S., Lea,S.M. and Garred,P. TITLE Crystal structure and functional characterization of the complement regulator mannose-binding lectin (MBL)/ficolin-associated protein-1 (MAP-1) JOURNAL J. Biol. Chem. 287 (39), 32913-32921 (2012) PUBMED 22854970 REMARK GeneRIF: MAP-1 competes with all three MASPs for ligand binding and is able to mediate a strong dose-dependent inhibitory effect on the lectin pathway activation, as measured by levels of C3 and C9. REFERENCE 5 (bases 1 to 6476) AUTHORS Heja,D., Kocsis,A., Dobo,J., Szilagyi,K., Szasz,R., Zavodszky,P., Pal,G. and Gal,P. TITLE Revised mechanism of complement lectin-pathway activation revealing the role of serine protease MASP-1 as the exclusive activator of MASP-2 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (26), 10498-10503 (2012) PUBMED 22691502 REMARK GeneRIF: MASP-1 activates MASP-2 and, moreover, inhibition of MASP-1 prevents autoactivation of MASP-2 REFERENCE 6 (bases 1 to 6476) AUTHORS Endo,M., Ohi,H., Ohsawa,I., Fujita,T., Matsushita,M. and Fujita,T. TITLE Glomerular deposition of mannose-binding lectin (MBL) indicates a novel mechanism of complement activation in IgA nephropathy JOURNAL Nephrol. Dial. Transplant. 13 (8), 1984-1990 (1998) PUBMED 9719152 REFERENCE 7 (bases 1 to 6476) AUTHORS Endo,Y., Sato,T., Matsushita,M. and Fujita,T. TITLE Exon structure of the gene encoding the human mannose-binding protein-associated serine protease light chain: comparison with complement C1r and C1s genes JOURNAL Int. Immunol. 8 (9), 1355-1358 (1996) PUBMED 8921412 REFERENCE 8 (bases 1 to 6476) AUTHORS Takada,F., Seki,N., Matsuda,Y., Takayama,Y. and Kawakami,M. TITLE Localization of the genes for the 100-kDa complement-activating components of Ra-reactive factor (CRARF and Crarf) to human 3q27-q28 and mouse 16B2-B3 JOURNAL Genomics 25 (3), 757-759 (1995) PUBMED 7759119 REFERENCE 9 (bases 1 to 6476) AUTHORS Sato,T., Endo,Y., Matsushita,M. and Fujita,T. TITLE Molecular characterization of a novel serine protease involved in activation of the complement system by mannose-binding protein JOURNAL Int. Immunol. 6 (4), 665-669 (1994) PUBMED 8018603 REFERENCE 10 (bases 1 to 6476) AUTHORS Takada,F., Takayama,Y., Hatsuse,H. and Kawakami,M. TITLE A new member of the C1s family of complement proteins found in a bactericidal factor, Ra-reactive factor, in human serum JOURNAL Biochem. Biophys. Res. Commun. 196 (2), 1003-1009 (1993) PUBMED 8240317 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC423174.1, D28593.1 and AC007920.18. This sequence is a reference standard in the RefSeqGene project. On Apr 22, 2010 this sequence version replaced gi:73623023. Summary: This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]. Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1. This isoform (1) is referred to as MASP1 in the literature. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-340 DC423174.1 1-340 341-1092 D28593.1 41-792 1093-1093 AC007920.18 105151-105151 1094-1243 D28593.1 794-943 1244-1244 AC007920.18 108650-108650 1245-1885 D28593.1 945-1585 1886-1886 AC007920.18 135390-135390 1887-2646 D28593.1 1587-2346 2647-6476 AC007920.18 141942-145771 FEATURES Location/Qualifiers source 1..6476 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3q27-q28" gene 1..6476 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)" /db_xref="GeneID:5648" /db_xref="HGNC:6901" /db_xref="HPRD:02749" /db_xref="MIM:600521" exon 1..395 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" misc_feature 58..60 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="upstream in-frame stop codon" variation 325 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72549255" CDS 391..2490 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /EC_number="3.4.21.-" /note="isoform 1 precursor is encoded by transcript variant 1; Ra-reactive factor serine protease p100; mannan-binding lectin serine protease 1; serine protease 5; complement factor MASP-3; mannose-binding protein-associated serine protease; mannose-binding lectin-associated serine protease 1; complement-activating component of Ra-reactive factor" /codon_start=1 /product="mannan-binding lectin serine protease 1 isoform 1 precursor" /protein_id="NP_001870.3" /db_xref="GI:21264357" /db_xref="CCDS:CCDS33907.1" /db_xref="GeneID:5648" /db_xref="HGNC:6901" /db_xref="HPRD:02749" /db_xref="MIM:600521" /translation="
MRWLLLYYALCFSLSKASAHTVELNNMFGQIQSPGYPDSYPSDSEVTWNITVPDGFRIKLYFMHFNLESSYLCEYDYVKVETEDQVLATFCGRETTDTEQTPGQEVVLSPGSFMSITFRSDFSNEERFTGFDAHYMAVDVDECKEREDEELSCDHYCHNYIGGYYCSCRFGYILHTDNRTCRVECSDNLFTQRTGVITSPDFPNPYPKSSECLYTIELEEGFMVNLQFEDIFDIEDHPEVPCPYDYIKIKVGPKVLGPFCGEKAPEPISTQSHSVLILFHSDNSGENRGWRLSYRAAGNECPELQPPVHGKIEPSQAKYFFKDQVLVSCDTGYKVLKDNVEMDTFQIECLKDGTWSNKIPTCKIVDCRAPGELEHGLITFSTRNNLTTYKSEIKYSCQEPYYKMLNNNTGIYTCSAQGVWMNKVLGRSLPTCLPVCGLPKFSRKLMARIFNGRPAQKGTTPWIAMLSHLNGQPFCGGSLLGSSWIVTAAHCLHQSLDPEDPTLRDSDLLSPSDFKIILGKHWRLRSDENEQHLGVKHTTLHPQYDPNTFENDVALVELLESPVLNAFVMPICLPEGPQQEGAMVIVSGWGKQFLQRFPETLMEIEIPIVDHSTCQKAYAPLKKKVTRDMICAGEKEGGKDACAGDSGGPMVTLNRERGQWYLVGTVSWGDDCGKKDRYGVYSYIHHNKDWIQRVTGVRN
" sig_peptide 391..447 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 448..1734 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /product="mannan-binding lectin serine protease 1 heavy chain isoform 1" misc_feature 448..1224 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P48740.3); Region: Interaction with FCN2" misc_feature 448..942 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P48740.3); Region: Homodimerization (By similarity)" misc_feature 448..942 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P48740.3); Region: Interaction with MBL2" misc_feature 463..801 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="CUB domain; extracellular domain; present in proteins mostly known to be involved in development; not found in prokaryotes, plants and yeast; Region: CUB; cd00041" /db_xref="CDD:28922" misc_feature order(472..474,478..480,484..486,565..567,580..582, 706..708,784..786,790..792,796..801) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="heterodimerization interface [polypeptide binding]; other site" /db_xref="CDD:28922" misc_feature 805..918 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(805..807,814..816,865..867) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 943..1278 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="CUB domain; extracellular domain; present in proteins mostly known to be involved in development; not found in prokaryotes, plants and yeast; Region: CUB; cd00041" /db_xref="CDD:28922" misc_feature order(970..972,976..978,982..984,1063..1065,1078..1080, 1189..1191,1261..1263,1267..1269,1273..1278) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="heterodimerization interface [polypeptide binding]; other site" /db_xref="CDD:28922" misc_feature 1291..1479 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="Complement control protein (CCP) modules (aka short consensus repeats SCRs or SUSHI repeats) have been identified in several proteins of the complement system; Region: CCP; cd00033" /db_xref="CDD:153056" misc_feature order(1321..1323,1378..1380) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="receptor-ligand interactions; other site" /db_xref="CDD:153056" misc_feature 1489..1686 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="Complement control protein (CCP) modules (aka short consensus repeats SCRs or SUSHI repeats) have been identified in several proteins of the complement system; Region: CCP; cd00033" /db_xref="CDD:153056" misc_feature order(1519..1521,1585..1587) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="receptor-ligand interactions; other site" /db_xref="CDD:153056" misc_feature 1732..1737 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /experiment="experimental evidence, no additional details recorded" /note="Cleavage, by autolysis; propagated from UniProtKB/Swiss-Prot (P48740.3); cleavage site" mat_peptide 1735..2487 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /product="mannan-binding lectin serine protease 1 light chain isoform 1" misc_feature 1735..2472 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="Trypsin-like serine protease; Many of these are synthesized as inactive precursor zymogens that are cleaved during limited proteolysis to generate their active forms. Alignment contains also inactive enzymes that have substitutions of the catalytic triad...; Region: Tryp_SPc; cd00190" /db_xref="CDD:29152" misc_feature 1735..1737 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="cleavage site" /db_xref="CDD:29152" misc_feature order(1858..1860,2044..2046,2326..2328) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="active site" /db_xref="CDD:29152" misc_feature order(2308..2310,2389..2391,2395..2397) /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="substrate binding sites [chemical binding]; other site" /db_xref="CDD:29152" exon 396..627 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 450 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549248" variation 452 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:1062049" exon 628..805 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 806..937 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 807 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549252" variation 856 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:200376787" exon 938..1134 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1027 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:28945069" variation 1093 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:3203210" variation 1121 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:28945071" exon 1135..1282 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1283..1401 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1402..1480 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1481..1618 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1515 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:34207306" exon 1619..1693 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1667 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:28945068" exon 1694..1831 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1815 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549158" exon 1832..1945 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1918 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:28945070" exon 1946..2131 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1963 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:28945073" variation 2034 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="t" /db_xref="dbSNP:28945072" variation 2037 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549170" exon 2132..2199 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 2200..2299 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 2300..6476 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 2319 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:35472527" STS 2626..2815 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="STS-D17525" /db_xref="UniSTS:47674" STS 2632..2967 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="SHGC-144506" /db_xref="UniSTS:174259" variation 2723 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="g" /replace="t" /db_xref="dbSNP:3203213" variation 2728 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="g" /replace="t" /db_xref="dbSNP:3203214" variation 2781 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:17040" variation 2828 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:1139134" variation 2920 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549163" variation 3073 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:3864096" STS 3138..3253 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="WI-9292" /db_xref="UniSTS:71339" variation 3149 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="c" /db_xref="dbSNP:3852053" variation 3245 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72550736" STS 3323..3542 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="G15960" /db_xref="UniSTS:7221" variation 3480 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:3206230" variation 3636 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72550737" variation 3668..3669 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549151" variation 3669 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72549150" STS 3760..4541 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="MASP1_V208" /db_xref="UniSTS:280841" variation 3992 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:3206231" variation 4192 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:3206232" variation 4248 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72549265" variation 4424 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549264" STS 4974..5221 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="RH75422" /db_xref="UniSTS:88054" STS 5067..5137 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="D3S3485E" /db_xref="UniSTS:154074" STS 5073..5202 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="RH93986" /db_xref="UniSTS:87294" STS 6258..6364 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /standard_name="SHGC-77643" /db_xref="UniSTS:57206" polyA_signal 6455..6460 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" polyA_site 6476 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" ORIGIN
acacacagagtgatacaaatacctgcttgagcccctcagttattttctctcaagggctgaagtcagccacacaggataaaggagggaagggaaggagcagatcttttcggtaggaagacagattttgttgtcaggttcctgggagtgcaagagcaagtcaaaggagagagagaggagagaggaaaagccagagggagagagggggagaggggatctgttgcaggcaggggaaggcgtgacctgaatggagaatgccagccaattccagagacacacagggacctcagaacaaagataaggcatcacggacaccacaccgggcacgagctcacaggcaagtcaagctgggaggaccaaggccgggcagccgggagcacccaaggcaggaaaatgaggtggctgcttctctattatgctctgtgcttctccctgtcaaaggcttcagcccacaccgtggagctaaacaatatgtttggccagatccagtcgcctggttatccagactcctatcccagtgattcagaggtgacttggaatatcactgtcccagatgggtttcggatcaagctttacttcatgcacttcaacttggaatcctcctacctttgtgaatatgactatgtgaaggtagaaactgaggaccaggtgctggcaaccttctgtggcagggagaccacagacacagagcagactcccggccaggaggtggtcctctcccctggctccttcatgtccatcactttccggtcagatttctccaatgaggagcgtttcacaggctttgatgcccactacatggctgtggatgtggacgagtgcaaggagagggaggacgaggagctgtcctgtgaccactactgccacaactacattggcggctactactgctcctgccgcttcggctacatcctccacacagacaacaggacctgccgagtggagtgcagtgacaacctcttcactcaaaggactggggtgatcaccagccctgacttcccaaacccttaccccaagagctctgaatgcctgtataccatcgagctggaggagggtttcatggtcaacctgcagtttgaggacatatttgacattgaggaccatcctgaggtgccctgcccctatgactacatcaagatcaaagttggtccaaaagttttggggcctttctgtggagagaaagccccagaacccatcagcacccagagccacagtgtcctgatcctgttccatagtgacaactcgggagagaaccggggctggaggctctcatacagggctgcaggaaatgagtgcccagagctacagcctcctgtccatgggaaaatcgagccctcccaagccaagtatttcttcaaagaccaagtgctcgtcagctgtgacacaggctacaaagtgctgaaggataatgtggagatggacacattccagattgagtgtctgaaggatgggacgtggagtaacaagattcccacctgtaaaattgtagactgtagagccccaggagagctggaacacgggctgatcaccttctctacaaggaacaacctcaccacatacaagtctgagatcaaatactcctgtcaggagccctattacaagatgctcaacaataacacaggtatatatacctgttctgcccaaggagtctggatgaataaagtattggggagaagcctacccacctgccttccagtgtgtgggctccccaagttctcccggaagctgatggccaggatcttcaatggacgcccagcccagaaaggcaccactccctggattgccatgctgtcacacctgaatgggcagcccttctgcggaggctcccttctaggctccagctggatcgtgaccgccgcacactgcctccaccagtcactcgatccggaagatccgaccctacgtgattcagacttgctcagcccttctgacttcaaaatcatcctgggcaagcattggaggctccggtcagatgaaaatgaacagcatctcggcgtcaaacacaccactctccacccccagtatgatcccaacacattcgagaatgacgtggctctggtggagctgttggagagcccagtgctgaatgccttcgtgatgcccatctgtctgcctgagggaccccagcaggaaggagccatggtcatcgtcagcggctgggggaagcagttcttgcaaaggttcccagagaccctgatggagattgaaatcccgattgttgaccacagcacctgccagaaggcttatgccccgctgaagaagaaagtgaccagggacatgatctgtgctggggagaaggaagggggaaaggacgcctgtgcgggtgactctggaggccccatggtgaccctgaatagagaaagaggccagtggtacctggtgggcactgtgtcctggggtgatgactgtgggaagaaggaccgctacggagtatactcttacatccaccacaacaaggactggatccagagggtcaccggagtgaggaactgaatttggctcctcagccccagcaccaccagctgtgggcagtcagtagcagaggacgatcctccgatgaaagcagccatttctcctttccttcctcccatcccccctccttcggcctatccattactgggcaatagagcaggtatcttcacccccttttcactctctttaaagagatggagcaagagagtggtcagaacacaggccgaatccaggctctatcacttactagtttgcagtgctgggcaggtgacttcatctcttcgaacttcagtttcttcataagatggaaatgctataccttacctacctcgtaaaagtctgatgaggaaaagattaactaatagatgcatagcacttaacagagtgcatagcatacactgttttcaataaatgcaccttagcagaaggtcgatgtgtctaccaggcagacgaagctctcttacaaacccctgcctgggtcttagcattgatcagtgacacacctctcccctcaaccttgaccatctccatctgcccttaaatgctgtatgcttttttgccaccgtgcaacttgcccaacatcaatcttcaccctcatccctaaaaaagtaaaacagacaaggttctgagtcctgtggtatgtcccctagcaaatgtaactaggaacatgcactagatgacagattgcgggagggcctgagagaagcagggacaggagggagcctggggattgtggtttgggaaggcagacacctggttctagaactagctctgcccttagccccctgtatgaccctatgcaagtcctcctccctcatctcaaagggtcctcaaagctctgacgatctaagatacaatgaagccattttccccctgataagatgaggtaaagccaatgtaaccaaaaggcaaaaattacaatcggttcaaaggaactttgatgcagacaaaatgctgctgctgctgctcctgaaatacccacccctttccactacgggtgggttcccaaggacatgggacaggcaaagtgtgagccaaaggatccttccttattcctaagcagagcatctgctctgggccctggcctccttcccttcttgggaaactgggctgcatgaggtgggccctggtagtttgtaccccaggcccctatactcttccttcctatgtccacagctgaccccaagcagccgttccccgactcctcacccctgagcctcaccctgaactccctcatcttgcaaggccataagtgttttccaagcaaaatgcctctcccatcctctctcaggaagcttctagagactttatgccctccagagctccaagatataagccctccaagggatcagaagctccaagttcctgtcttctgttttatagaaattgatcttccctgggggactttaactcttgacctgtatgcagctgttggagtaattccaggtctcttgaaaaaaaagaggaagataatggagaatgagaacatatatatatatatattaagccccaggctgaatactcagggacagcaattcacagcctgcctctggttctataaacaagtcattctacctctttgtgccctgctgtttattctgtaaggggaaggtggcaatgggacccagctccatcagacacttgtcaagctagcagaaactccattttcaatgccaaagaagaactgtaatgctgttttggaatcatcccaaggcatcccaagacaccatatcttcccatttcaagcactgcctgggcacaccccaacatcccaggctgtggtggctcctgtgggaactacctagatgaagagagtatcatttataccttctaggagctcctattgggagacatgaaacatatgtaattgactaccatgtaatagaacaaaccctgccaagtgctgctttggaaagtcatggaggtaaaagaaagaccattctggtatgaaggttttgggggaggagatatcaatcaagaaggcttcccagaagaggtgactggaccagagccttgtccacaggtaagacggaggaggccttccacatggagggagaacaatagtaaatgtccactcaagatgtcctttattataccagctcctcccacaaaaacacatgtccagtggactctttttctgggatcagaaccaacaccaaaaagagcttttctccttaaagttagaattctaaacaggacttgaaatggcctcaaggtttgtgcacaaatactgacttctggctggacccagcttattctgtttatttctccaattgcaatttcatccttatcctgagaaaatgtctaaataggccatggaacccaggcttccccgtgacctacaagcacttattagctgtgccagctcctgcactgctgctaaggtccaagaaacccagatctctcacagagccatagaagcagagggctggagtatctgtgaggacaacaaccttgtctaacttcgcgacctcattcttgagcatttctactgatgagaaactcactacccccaattgcagctcattcaactttaaaattgctgctttttgaatcactgattgtgaatattaatttaaaaaaataagtaagaaaatgttttaaatgtgctgcctctttaaaaggtctcctctttgtgcaaccaaaacccacctctctagaatacagtttgtataactgaagctataatttcataccatgagtgctgctgttagcaataataatcatgcccggattttattaacaacagaagctgttgctcgtatgaaaaaacaaacattagttctaataaacatctgcattgagtcaaagctccctgtttgtttgtatgtcttttatgcactgatgattatagtgagttgctttcatttaccaacattttgttgtattcgtgtaggatcactgtaccatgaagggagagagactatgatgggaagattgttgtagatacaaaagcatgtcttaggtttttgggtcagttctgtttaaatacctgtcctattattcctgtaaattatcaaaatatcccagaatgtcaatgtttctgcatccacattacaattattaaatgccactcatttattaaatttactattatcagtggcatttaataaatttgaatcatatgttcagtgtttggtttagaaaatatggtgccatgtctatgagtggcctgttctggattggagtacatgccttctttctgccttgagttaatcttactcaatggagaacaagaatcaaagaaacaccaccaccaagaagcccttcaagctagagttgggcaagagtcagggaggggaatgtagaccactcatatgacagaggtggaaaccaatcttggtctagaataagtctcaaaatcaaaagacttgaattctagtgcagcgtaggttgactcccttatttatttaattttcccatctctacaccgctagaataacctctctcctgaggctgttgaatctgatgaattagcagataggaaagaacttagaaaattataagttcactcaaatgtaaaaggttatatgggaaataatcaccactaacatttttgagtacttactatctgcttgttatacacattctctaatttaattttcacaagaaaattcatgaaaggactatacttatcccccttttacaggtgagcaacctggagtgcagtgaagtgtaaaatgtgggccgacttaggagcacaaataccccagcaacaatgagcactcttagtacacaggtcttggtttctaaaatatcatcatccgataaaaggaacacaggctctttgaagaaatgactgattccgggattggggcaagaaacacacaagctgagactggagcatcttgcagtcccagaaagtgaagaaacgctgaggatatgtcaaagggacacaggagccaaatgaaagagcttccactggccaaagctggaatgttgagcaacaaagcaacatagcattggataataacccaaagtataaaataaatattcatgagtacata
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5648 -> Molecular function: GO:0004252 [serine-type endopeptidase activity] evidence: IDA GeneID:5648 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA GeneID:5648 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5648 -> Molecular function: GO:0008233 [peptidase activity] evidence: IDA GeneID:5648 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI GeneID:5648 -> Molecular function: GO:0048306 [calcium-dependent protein binding] evidence: IPI GeneID:5648 -> Biological process: GO:0001867 [complement activation, lectin pathway] evidence: IMP GeneID:5648 -> Biological process: GO:0001867 [complement activation, lectin pathway] evidence: TAS GeneID:5648 -> Biological process: GO:0006508 [proteolysis] evidence: IEA GeneID:5648 -> Biological process: GO:0006956 [complement activation] evidence: TAS GeneID:5648 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:5648 -> Biological process: GO:0045916 [negative regulation of complement activation] evidence: IDA GeneID:5648 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS GeneID:5648 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001870 -> EC 3.4.21.-
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.