Home |
Help |
Advanced search
2024-04-17 05:33:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001856 5584 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens collagen, type XVI, alpha 1 (COL16A1), mRNA.
ACCESSION NM_001856
VERSION NM_001856.3 GI:100913219
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5584)
AUTHORS Knaup,J., Verwanger,T., Gruber,C., Ziegler,V., Bauer,J.W. and
Krammer,B.
TITLE Epidermolysis bullosa - a group of skin diseases with different
causes but commonalities in gene expression
JOURNAL Exp. Dermatol. 21 (7), 526-530 (2012)
PUBMED 22716248
REMARK GeneRIF: Gene expression profiles showed that COL16A1 was
up-regulated in epidermolysis bullosa subtypes.
REFERENCE 2 (bases 1 to 5584)
AUTHORS Ratzinger,S., Grassel,S., Dowejko,A., Reichert,T.E. and Bauer,R.J.
TITLE Induction of type XVI collagen expression facilitates proliferation
of oral cancer cells
JOURNAL Matrix Biol. 30 (2), 118-125 (2011)
PUBMED 21251976
REMARK GeneRIF: Overexpression of type XVI collagen in aberrant oral
keratinocytes leads to Kindlin-1 induction, increased
Kindlin-1/beta1-integrin interaction, integrin activation and
subsequently to a proliferative cellular phenotype.
REFERENCE 3 (bases 1 to 5584)
AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
CONSRTM DREAM investigators
TITLE Variation at the NFATC2 locus increases the risk of
thiazolidinedione-induced edema in the Diabetes REduction
Assessment with ramipril and rosiglitazone Medication (DREAM) study
JOURNAL Diabetes Care 33 (10), 2250-2253 (2010)
PUBMED 20628086
REMARK GeneRIF: Observational study of gene-disease association,
gene-environment interaction, and pharmacogenomic / toxicogenomic.
(HuGE Navigator)
REFERENCE 4 (bases 1 to 5584)
AUTHORS Ratzinger,S., Eble,J.A., Pasoldt,A., Opolka,A., Rogler,G.,
Grifka,J. and Grassel,S.
TITLE Collagen XVI induces formation of focal contacts on intestinal
myofibroblasts isolated from the normal and inflamed intestinal
tract
JOURNAL Matrix Biol. 29 (3), 177-193 (2010)
PUBMED 19931388
REMARK GeneRIF: Collagen XVI promotes persistence of intestinal
subepithelial myofibroblasts in the normal and in the inflamed
bowel wall by stabilizing focal adhesion contacts.
REFERENCE 5 (bases 1 to 5584)
AUTHORS Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium
TITLE Gene-centric association signals for lipids and apolipoproteins
identified via the HumanCVD BeadChip
JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009)
PUBMED 19913121
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 6 (bases 1 to 5584)
AUTHORS Grassel,S., Timpl,R., Tan,E.M. and Chu,M.L.
TITLE Biosynthesis and processing of type XVI collagen in human
fibroblasts and smooth muscle cells
JOURNAL Eur. J. Biochem. 242 (3), 576-584 (1996)
PUBMED 9022684
REFERENCE 7 (bases 1 to 5584)
AUTHORS Tillet,E., Mann,K., Nischt,R., Pan,T.C., Chu,M.L. and Timpl,R.
TITLE Recombinant analysis of human alpha 1 (XVI) collagen. Evidence for
processing of the N-terminal globular domain
JOURNAL Eur. J. Biochem. 228 (1), 160-168 (1995)
PUBMED 7882999
REFERENCE 8 (bases 1 to 5584)
AUTHORS Sires,U.I., Dublet,B., Aubert-Foucher,E., van der Rest,M. and
Welgus,H.G.
TITLE Degradation of the COL1 domain of type XIV collagen by 92-kDa
gelatinase
JOURNAL J. Biol. Chem. 270 (3), 1062-1067 (1995)
PUBMED 7836360
REFERENCE 9 (bases 1 to 5584)
AUTHORS Yamaguchi,N., Kimura,S., McBride,O.W., Hori,H., Yamada,Y.,
Kanamori,T., Yamakoshi,H. and Nagai,Y.
TITLE Molecular cloning and partial characterization of a novel collagen
chain, alpha 1(XVI), consisting of repetitive collagenous domains
and cysteine-containing non-collagenous segments
JOURNAL J. Biochem. 112 (6), 856-863 (1992)
PUBMED 1284248
REFERENCE 10 (bases 1 to 5584)
AUTHORS Pan,T.C., Zhang,R.Z., Mattei,M.G., Timpl,R. and Chu,M.L.
TITLE Cloning and chromosomal location of human alpha 1(XVI) collagen
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (14), 6565-6569 (1992)
PUBMED 1631157
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC064839.1, AC114488.3,
M92642.1 and S57132.1.
On May 25, 2006 this sequence version replaced gi:18641351.
Summary: This gene encodes the alpha chain of type XVI collagen, a
member of the FACIT collagen family (fibril-associated collagens
with interrupted helices). Members of this collagen family are
found in association with fibril-forming collagens such as type I
and II, and serve to maintain the integrity of the extracellular
matrix. High levels of type XVI collagen have been found in
fibroblasts and keratinocytes, and in smooth muscle and amnion.
[provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
[ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2866 BC064839.1 153-3018
2867-2903 AC114488.3 118219-118255 c
2904-3845 M92642.1 2689-3630
3846-5331 S57132.1 2227-3712
5332-5584 AC114488.3 87532-87784 c
FEATURES Location/Qualifiers
source 1..5584
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p35-p34"
gene 1..5584
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/note="collagen, type XVI, alpha 1"
/db_xref="GeneID:1307"
/db_xref="HGNC:2193"
/db_xref="MIM:120326"
exon 1..331
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 332..438
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
misc_feature 348..350
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/note="upstream in-frame stop codon"
CDS 366..5180
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/note="collagen XVI, alpha-1 polypeptide; collagen
alpha-1(XVI) chain; alpha 1 type XVI collagen"
/codon_start=1
/product="collagen alpha-1(XVI) chain precursor"
/protein_id="NP_001847.3"
/db_xref="GI:100913220"
/db_xref="CCDS:CCDS41297.1"
/db_xref="GeneID:1307"
/db_xref="HGNC:2193"
/db_xref="MIM:120326"
/translation="
MWVSWAPGLWLLGLWATFGHGANTGAQCPPSQQEGLKLEHSSSLPANVTGFNLIHRLSLMKTSAIKKIRNPKGPLILRLGAAPVTQPTRRVFPRGLPEEFALVLTLLLKKHTHQKTWYLFQVTDANGYPQISLEVNSQERSLELRAQGQDGDFVSCIFPVPQLFDLRWHKLMLSVAGRVASVHVDCSSASSQPLGPRRPMRPVGHVFLGLDAEQGKPVSFDLQQVHIYCDPELVLEEGCCEILPAGCPPETSKARRDTQSNELIEINPQSEGKVYTRCFCLEEPQNSEVDAQLTGRISQKAERGAKVHQETAADECPPCVHGARDSNVTLAPSGPKGGKGERGLPGPPGSKGEKGARGNDCVRISPDAPLQCAEGPKGEKGESGALGPSGLPGSTGEKGQKGEKGDGGIKGVPGKPGRDGRPGEICVIGPKGQKGDPGFVGPEGLAGEPGPPGLPGPPGIGLPGTPGDPGGPPGPKGDKGSSGIPGKEGPGGKPGKPGVKGEKGDPCEVCPTLPEGFQNFVGLPGKPGPKGEPGDPVPARGDPGIQGIKGEKGEPCLSCSSVVGAQHLVSSTGASGDVGSPGFGLPGLPGRAGVPGLKGEKGNFGEAGPAGSPGPPGPVGPAGIKGAKGEPCEPCPALSNLQDGDVRVVALPGPSGEKGEPGPPGFGLPGKQGKAGERGLKGQKGDAGNPGDPGTPGTTGRPGLSGEPGVQGPAGPKGEKGDGCTACPSLQGTVTDMAGRPGQPGPKGEQGPEGVGRPGKPGQPGLPGVQGPPGLKGVQGEPGPPGRGVQGPQGEPGAPGLPGIQGLPGPRGPPGPTGEKGAQGSPGVKGATGPVGPPGASVSGPPGRDGQQGQTGLRGTPGEKGPRGEKGEPGECSCPSQGDLIFSGMPGAPGLWMGSSWQPGPQGPPGIPGPPGPPGVPGLQGVPGNNGLPGQPGLTAELGSLPIEQHLLKSICGDCVQGQRAHPGYLVEKGEKGDQGIPGVPGLDNCAQCFLSLERPRAEEARGDNSEGDPGCVGSPGLPGPPGLPGQRGEEGPPGMRGSPGPPGPIGPPGFPGAVGSPGLPGLQGERGLTGLTGDKGEPGPPGQPGYPGATGPPGLPGIKGERGYTGSAGEKGEPGPPGSEGLPGPPGPAGPRGERGPQGNSGEKGDQGFQGQPGFPGPPGPPGFPGKVGSPGPPGPQAEKGSEGIRGPSGLPGSPGPPGPPGIQGPAGLDGLDGKDGKPGLRGDPGPAGPPGLMGPPGFKGKTGHPGLPGPKGDCGKPGPPGSTGRPGAEGEPGAMGPQGRPGPPGHVGPPGPPGQPGPAGISAVGLKGDRGATGERGLAGLPGQPGPPGHPGPPGEPGTDGAAGKEGPPGKQGFYGPPGPKGDPGAAGQKGQAGEKGRAGMPGGPGKSGSMGPVGPPGPAGERGHPGAPGPSGSPGLPGVPGSMGDMVNYDEIKRFIRQEIIKMFDERMAYYTSRMQFPMEMAAAPGRPGPPGKDGAPGRPGAPGSPGLPGQIGREGRQGLPGVRGLPGTKGEKGDIGIGIAGENGLPGPPGPQGPPGYGKMGATGPMGQQGIPGIPGPPGPMGQPGKAGHCNPSDCFGAMPMEQQYPPMKTMKGPFG
"
sig_peptide 366..428
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 513..1058
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/note="Thrombospondin N-terminal -like domains; Region:
TSPN; smart00210"
/db_xref="CDD:128506"
misc_feature 1059..1487
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 10 (NC10)"
misc_feature 1488..1883
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 9 (COL9) with 3
imperfections"
misc_feature 1884..1928
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 9 (NC9)"
misc_feature 1929..2030
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 8 (COL8) with 1
imperfection"
misc_feature 1983..1991
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Cell attachment site (Potential)"
misc_feature 2031..2081
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 8 (NC8)"
misc_feature 2082..2258
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 7 (COL7) with 1
imperfection"
misc_feature 2259..2321
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 7 (NC7)"
misc_feature 2322..2534
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 6 (COL6) with 1
imperfection"
misc_feature 2535..2579
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 6 (NC6)"
misc_feature 2580..2993
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 5 (COL5) with 3
imperfections"
misc_feature 2994..3026
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 5 (NC5)"
misc_feature 3027..3182
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 4 (COL4) with 2
imperfections"
misc_feature 3183..3284
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 4 (NC4)"
misc_feature 3285..3329
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 3 (COL3)"
misc_feature 3330..3398
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 3 (NC3)"
misc_feature 3381..3389
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Cell attachment site (Potential)"
misc_feature 3399..4664
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 2 (COL2) with 2
imperfections"
misc_feature 4044..4052
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Cell attachment site (Potential)"
misc_feature 4665..4781
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 2 (NC2)"
misc_feature 4782..5099
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Triple-helical region 1 (COL1) with 2
imperfections"
misc_feature 5100..5177
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07092.2);
Region: Nonhelical region 1 (NC1)"
exon 439..513
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 446
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="t"
/db_xref="dbSNP:2229802"
exon 514..631
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 550
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="c"
/db_xref="dbSNP:2228552"
exon 632..755
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 633
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="c"
/db_xref="dbSNP:2228550"
variation 656
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228551"
variation 712
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:34091659"
exon 756..1022
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1023..1103
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1104..1229
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1230..1283
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1284..1310
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1311..1346
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1347..1373
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1374..1436
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1437..1478
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 1462
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229803"
variation 1472
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="g"
/db_xref="dbSNP:3818788"
exon 1479..1523
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1524..1559
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1560..1622
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1623..1667
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1668..1763
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1764..1802
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1803..1847
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 1810
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:34531794"
exon 1848..1874
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 1875..1985
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 1960
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="g"
/db_xref="dbSNP:35791190"
exon 1986..2021
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2022..2132
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2133..2168
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2169..2204
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2205..2249
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2250..2381
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2382..2417
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2418..2525
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2526..2648
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 2598
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="g"
/db_xref="dbSNP:34770879"
variation 2637
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="g"
/db_xref="dbSNP:34976864"
exon 2649..2702
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2703..2744
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2745..2780
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2781..2834
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2835..2903
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2904..2948
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2949..2975
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 2976..3035
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3036..3083
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3084..3137
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 3091
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229804"
exon 3138..3191
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3192..3224
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3225..3341
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3342..3383
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 3381
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:35986497"
exon 3384..3470
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 3442
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228553"
exon 3471..3515
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3516..3560
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3561..3614
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3615..3668
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3669..3722
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
variation 3685
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="g"
/db_xref="dbSNP:34013895"
exon 3723..3767
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3768..3821
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3822..3857
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3858..3920
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3921..3992
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 3993..4046
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4047..4091
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4092..4136
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4137..4190
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4191..4244
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4245..4295
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4296..4385
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4386..4421
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4422..4466
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4467..4655
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4656..4722
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4723..4899
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4900..4977
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
exon 4978..5584
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/inference="alignment:Splign:1.39.8"
STS 5084..5297
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/standard_name="STS-W96115"
/db_xref="UniSTS:25967"
STS 5131..5256
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/standard_name="RH69199"
/db_xref="UniSTS:73013"
variation 5189
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="a"
/replace="c"
/db_xref="dbSNP:1061389"
STS 5198..5428
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/standard_name="STS-M92642"
/db_xref="UniSTS:73133"
STS 5200..5418
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/standard_name="SHGC-35321"
/db_xref="UniSTS:45868"
polyA_signal 5219..5224
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_site 5243
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
variation 5272
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
/replace="g"
/replace="t"
/db_xref="dbSNP:1061392"
polyA_signal 5314..5319
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_site 5331
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_signal 5549..5554
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_signal 5556..5561
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_signal 5563..5568
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
polyA_site 5584
/gene="COL16A1"
/gene_synonym="447AA; FP1572"
ORIGIN
agtctagccgcctctggtgccgctggagccccctctaggccctcctcctcctcctccctggcgggccggtccagctgtgttccattagtgtccctggcaggcccccagccccctggaaccgcctctcttcccccacccggagtggccggcagtccccggcaggcgtgcgccgggcagcagacagccgggagagctcgagcgccaggaagctggggacccgtgaccgtcacggagagatagagaacccctagcggacctgaggaacctgggctctgcttcctccgcctgctgcctggactgctcagtgaggtggggggatccccggccaccggtgctgtggctgtagctgacctctttggaccgggatgtgggtatcctgggctcctggcctgtggctgctcggtctttgggctaccttcggccatggggcaaatacaggtgcacaatgcccaccttcacagcaggaaggactcaaattggaacacagtagtagcctgccagccaacgtgactggcttcaacctcatccaccgactcagcctcatgaagacgtctgccatcaagaagatccgcaaccccaaggggcctctcatcctgcgcctgggggcggcccccgtgacccagcccacgcgaagagtattccctcggggtctcccggaggagtttgccctggtgctgacactactgctgaagaaacacacccaccagaagacgtggtatctgtttcaagtgaccgatgcaaatgggtatccacagatatccctggaagtcaacagccaagagcggagcctggagctcagggcccagggccaggatggcgactttgtgtcctgcatcttcccagtgccccagctcttcgacttgcgttggcacaagctgatgctgagtgtggctggacgtgtggcctctgtgcacgtggactgcagctcagcctcctcccagcctctggggccccgacgacccatgaggcctgtgggccatgtatttctaggcttggatgctgagcagggcaagcctgtctcgtttgaccttcagcaggtgcacatctactgtgacccggagctcgtgctggaggagggctgctgtgagattttaccagcagggtgccccccagagacctccaaggcccgccgggacacccagagcaatgagctcattgagatcaatccacagtctgaaggcaaggtctacacccgctgcttctgcctggaggagcctcaaaacagcgaggtggatgcccagctgacgggaagaatcagccagaaggcagaaaggggagcaaaggtccatcaggagacagcagccgatgagtgtccgccctgtgtccatggtgcccgggacagcaatgtcacacttgctccctctggccccaagggagggaaaggtgagcggggcctgcctggtccaccaggctccaagggagagaagggagcacggggcaatgactgtgttcgaatctccccggatgccccacttcagtgtgcagaaggcccgaagggagagaagggggagtcaggagctctgggaccctcaggactcccaggctcaacaggcgagaagggccagaaaggcgagaagggcgacggaggcatcaagggcgtgccgggaaagccaggccgggacggccggccaggagagatctgtgtcattgggcccaaagggcagaagggagaccctggctttgttgggcctgaggggctggcaggagagcctgggccccccggcctccctggaccccctgggataggactgcctgggaccccgggggatccaggtggcccaccaggccccaagggagacaagggcagctcggggatcccaggaaaggaaggccctggtgggaaacctgggaagccaggtgtgaagggagagaagggtgacccctgtgaagtgtgcccaacactgcctgaagggttccagaactttgttggacttcctggaaagccagggcccaaaggggagcctggtgatcctgtaccagccaggggagaccctggcatccaaggcatcaaaggagagaagggggagccctgcttgtcctgcagctcggttgtaggggcccagcatcttgtgtcctccacaggggccagtggagatgtgggttcccctggctttggtctgcctggccttccgggtagagctggggttccagggctgaaaggagagaagggtaacttcggggaggcagggccagctggcagtccagggccaccaggaccagtggggccagcaggcatcaaaggggcgaagggggagccctgtgagccgtgcccagccctgtccaaccttcaggatggggatgtccgtgtggtggccttgcctggcccatccggagagaagggggaacctgggcctccaggctttggcttgccaggaaaacagggcaaggctggagagcgtggactgaaggggcagaagggtgatgctgggaatcctggagaccctggaacgccgggcaccacagggcggccaggactgtcaggagagcctggagttcagggccccgcggggccaaaaggagaaaagggtgatggctgcactgcctgccccagcctgcaggggacagtgacagacatggcaggacggcctgggcagcccggccccaaaggagagcagggccccgaaggcgtgggccgacctggtaaacccggccaacccggtctaccaggagttcaagggcccccaggactgaagggcgtgcagggagagccagggcctccaggaaggggagtccagggaccccagggggagcctggagccccgggtttgcctggcattcagggacttccgggacctcggggaccacctggccccactggagagaagggtgcccagggatctccaggggtgaaaggagccaccggacctgtgggacctcctggggccagtgtctctgggcctccgggccgtgatgggcagcaaggacagacgggactcagaggaacaccaggtgaaaaaggaccacgaggagagaagggtgagccaggggagtgctcctgcccctctcaaggagacctcatcttctctggcatgccgggtgctccgggactttggatgggcagctcctggcagccgggcccgcagggtccaccaggtattcccggaccaccaggcccccctggagtacctgggctgcagggagtgcctggaaacaacggtttgccaggacagcctgggctcactgcagaactgggatccttaccaattgaacagcacctccttaagagtatctgcggggactgtgtccaggggcagagggcccacccagggtacctcgtggagaagggagagaagggagaccagggcatccctggtgtgccaggcctcgacaactgcgcccagtgctttttgtcactggagcgcccaagagccgaggaggcccggggtgacaacagtgagggagatcctggctgtgttgggagcccaggcctacctggtcctccgggattgccaggccagagaggagaagagggtccgcctggcatgaggggctccccgggtcctccaggccctatcggccccccaggttttcctggtgctgttggctcccccggattgcctggccttcaaggagagcgaggtctcacgggcctgactggagacaagggggagccgggtcctccagggcaaccaggttacccaggtgccacgggccccccaggactgcctggcatcaagggggagcgtggctacaccgggtcagcgggagagaaaggagagccgggccccccaggatctgaaggcctcccaggccccccaggcccagcgggtcccagaggagagcgaggaccccaaggtaactccggtgagaagggcgaccagggatttcaaggccagccaggctttccgggcccaccgggtccccctggattcccaggcaaagttggatcacctggcccacctggccctcaagcagagaagggcagcgaagggattcgaggcccatcaggcctgcctggctcccctgggccaccgggacctcctgggattcagggccccgccggtctggatggtttggatgggaaggacggcaagcctggcttgaggggggaccctggtcctgctggcccccctggactcatgggaccaccgggctttaaggggaaaacaggacatcctggcctcccaggacctaagggtgactgtggcaaaccaggtccccctggcagcactggccggcctggcgcagagggtgaacctggtgccatgggaccccagggaagacccggtcccccgggacacgttgggccaccagggcctccaggccagccaggaccagctgggatctctgcagtgggtctgaaaggagaccgaggagccaccggagaaaggggccttgcaggcctcccaggccagcccggcccccctggacaccctggccccccaggcgaacctggtacggatggtgcagctggcaaagagggaccccctggaaagcagggattctatggacctcctggtcccaagggtgatccaggagctgcaggacagaagggccaggcaggagagaaggggagagccggcatgcctggtggacctggcaagagtggttccatggggcctgttgggccaccgggccctgcaggagagagaggccaccctggagctccggggccttcggggagccctggcttgcctggtgtgcctggctccatgggagacatggtgaattatgatgaaatcaagaggttcatcagacaagagatcattaaaatgtttgatgagagaatggcttactacacctccaggatgcagttccccatggagatggcggcagctccgggacgaccagggcctccagggaaggatggtgctccgggcaggccaggtgctccagggtcacctgggctccctggtcagattggcagagaaggacggcagggcttgccaggagtaagaggattgcctggtaccaaaggtgaaaaaggggacattggtattggcattgcaggagaaaatggtcttcccggccccccaggtcctcaaggtcctccaggctatggcaagatgggtgcaacaggaccaatgggccagcaaggcatccctggcatccctgggcccccgggtcccatgggccagccaggcaaggctggccactgtaatccctctgactgctttggggccatgccgatggagcagcagtacccacccatgaaaaccatgaaggggccttttggctgaaattccccacctgcctttggatgaaagactccgttgggaataaatggccaaagcttataggactctgtgacaggttgtgaatgttttttttgttgttgttgttgtttttaattgctgttaatattttttaaataataaagaaacaaaactatctgccctttcccttccagtgggttcctctggtgctgcagccagagctccctgttgccctccttttcccgtttagtcccaggaacaaaaaagggcattttgggtacaggggcatatacctgtaatcctagctattcaaggggctgaggtgggaggatcgcctgagcccaggagtttgagaccagtctaagcaacataatgagactcagtctccgaaaaataaaaattaaaaaataaagggtatttccctcctt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1307 -> Molecular function: GO:0005178 [integrin binding] evidence: IDA
GeneID:1307 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1307 -> Biological process: GO:0007155 [cell adhesion] evidence: IDA
GeneID:1307 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: TAS
GeneID:1307 -> Biological process: GO:0007565 [female pregnancy] evidence: TAS
GeneID:1307 -> Biological process: GO:0022617 [extracellular matrix disassembly] evidence: TAS
GeneID:1307 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:1307 -> Biological process: GO:0030574 [collagen catabolic process] evidence: TAS
GeneID:1307 -> Biological process: GO:0071230 [cellular response to amino acid stimulus] evidence: IEA
GeneID:1307 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:1307 -> Cellular component: GO:0005597 [collagen type XVI] evidence: TAS
GeneID:1307 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.