Home |
Help |
Advanced search
2024-04-20 08:05:24, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001748 3492 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens calpain 2, (m/II) large subunit (CAPN2), transcript
variant 1, mRNA.
ACCESSION NM_001748
VERSION NM_001748.4 GI:157389004
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3492)
AUTHORS Storr,S.J., Safuan,S., Woolston,C.M., Abdel-Fatah,T., Deen,S.,
Chan,S.Y. and Martin,S.G.
TITLE Calpain-2 expression is associated with response to platinum based
chemotherapy, progression-free and overall survival in ovarian
cancer
JOURNAL J. Cell. Mol. Med. 16 (10), 2422-2428 (2012)
PUBMED 22435971
REMARK GeneRIF: High expression of calpain-2 is significantly associated
with resistance to platinum-based adjuvant chemotherapy.
REFERENCE 2 (bases 1 to 3492)
AUTHORS Storr,S.J., Lee,K.W., Woolston,C.M., Safuan,S., Green,A.R.,
Macmillan,R.D., Benhasouna,A., Parr,T., Ellis,I.O. and Martin,S.G.
TITLE Calpain system protein expression in basal-like and triple-negative
invasive breast cancer
JOURNAL Ann. Oncol. 23 (9), 2289-2296 (2012)
PUBMED 22745213
REMARK GeneRIF: Expression of the large catalytic subunit of calpain-2 is
significantly associated with clinical outcome of patients with
triple-negative and basal-like disease.
REFERENCE 3 (bases 1 to 3492)
AUTHORS Wang,C.F. and Huang,Y.S.
TITLE Calpain 2 activated through N-methyl-D-aspartic acid receptor
signaling cleaves CPEB3 and abrogates CPEB3-repressed translation
in neurons
JOURNAL Mol. Cell. Biol. 32 (16), 3321-3332 (2012)
PUBMED 22711986
REMARK GeneRIF: cleavage of CPEB3 by NMDA-activated calpain 2 accounts for
the activity-related translation of CPEB3-targeted RNAs
REFERENCE 4 (bases 1 to 3492)
AUTHORS Shen,C., Yu,Y., Li,H., Yan,G., Liu,M., Shen,H. and Yang,P.
TITLE Global profiling of proteolytically modified proteins in human
metastatic hepatocellular carcinoma cell lines reveals CAPN2
centered network
JOURNAL Proteomics 12 (12), 1917-1927 (2012)
PUBMED 22623320
REMARK GeneRIF: Two human hepatocellular carcinoma cell lines were
researched using proteomics. A proteolysis network was built up, of
which the CAPN2 centered subnetwork, including SPTBN1, ATP5B, and
VIM, was more active in the highly metastatic HCC cell line.
REFERENCE 5 (bases 1 to 3492)
AUTHORS Ma,J., Cui,W., He,S.M., Duan,Y.H., Heng,L.J., Wang,L. and Gao,G.D.
TITLE Human U87 astrocytoma cell invasion induced by interaction of
betaig-h3 with integrin alpha5beta1 involves calpain-2
JOURNAL PLoS ONE 7 (5), E37297 (2012)
PUBMED 22629380
REMARK GeneRIF: betaig-h3 co-localized with integrin alpha5beta1 to
enhance the invasion of U87 cells, and that calpain-2, is involved
in this process, acting as a downstream molecule.
REFERENCE 6 (bases 1 to 3492)
AUTHORS Adachi,Y., Kitahara-Ozawa,A., Sugamura,K., Lee,W.J., Yodoi,J.,
Maki,M., Murachi,T. and Hatanaka,M.
TITLE Expression of calpain II gene in human hematopoietic system cells
infected with human T-cell leukemia virus type I
JOURNAL J. Biol. Chem. 267 (27), 19373-19378 (1992)
PUBMED 1527057
REFERENCE 7 (bases 1 to 3492)
AUTHORS Ohno,S., Minoshima,S., Kudoh,J., Fukuyama,R., Shimizu,Y.,
Ohmi-Imajoh,S., Shimizu,N. and Suzuki,K.
TITLE Four genes for the calpain family locate on four distinct human
chromosomes
JOURNAL Cytogenet. Cell Genet. 53 (4), 225-229 (1990)
PUBMED 2209092
REFERENCE 8 (bases 1 to 3492)
AUTHORS Hata,A., Ohno,S., Akita,Y. and Suzuki,K.
TITLE Tandemly reiterated negative enhancer-like elements regulate
transcription of a human gene for the large subunit of
calcium-dependent protease
JOURNAL J. Biol. Chem. 264 (11), 6404-6411 (1989)
PUBMED 2539381
REFERENCE 9 (bases 1 to 3492)
AUTHORS Imajoh,S., Aoki,K., Ohno,S., Emori,Y., Kawasaki,H., Sugihara,H. and
Suzuki,K.
TITLE Molecular cloning of the cDNA for the large subunit of the
high-Ca2+-requiring form of human Ca2+-activated neutral protease
JOURNAL Biochemistry 27 (21), 8122-8128 (1988)
PUBMED 2852952
REFERENCE 10 (bases 1 to 3492)
AUTHORS Kopp,S.
TITLE Reproducibility of response to a questionnaire on symptoms of
masticatory dysfunction
JOURNAL Community Dent Oral Epidemiol 4 (5), 205-209 (1976)
PUBMED 1067155
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC011828.2, DA448245.1,
AB209855.1 and AI089162.1.
On Sep 20, 2007 this sequence version replaced gi:12408645.
Summary: The calpains, calcium-activated neutral proteases, are
nonlysosomal, intracellular cysteine proteases. The mammalian
calpains include ubiquitous, stomach-specific, and muscle-specific
proteins. The ubiquitous enzymes consist of heterodimers with
distinct large, catalytic subunits associated with a common small,
regulatory subunit. This gene encodes the large subunit of the
ubiquitous enzyme, calpain 2. Multiple heterogeneous
transcriptional start sites in the 5' UTR have been reported. Two
transcript variants encoding different isoforms have been found for
this gene. [provided by RefSeq, Mar 2009].
Transcript Variant: This variant (1) represents the longer
transcript and encodes the longer isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF261089.1, M23254.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-805 BC011828.2 1-805
806-806 DA448245.1 165-165
807-2042 BC011828.2 807-2042
2043-3313 AB209855.1 1908-3178
3314-3492 AI089162.1 1-179 c
FEATURES Location/Qualifiers
source 1..3492
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q41-q42"
gene 1..3492
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="calpain 2, (m/II) large subunit"
/db_xref="GeneID:824"
/db_xref="HGNC:1479"
/db_xref="MIM:114230"
exon 1..461
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 12
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:2154114"
misc_feature 93..95
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="upstream in-frame stop codon"
variation 134
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:138727686"
variation 212
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:2186007"
variation 214
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:60663921"
CDS 225..2327
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/EC_number="3.4.22.53"
/note="isoform 1 is encoded by transcript variant 1;
calpain, large polypeptide L2; calpain 2, large subunit;
calpain 2, large [catalytic] subunit; calpain-2 catalytic
subunit; calpain M-type; M-calpain; millimolar-calpain;
CANP 2; calpain-2 large subunit; calpain large polypeptide
L2; calcium-activated neutral proteinase 2"
/codon_start=1
/product="calpain-2 catalytic subunit isoform 1"
/protein_id="NP_001739.2"
/db_xref="GI:157389005"
/db_xref="CCDS:CCDS31035.1"
/db_xref="GeneID:824"
/db_xref="HGNC:1479"
/db_xref="MIM:114230"
/translation="
MAGIAAKLAKDREAAEGLGSHERAIKYLNQDYEALRNECLEAGTLFQDPSFPAIPSALGFKELGPYSSKTRGIEWKRPTEICADPQFIIGGATRTDICQGALGDCWLLAAIASLTLNEEILARVVPLNQSFQENYAGIFHFQFWQYGEWVEVVVDDRLPTKDGELLFVHSAEGSEFWSALLEKAYAKINGCYEALSGGATTEGFEDFTGGIAEWYELKKPPPNLFKIIQKALQKGSLLGCSIDITSAADSEAITFQKLVKGHAYSVTGAEEVESNGSLQKLIRIRNPWGEVEWTGRWNDNCPSWNTIDPEERERLTRRHEDGEFWMSFSDFLRHYSRLEICNLTPDTLTSDTYKKWKLTKMDGNWRRGSTAGGCRNYPNTFWMNPQYLIKLEEEDEDEEDGESGCTFLVGLIQKHRRRQRKMGEDMHTIGFGIYEVPEELSGQTNIHLSKNFFLTNRARERSDTFINLREVLNRFKLPPGEYILVPSTFEPNKDGDFCIRVFSEKKADYQAVDDEIEANLEEFDISEDDIDDGFRRLFAQLAGEDAEISAFELQTILRRVLAKRQDIKSDGFSIETCKIMVDMLDSDGSGKLGLKEFYILWTKIQKYQKIYREIDVDRSGTMNSYEMRKALEEAGFKMPCQLHQVIVARFADDQLIIDFDNFVRCLVRLETLFKIFKQLDPENTGTIELDLISWLCFSVL
"
misc_feature 327..1250
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Calpains, domains IIa, IIb; calcium-dependent
cytoplasmic cysteine proteinases, papain-like. Functions
in cytoskeletal remodeling processes, cell
differentiation, apoptosis and signal transduction;
Region: CysPc; cd00044"
/db_xref="CDD:28925"
misc_feature order(537..539,1008..1010,1080..1082)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="catalytic site [active]"
/db_xref="CDD:28925"
misc_feature 1257..1766
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17655.6);
Region: Domain III"
misc_feature 1284..1760
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Calpain, subdomain III. Calpains are
calcium-activated cytoplasmic cysteine proteinases,
participate in cytoskeletal remodeling processes, cell
differentiation, apoptosis and signal transduction.
Catalytic domain and the two calmodulin-like domains
are...; Region: Calpain_III; cd00214"
/db_xref="CDD:29269"
misc_feature order(1398..1406,1437..1439)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="acidic loop; other site"
/db_xref="CDD:29269"
misc_feature 1767..1811
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17655.6);
Region: Linker"
misc_feature 1812..2324
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17655.6);
Region: Domain IV"
misc_feature 1854..2033
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="EF-hand domain pair; Region: EF_hand_6; pfam13833"
/db_xref="CDD:206004"
misc_feature 1953..2117
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="EF-hand, calcium binding motif; A diverse
superfamily of calcium sensors and calcium signal
modulators; most examples in this alignment model have 2
active canonical EF hands. Ca2+ binding induces a
conformational change in the EF-hand motif, leading to...;
Region: EFh; cd00051"
/db_xref="CDD:28933"
misc_feature order(1977..1979,1983..1985,1989..1991,2010..2012,
2067..2069,2073..2075,2079..2081,2100..2102)
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28933"
misc_feature 2034..>2309
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/note="Ca2+-binding protein (EF-Hand superfamily) [Signal
transduction mechanisms / Cytoskeleton / Cell division and
chromosome partitioning / General function prediction
only]; Region: FRQ1; COG5126"
/db_xref="CDD:34727"
variation 240
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:375899944"
variation 269
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:2275879"
variation 290
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:25655"
variation 318
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:369686010"
variation 325
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:139934619"
variation 341
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:149853702"
variation 347
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:149361972"
variation 356
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:28370007"
variation 368
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370008"
variation 393
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:146572729"
variation 415
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:202121109"
variation 426
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:2230083"
variation 444
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:142691066"
variation 461
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:376727805"
exon 462..531
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 471
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146935874"
variation 490
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:200558564"
variation 504
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:144316024"
variation 525
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:371602613"
variation 530
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:17596"
exon 532..650
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 592
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369599821"
variation 596
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372591359"
variation 597
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:375820403"
variation 644
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139777234"
exon 651..784
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 659
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146548007"
variation 663
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:12122278"
variation 665
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:147841921"
variation 672
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:369131658"
variation 695
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:372898901"
variation 704
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:17597"
variation 710
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:377263295"
variation 714
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:141894173"
variation 722
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:17598"
variation 737
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:3738377"
variation 743
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:149399445"
variation 767
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:370792781"
variation 774
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:147235023"
variation 779
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:146165743"
exon 785..953
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 806
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:17600"
variation 836
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139316104"
variation 868
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201961877"
variation 880
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:147824152"
variation 931
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140704789"
exon 954..1037
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 956
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:371937820"
variation 963
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:149026969"
exon 1038..1123
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1071
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:149096348"
variation 1073
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:75929332"
variation 1106
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200144173"
variation 1111
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146546882"
variation 1115
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:138405763"
exon 1124..1198
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1140
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201613674"
variation 1142
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201171878"
variation 1143
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200300250"
variation 1178
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:190784958"
exon 1199..1359
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1217
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201694370"
variation 1229
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370081"
variation 1233
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:142874360"
variation 1234
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:139659399"
variation 1268
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370082"
variation 1275
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:149659079"
variation 1324
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:374476504"
variation 1334
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:377763395"
variation 1336
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:145466296"
variation 1337
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145344369"
variation 1338
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:199728877"
variation 1358
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:141342575"
exon 1360..1529
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1378
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201781579"
variation 1415
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201268064"
variation 1416
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:368366230"
variation 1433
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372088631"
variation 1474
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148370103"
variation 1476
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:375412773"
variation 1493
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:368949645"
variation 1499
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:371353695"
exon 1530..1541
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
exon 1542..1753
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1555
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:376104085"
variation 1595
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:150813013"
variation 1596
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:370722848"
variation 1606
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148169772"
variation 1630
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:143885626"
variation 1634
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:374384888"
variation 1651
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:9804140"
variation 1665
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:148678361"
variation 1666
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:151234089"
variation 1686
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:144006318"
variation 1700
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:201955876"
variation 1723
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:201053061"
variation 1724
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:375605587"
exon 1754..1790
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1761
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369320951"
variation 1780
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:192016088"
variation 1785
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:28370127"
exon 1791..1856
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1803
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145816861"
variation 1813
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:369150450"
variation 1824
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:1130848"
variation 1839
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:372646959"
exon 1857..1914
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1862
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:144506321"
variation 1883
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:202078174"
variation 1884
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:192850510"
variation 1886
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:199718662"
variation 1899
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:199816050"
variation 1901
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:201111260"
exon 1915..1979
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1918
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:201138626"
variation 1926
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:17599"
variation 1934
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:371565778"
variation 1948
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:200417819"
exon 1980..2048
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 1982
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:139113564"
variation 2023
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:192780261"
variation 2039
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:375441224"
exon 2049..2127
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2064
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:150551571"
variation 2067
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:144592508"
variation 2069
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:369952708"
variation 2107
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:148485450"
variation 2113
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372461819"
variation 2122
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:199643396"
variation 2127
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:369104615"
exon 2128..2244
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2160
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:146423555"
variation 2162
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:374729587"
variation 2169
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:143262618"
variation 2187
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:200435825"
variation 2216
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:367730701"
variation 2237
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:145389568"
variation 2239
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:139047155"
exon 2245..2303
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2253
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:2230082"
variation 2267
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:372396856"
variation 2268
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200476814"
variation 2275
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:201100784"
variation 2292
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:200236165"
exon 2304..3488
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/inference="alignment:Splign:1.39.8"
variation 2311
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:76751378"
variation 2317
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:148122411"
variation 2320
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:184347397"
variation 2358
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:372699410"
variation 2399
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:188792767"
STS 2405..2743
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/db_xref="UniSTS:56629"
variation 2428
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:16842201"
variation 2515
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:28370175"
variation 2517
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:187383102"
variation 2532
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:369415939"
variation 2566
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:28370176"
variation 2585
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:28370177"
variation 2601
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:375053676"
variation 2687
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:28370178"
variation 2690
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370179"
variation 2697
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:10961"
variation 2711
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:12043790"
variation 2748..2749
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="tt"
/db_xref="dbSNP:373808822"
variation 2809
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:28370180"
variation 2903
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:189292302"
variation 2976
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="c"
/db_xref="dbSNP:3835626"
variation 3018
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="g"
/db_xref="dbSNP:1803242"
STS 3021..3122
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/standard_name="D1S3584"
/db_xref="UniSTS:5231"
STS 3024..3175
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/standard_name="SHGC-76403"
/db_xref="UniSTS:42019"
variation 3035
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:13341"
variation 3058
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="g"
/db_xref="dbSNP:180963689"
variation 3066
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="c"
/db_xref="dbSNP:1063453"
variation 3075
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="g"
/replace="t"
/db_xref="dbSNP:185195602"
variation 3101
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:190247452"
variation 3179
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370182"
variation 3211
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:28370183"
variation 3236
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="c"
/replace="t"
/db_xref="dbSNP:7331"
variation 3297
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace="a"
/replace="t"
/db_xref="dbSNP:3820472"
variation 3353..3354
/gene="CAPN2"
/gene_synonym="CANP2; CANPL2; CANPml; mCANP"
/replace=""
/replace="g"
/db_xref="dbSNP:35076255"
ORIGIN
caggccgcaggatggcctggtcccgggccgggagcccagcaggccgggagcggctgaggccacaccccgcgggccgggccgcttccctccggtgaatcatcgctcgcagcggcggcgcccgcagtggccgcagcagcgcgccgggccctggccgcgccccagccgagcgcagcgcggagtcgccccgacctttctctgcgcagtacggccgccgggaccgcagcatggcgggcatcgcggccaagctggcgaaggaccgggaggcggccgaggggctgggctcccacgagagggccatcaagtacctcaaccaggactacgaggcgctgcggaacgagtgcctggaggccgggacgctcttccaggacccgtccttcccggccatcccctcggccctgggcttcaaggagttggggccctactccagcaaaacccggggcatcgagtggaagcgccccacggagatctgcgctgacccccagtttatcattggaggagccacccgcacagacatctgccaaggagccctgggtgactgctggctgctggcagccattgcctccctcaccttgaatgaagaaatcctggctcgagtcgtccccctaaaccagagcttccaggaaaactatgcagggatctttcacttccagttctggcaatacggcgagtgggtggaggtggtggtggatgacaggctgcccaccaaggacggggagctgctctttgtgcattcagccgaagggagcgagttctggagcgccctgctggagaaggcatacgccaagatcaacggatgctatgaagcgctatcagggggtgccaccactgagggcttcgaagacttcaccggaggcattgctgagtggtatgagttgaagaagccccctcccaacctgttcaagatcatccagaaagctctgcaaaaaggctctctccttggctgctccatcgacatcaccagcgccgcggactcggaggccatcacgtttcagaagctggtgaaggggcacgcgtactcggtcaccggagccgaggaggttgaaagtaacggaagcctacagaaactgatccgcatccgaaatccctggggagaagtggagtggacagggcggtggaatgacaactgcccaagctggaacactatagacccagaggagagggaaaggctgaccagacggcatgaagatggagaattctggatgtctttcagtgacttcctgaggcactattcccgcctggagatctgtaacctgaccccagacactctcaccagcgatacctacaagaagtggaaactcaccaaaatggatgggaactggaggcggggctccaccgcgggaggttgcaggaactacccgaacacattctggatgaaccctcagtacctgatcaagctggaggaggaggatgaggacgaggaggatggggagagcggctgcaccttcctggtggggctcattcagaagcaccgacggcggcagaggaagatgggcgaggacatgcacaccatcggctttggcatctatgaggttccagaggagttaagtgggcagaccaacatccacctcagcaaaaacttcttcctgacgaatcgcgccagggagcgctcagacaccttcatcaacctccgggaggtgctcaaccgcttcaagctgccgccaggagagtacattctcgtgccttccaccttcgaacccaacaaggatggggatttctgcatccgggtcttttctgaaaagaaagctgactaccaagctgtcgatgatgaaatcgaggccaatcttgaagagttcgacatcagcgaggatgacattgatgatggattcaggagactgtttgcccagttggcaggagaggatgcggagatctctgcctttgagctgcagaccatcctgagaagggttctagcaaagcgccaagatatcaagtcagatggcttcagcatcgagacatgcaaaattatggttgacatgctagattcggacgggagtggcaagctggggctgaaggagttctacattctctggacgaagattcaaaaataccaaaaaatttaccgagaaatcgacgttgacaggtctggtaccatgaattcctatgaaatgcggaaggcattagaagaagcaggtttcaagatgccctgtcaactccaccaagtcatcgttgctcggtttgcagatgaccagctcatcatcgattttgataattttgttcggtgtttggttcggctggaaacgctattcaagatatttaagcagctggatcccgagaatactggaacaatagagctcgaccttatctcttggctctgtttctcagtactttgaagttataactaatctgcctgaagacttctcatgatggaaaatcagccaaggactaagcttccatagaaatacactttgtatctggacctcaaaattatgggaacatttacttaaacggatgatcatagctgaaaataatgatactgtcaatttgagatagcagaagtttcacacatcaaagtaaaagatttgcatatcattatactaaatgcaaatgagtcgcttaacccttgacaaggtcaaagaaagctttaaatctgtaaatagtatacactttttacttttacacactttcctgttcatagcaatattaaatcaggaaaaaaaaatgcagggaggtatttaacagctgagcaaaaacattgagtcgctctcaaaggacacgaggcccttggcagggaatatttaaagcaacttcaagtttaaaatgcagctgttgattctaccaaacaacagtccaagattaccatttcccatgagccaactgggaaacatggtatatcatgaagtaatcttgtcaaggcatctggagagtccaggagagaagactcacctctgtcgcttgggttaaacaagagacaggttttgtagaatattgattggtaatagtaaatcgttctccttacaatcaagttcttgaccctattcggccttatacatctggtcttacaaagaccaaagggatcctgcgcttgatcaactgaaccagtatgccaaaaccaggcatccaatttgtaaaccaattatgataaaggacaaaataagctgtttgccacctcaaaactttatgaacttcaccaccactagtgtctgtccatggagttagaggggacatcacttagaagttcttatagaaaggacacaagtttgtttcctggctttaccttgggaaaatgctagcaacattatagaaattttgccttgttgccttatcttcttccaaatgtactgttaaataaaaataaagggttaccccatgcaatcacaccatgccatgttttccttcctggagggcagccccacaggacggtttatgagcacacaattatagcttgtttctactttaacaaggtatgctgcctctgtaaattcatgtattcaaaggaaaagacaccttgcctataattaaaatgtggaactataaaattttttaaaatccaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:824 -> Molecular function: GO:0004198 [calcium-dependent cysteine-type endopeptidase activity] evidence: IEA
GeneID:824 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:824 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:824 -> Molecular function: GO:0008092 [cytoskeletal protein binding] evidence: IEA
GeneID:824 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: TAS
GeneID:824 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IEA
GeneID:824 -> Biological process: GO:0001666 [response to hypoxia] evidence: IEA
GeneID:824 -> Biological process: GO:0001824 [blastocyst development] evidence: IEA
GeneID:824 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:824 -> Biological process: GO:0007520 [myoblast fusion] evidence: IEA
GeneID:824 -> Biological process: GO:0016540 [protein autoprocessing] evidence: IEA
GeneID:824 -> Cellular component: GO:0000785 [chromatin] evidence: IEA
GeneID:824 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:824 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:824 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001739 -> EC 3.4.22.53
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.