GGRNA Home | Help | Advanced search

2019-03-25 15:16:11, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001700                912 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens azurocidin 1 (AZU1), mRNA.
ACCESSION   NM_001700
VERSION     NM_001700.3  GI:28416954
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 912)
  AUTHORS   Daigo,K., Yamaguchi,N., Kawamura,T., Matsubara,K., Jiang,S.,
            Ohashi,R., Sudou,Y., Kodama,T., Naito,M., Inoue,K. and Hamakubo,T.
  TITLE     The proteomic profile of circulating pentraxin 3 (PTX3) complex in
            sepsis demonstrates the interaction with azurocidin 1 and other
            components of neutrophil extracellular traps
  JOURNAL   Mol. Cell Proteomics 11 (6), M111 (2012)
   PUBMED   22278372
  REMARK    GeneRIF: AZU1 exhibited high affinity binding to PTX3 in a calcium
            ion-dependent manner
REFERENCE   2  (bases 1 to 912)
  AUTHORS   Chew,M.S., Linder,A., Santen,S., Ersson,A., Herwald,H. and
            Thorlacius,H.
  TITLE     Increased plasma levels of heparin-binding protein in patients with
            shock: a prospective, cohort study
  JOURNAL   Inflamm. Res. 61 (4), 375-379 (2012)
   PUBMED   22207392
  REMARK    GeneRIF: Heparin-binding protein is elevated in patients with shock
            from septic and non-septic etiologies.
REFERENCE   3  (bases 1 to 912)
  AUTHORS   Schou,M., Djurup,R., Norris,K. and Flodgaard,H.
  TITLE     Identifying the functional part of heparin-binding protein (HBP) as
            a monocyte stimulator and the novel role of monocytes as HBP
            producers
  JOURNAL   Innate Immun 17 (1), 60-69 (2011)
   PUBMED   20083497
  REMARK    GeneRIF: The TAASC motif in a cyclizised 20-44 amino acid peptide
            is part of the ligand in HBP responsible for activation of the HBP
            receptor on monocytes. Monocytes release HBP constitutively in
            small amounts and more so in the presence of lipopolysaccharide.
REFERENCE   4  (bases 1 to 912)
  AUTHORS   Changho,S. and Ahmed,A.A.
  TITLE     Neutrophils in biliary atresia. A study on their morphologic
            distribution and expression of CAP37
  JOURNAL   Pathol. Res. Pract. 206 (5), 314-317 (2010)
   PUBMED   20399025
  REMARK    GeneRIF: Proliferating bile ductules may play a role in the
            inflammatory response in biliary atresia through expression of
            CAP37.
REFERENCE   5  (bases 1 to 912)
  AUTHORS   Linder,A., Johansson,L., Thulin,P., Hertzen,E., Morgelin,M.,
            Christensson,B., Bjorck,L., Norrby-Teglund,A. and Akesson,P.
  TITLE     Erysipelas caused by group A streptococcus activates the contact
            system and induces the release of heparin-binding protein
  JOURNAL   J. Invest. Dermatol. 130 (5), 1365-1372 (2010)
   PUBMED   20107486
  REMARK    GeneRIF: group A streptococci induce contact activation and HBP
            release during skin infection, which likely contribute to the
            symptoms seen in erysipelas: fever, pain, erythema, and edema
REFERENCE   6  (bases 1 to 912)
  AUTHORS   Zimmer,M., Medcalf,R.L., Fink,T.M., Mattmann,C., Lichter,P. and
            Jenne,D.E.
  TITLE     Three human elastase-like genes coordinately expressed in the
            myelomonocyte lineage are organized as a single genetic locus on
            19pter
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (17), 8215-8219 (1992)
   PUBMED   1518849
REFERENCE   7  (bases 1 to 912)
  AUTHORS   Morgan,J.G., Sukiennicki,T., Pereira,H.A., Spitznagel,J.K.,
            Guerra,M.E. and Larrick,J.W.
  TITLE     Cloning of the cDNA for the serine protease homolog
            CAP37/azurocidin, a microbicidal and chemotactic protein from human
            granulocytes
  JOURNAL   J. Immunol. 147 (9), 3210-3214 (1991)
   PUBMED   1919011
REFERENCE   8  (bases 1 to 912)
  AUTHORS   Almeida,R.P., Melchior,M., Campanelli,D., Nathan,C. and Gabay,J.E.
  TITLE     Complementary DNA sequence of human neutrophil azurocidin, an
            antibiotic with extensive homology to serine proteases
  JOURNAL   Biochem. Biophys. Res. Commun. 177 (2), 688-695 (1991)
   PUBMED   2049091
REFERENCE   9  (bases 1 to 912)
  AUTHORS   Green,B.G., Weston,H., Ashe,B.M., Doherty,J., Finke,P., Hagmann,W.,
            Lark,M., Mao,J., Maycock,A., Moore,V. et al.
  TITLE     PMN elastases: a comparison of the specificity of human isozymes
            and the enzyme from other species toward substrates and inhibitors
  JOURNAL   Arch. Biochem. Biophys. 286 (1), 284-292 (1991)
   PUBMED   1897955
REFERENCE   10 (bases 1 to 912)
  AUTHORS   Pohl,J., Pereira,H.A., Martin,N.M. and Spitznagel,J.K.
  TITLE     Amino acid sequence of CAP37, a human neutrophil granule-derived
            antibacterial and monocyte-specific chemotactic glycoprotein
            structurally similar to neutrophil elastase
  JOURNAL   FEBS Lett. 272 (1-2), 200-204 (1990)
   PUBMED   2226832
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from M96326.1.
            On Feb 19, 2003 this sequence version replaced gi:27881413.
            
            Summary: Azurophil granules, specialized lysosomes of the
            neutrophil, contain at least 10 proteins implicated in the killing
            of microorganisms. The protein encoded by this gene is an azurophil
            granule antibiotic protein, with monocyte chemotactic and
            antibacterial activity. It is also an important multifunctional
            inflammatory mediator. This encoded protein is a member of the
            serine protease gene family but it is not a serine proteinase,
            because the active site serine and histidine residues are replaced.
            The genes encoding this protein, neutrophil elastase 2, and
            proteinase 3 are in a cluster located at chromosome 19pter. All 3
            genes are expressed coordinately and their protein products are
            packaged together into azurophil granules during neutrophil
            differentiation. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X58794.1, BC093931.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025093 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..912
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.3"
     gene            1..912
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="azurocidin 1"
                     /db_xref="GeneID:566"
                     /db_xref="HGNC:913"
                     /db_xref="HPRD:01221"
                     /db_xref="MIM:162815"
     STS             1..822
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /db_xref="UniSTS:480558"
     exon            1..74
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /inference="alignment:Splign:1.39.8"
     CDS             17..772
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="cationic antimicrobial protein 37; heparin-binding
                     protein; neutrophil azurocidin; cationic antimicrobial
                     protein CAP37"
                     /codon_start=1
                     /product="azurocidin preproprotein"
                     /protein_id="NP_001691.1"
                     /db_xref="GI:11342670"
                     /db_xref="CCDS:CCDS12044.1"
                     /db_xref="GeneID:566"
                     /db_xref="HGNC:913"
                     /db_xref="HPRD:01221"
                     /db_xref="MIM:162815"
                     /translation="
MTRLTVLALLAGLLASSRAGSSPLLDIVGGRKARPRQFPFLASIQNQGRHFCGGALIHARFVMTAASCFQSQNPGVSTVVLGAYDLRRRERQSRQTFSISSMSENGYDPQQNLNDLMLLQLDREANLTSSVTILPLPLQNATVEAGTRCQVAGWGSQRSGGRLSRFPRFVNVTVTPEDQCRPNNVCTGVLTRRGGICNGDGGTPLVCEGLAHGVASFSLGPCGRGPDFFTRVALFRDWIDGVLNNPGPGPA
"
     sig_peptide     17..94
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
     proprotein      95..769
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /product="azurocidin proprotein"
     mat_peptide     95..760
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /product="azurocidin"
     misc_feature    95..736
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="Trypsin-like serine protease; Many of these are
                     synthesized as inactive precursor zymogens that are
                     cleaved during limited proteolysis to generate their
                     active forms. Alignment contains also inactive enzymes
                     that have substitutions of the catalytic triad...; Region:
                     Tryp_SPc; cd00190"
                     /db_xref="CDD:29152"
     misc_feature    95..97
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="cleavage site"
                     /db_xref="CDD:29152"
     misc_feature    152..226
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P20160.3);
                     Region: Possesses antibiotic activity"
     misc_feature    170..268
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P20160.3);
                     Region: Hydrophobic"
     misc_feature    order(215..217,359..361,617..619)
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="active site"
                     /db_xref="CDD:29152"
     misc_feature    order(599..601,662..664,668..670)
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="substrate binding sites [chemical binding]; other
                     site"
                     /db_xref="CDD:29152"
     variation       61
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34124897"
     variation       67
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146182220"
     variation       71
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139128406"
     variation       73
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375208692"
     variation       74
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201600404"
     exon            75..231
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /inference="alignment:Splign:1.39.8"
     variation       75
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200732632"
     variation       82
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:36002066"
     variation       91
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112635330"
     misc_feature    95..772
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /note="Region: azurocidin 1 proprotein"
     variation       103
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184057116"
     variation       108
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144130932"
     variation       114
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376406973"
     variation       163
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370446425"
     variation       177
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113510125"
     variation       216
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377499337"
     exon            232..376
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /inference="alignment:Splign:1.39.8"
     variation       238
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12460890"
     variation       278
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202068638"
     variation       281
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370082761"
     variation       282
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148652041"
     variation       296
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374411584"
     variation       304
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201771664"
     variation       320
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377346707"
     variation       334
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57230903"
     variation       338
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142169722"
     exon            377..610
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /inference="alignment:Splign:1.39.8"
     variation       393
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151205721"
     variation       407
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376150747"
     variation       411
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140987452"
     variation       412
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368212768"
     variation       422
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372031493"
     variation       436
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376674305"
     variation       437
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28664760"
     variation       441
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147872987"
     variation       442
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141563771"
     variation       443
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78165561"
     variation       474
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371000929"
     variation       488
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368496402"
     variation       489
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28626600"
     variation       498
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732997"
     variation       501
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149180756"
     variation       510
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732996"
     variation       523
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:595844"
     variation       526
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376967352"
     variation       529
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141614223"
     variation       530
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145363133"
     variation       544
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201821197"
     variation       557
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201652896"
     variation       577
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372443381"
     variation       578
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371203310"
     variation       594
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138374662"
     variation       601
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137867622"
     exon            611..912
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /inference="alignment:Splign:1.39.8"
     variation       632
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201462708"
     variation       655
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150578187"
     variation       668
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139615484"
     variation       671
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149335820"
     variation       676
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186978911"
     variation       695
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144535481"
     variation       705
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200419489"
     variation       706
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:588442"
     variation       711
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:372854624"
     variation       720
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144687782"
     variation       722
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112572343"
     variation       753
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370044905"
     variation       754
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200997500"
     variation       761
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147909830"
     variation       778
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350539"
     STS             780..904
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /standard_name="STS-M96326"
                     /db_xref="UniSTS:75203"
     variation       806
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376815060"
     variation       812
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371079321"
     variation       856..857
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:368866282"
     variation       866
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148173821"
     polyA_signal    888..893
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
     polyA_site      912
                     /gene="AZU1"
                     /gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
acagacctgccccgccatgacccggctgacagtcctggccctgctggctggtctgctggcgtcctcgagggccggctccagcccccttttggacatcgttggcggccggaaggcgaggccccgccagttcccgttcctggcctccattcagaatcaaggcaggcacttctgcgggggtgccctgatccatgcccgcttcgtgatgaccgcggccagctgcttccaaagccagaaccccggggttagcaccgtggtgctgggtgcctatgacctgaggcggcgggagaggcagtcccgccagacgttttccatcagcagcatgagcgagaatggctacgacccccagcagaacctgaacgacctgatgctgcttcagctggaccgtgaggccaacctcaccagcagcgtgacgatactgccactgcctctgcagaacgccacggtggaagccggcaccagatgccaggtggccggctgggggagccagcgcagtggggggcgtctctcccgttttcccaggtttgtcaacgtgactgtgacccccgaggaccagtgtcgccccaacaacgtgtgcaccggtgtgctcacccgccgcggtggcatctgcaatggggacgggggcacccccctcgtctgcgagggcctggcccacggcgtggcctccttttccctggggccctgtggccgaggccctgacttcttcacccgagtggcgctcttccgagactggatcgatggtgttctcaacaacccgggaccggggccagcctaggggggcctgtgacctcccatggagcccagccccgccctccacacctccggcgctccgcacccacctcccacggccccgcccctgcccccgctccggccagaggggccctggctgtaataaagaagccgatctctcctctg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:566 -> Molecular function: GO:0004252 [serine-type endopeptidase activity] evidence: IEA
            GeneID:566 -> Molecular function: GO:0008201 [heparin binding] evidence: NAS
            GeneID:566 -> Molecular function: GO:0015643 [toxic substance binding] evidence: NAS
            GeneID:566 -> Biological process: GO:0001774 [microglial cell activation] evidence: IEP
            GeneID:566 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
            GeneID:566 -> Biological process: GO:0006954 [inflammatory response] evidence: NAS
            GeneID:566 -> Biological process: GO:0007205 [protein kinase C-activating G-protein coupled receptor signaling pathway] evidence: TAS
            GeneID:566 -> Biological process: GO:0008347 [glial cell migration] evidence: IDA
            GeneID:566 -> Biological process: GO:0042117 [monocyte activation] evidence: TAS
            GeneID:566 -> Biological process: GO:0042535 [positive regulation of tumor necrosis factor biosynthetic process] evidence: IDA
            GeneID:566 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: NAS
            GeneID:566 -> Biological process: GO:0043114 [regulation of vascular permeability] evidence: NAS
            GeneID:566 -> Biological process: GO:0045123 [cellular extravasation] evidence: NAS
            GeneID:566 -> Biological process: GO:0045348 [positive regulation of MHC class II biosynthetic process] evidence: IEP
            GeneID:566 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IDA
            GeneID:566 -> Biological process: GO:0048246 [macrophage chemotaxis] evidence: NAS
            GeneID:566 -> Biological process: GO:0050725 [positive regulation of interleukin-1 beta biosynthetic process] evidence: IDA
            GeneID:566 -> Biological process: GO:0050754 [positive regulation of fractalkine biosynthetic process] evidence: IDA
            GeneID:566 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IDA
            GeneID:566 -> Biological process: GO:0050829 [defense response to Gram-negative bacterium] evidence: TAS
            GeneID:566 -> Biological process: GO:0050930 [induction of positive chemotaxis] evidence: NAS
            GeneID:566 -> Cellular component: GO:0005576 [extracellular region] evidence: NAS
            GeneID:566 -> Cellular component: GO:0042582 [azurophil granule] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.