GGRNA Home | Help | Advanced search

2024-04-27 04:21:05, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001649               7445 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens shroom family member 2 (SHROOM2), mRNA.
ACCESSION   NM_001649
VERSION     NM_001649.2  GI:18375508
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7445)
  AUTHORS   Dunlop,M.G., Dobbins,S.E., Farrington,S.M., Jones,A.M., Palles,C.,
            Whiffin,N., Tenesa,A., Spain,S., Broderick,P., Ooi,L.Y.,
            Domingo,E., Smillie,C., Henrion,M., Frampton,M., Martin,L.,
            Grimes,G., Gorman,M., Semple,C., Ma,Y.P., Barclay,E.,
            Prendergast,J., Cazier,J.B., Olver,B., Penegar,S., Lubbe,S.,
            Chander,I., Carvajal-Carmona,L.G., Ballereau,S., Lloyd,A.,
            Vijayakrishnan,J., Zgaga,L., Rudan,I., Theodoratou,E., Starr,J.M.,
            Deary,I., Kirac,I., Kovacevic,D., Aaltonen,L.A.,
            Renkonen-Sinisalo,L., Mecklin,J.P., Matsuda,K., Nakamura,Y.,
            Okada,Y., Gallinger,S., Duggan,D.J., Conti,D., Newcomb,P.,
            Hopper,J., Jenkins,M.A., Schumacher,F., Casey,G., Easton,D.,
            Shah,M., Pharoah,P., Lindblom,A., Liu,T., Smith,C.G., West,H.,
            Cheadle,J.P., Midgley,R., Kerr,D.J., Campbell,H., Tomlinson,I.P.
            and Houlston,R.S.
  CONSRTM   Colorectal Tumour Gene Identification (CORGI) Consortium; Swedish
            Low-Risk Colorectal Cancer Study Group; COIN Collaborative Group
  TITLE     Common variation near CDKN1A, POLD3 and SHROOM2 influences
            colorectal cancer risk
  JOURNAL   Nat. Genet. 44 (7), 770-776 (2012)
   PUBMED   22634755
  REMARK    GeneRIF: We identified three new CRC risk loci at 6p21 (rs1321311,
            near CDKN1A; P = 1.14 x 10(-10)), 11q13.4 (rs3824999, intronic to
            POLD3; P = 3.65 x 10(-10)) and Xp22.2 (rs5934683, near SHROOM2; P =
            7.30 x 10(-10)).
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 7445)
  AUTHORS   Farber,M.J., Rizaldy,R. and Hildebrand,J.D.
  TITLE     Shroom2 regulates contractility to control endothelial
            morphogenesis
  JOURNAL   Mol. Biol. Cell 22 (6), 795-805 (2011)
   PUBMED   21248203
  REMARK    GeneRIF: Data suggest that Shroom2 facilitates the formation of a
            contractile network within endothelial cells, the loss of which
            leads to an increase in endothelial sprouting, migration, and
            angiogenesis.
REFERENCE   3  (bases 1 to 7445)
  AUTHORS   Wu,C., Ma,M.H., Brown,K.R., Geisler,M., Li,L., Tzeng,E., Jia,C.Y.,
            Jurisica,I. and Li,S.S.
  TITLE     Systematic identification of SH3 domain-mediated human
            protein-protein interactions by peptide array target screening
  JOURNAL   Proteomics 7 (11), 1775-1785 (2007)
   PUBMED   17474147
REFERENCE   4  (bases 1 to 7445)
  AUTHORS   Dietz,M.L., Bernaciak,T.M., Vendetti,F., Kielec,J.M. and
            Hildebrand,J.D.
  TITLE     Differential actin-dependent localization modulates the
            evolutionarily conserved activity of Shroom family proteins
  JOURNAL   J. Biol. Chem. 281 (29), 20542-20554 (2006)
   PUBMED   16684770
REFERENCE   5  (bases 1 to 7445)
  AUTHORS   Hagens,O., Ballabio,A., Kalscheuer,V., Kraehenbuhl,J.P.,
            Schiaffino,M.V., Smith,P., Staub,O., Hildebrand,J. and
            Wallingford,J.B.
  TITLE     A new standard nomenclature for proteins related to Apx and Shroom
  JOURNAL   BMC Cell Biol. 7, 18 (2006)
   PUBMED   16615870
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 7445)
  AUTHORS   Ross,M.T., Grafham,D.V., Coffey,A.J., Scherer,S., McLay,K.,
            Muzny,D., Platzer,M., Howell,G.R., Burrows,C., Bird,C.P.,
            Frankish,A., Lovell,F.L., Howe,K.L., Ashurst,J.L., Fulton,R.S.,
            Sudbrak,R., Wen,G., Jones,M.C., Hurles,M.E., Andrews,T.D.,
            Scott,C.E., Searle,S., Ramser,J., Whittaker,A., Deadman,R.,
            Carter,N.P., Hunt,S.E., Chen,R., Cree,A., Gunaratne,P., Havlak,P.,
            Hodgson,A., Metzker,M.L., Richards,S., Scott,G., Steffen,D.,
            Sodergren,E., Wheeler,D.A., Worley,K.C., Ainscough,R.,
            Ambrose,K.D., Ansari-Lari,M.A., Aradhya,S., Ashwell,R.I.,
            Babbage,A.K., Bagguley,C.L., Ballabio,A., Banerjee,R., Barker,G.E.,
            Barlow,K.F., Barrett,I.P., Bates,K.N., Beare,D.M., Beasley,H.,
            Beasley,O., Beck,A., Bethel,G., Blechschmidt,K., Brady,N.,
            Bray-Allen,S., Bridgeman,A.M., Brown,A.J., Brown,M.J., Bonnin,D.,
            Bruford,E.A., Buhay,C., Burch,P., Burford,D., Burgess,J.,
            Burrill,W., Burton,J., Bye,J.M., Carder,C., Carrel,L., Chako,J.,
            Chapman,J.C., Chavez,D., Chen,E., Chen,G., Chen,Y., Chen,Z.,
            Chinault,C., Ciccodicola,A., Clark,S.Y., Clarke,G., Clee,C.M.,
            Clegg,S., Clerc-Blankenburg,K., Clifford,K., Cobley,V., Cole,C.G.,
            Conquer,J.S., Corby,N., Connor,R.E., David,R., Davies,J., Davis,C.,
            Davis,J., Delgado,O., Deshazo,D., Dhami,P., Ding,Y., Dinh,H.,
            Dodsworth,S., Draper,H., Dugan-Rocha,S., Dunham,A., Dunn,M.,
            Durbin,K.J., Dutta,I., Eades,T., Ellwood,M., Emery-Cohen,A.,
            Errington,H., Evans,K.L., Faulkner,L., Francis,F., Frankland,J.,
            Fraser,A.E., Galgoczy,P., Gilbert,J., Gill,R., Glockner,G.,
            Gregory,S.G., Gribble,S., Griffiths,C., Grocock,R., Gu,Y.,
            Gwilliam,R., Hamilton,C., Hart,E.A., Hawes,A., Heath,P.D.,
            Heitmann,K., Hennig,S., Hernandez,J., Hinzmann,B., Ho,S., Hoffs,M.,
            Howden,P.J., Huckle,E.J., Hume,J., Hunt,P.J., Hunt,A.R.,
            Isherwood,J., Jacob,L., Johnson,D., Jones,S., de Jong,P.J.,
            Joseph,S.S., Keenan,S., Kelly,S., Kershaw,J.K., Khan,Z.,
            Kioschis,P., Klages,S., Knights,A.J., Kosiura,A., Kovar-Smith,C.,
            Laird,G.K., Langford,C., Lawlor,S., Leversha,M., Lewis,L., Liu,W.,
            Lloyd,C., Lloyd,D.M., Loulseged,H., Loveland,J.E., Lovell,J.D.,
            Lozado,R., Lu,J., Lyne,R., Ma,J., Maheshwari,M., Matthews,L.H.,
            McDowall,J., McLaren,S., McMurray,A., Meidl,P., Meitinger,T.,
            Milne,S., Miner,G., Mistry,S.L., Morgan,M., Morris,S., Muller,I.,
            Mullikin,J.C., Nguyen,N., Nordsiek,G., Nyakatura,G., O'Dell,C.N.,
            Okwuonu,G., Palmer,S., Pandian,R., Parker,D., Parrish,J.,
            Pasternak,S., Patel,D., Pearce,A.V., Pearson,D.M., Pelan,S.E.,
            Perez,L., Porter,K.M., Ramsey,Y., Reichwald,K., Rhodes,S.,
            Ridler,K.A., Schlessinger,D., Schueler,M.G., Sehra,H.K.,
            Shaw-Smith,C., Shen,H., Sheridan,E.M., Shownkeen,R., Skuce,C.D.,
            Smith,M.L., Sotheran,E.C., Steingruber,H.E., Steward,C.A.,
            Storey,R., Swann,R.M., Swarbreck,D., Tabor,P.E., Taudien,S.,
            Taylor,T., Teague,B., Thomas,K., Thorpe,A., Timms,K., Tracey,A.,
            Trevanion,S., Tromans,A.C., d'Urso,M., Verduzco,D., Villasana,D.,
            Waldron,L., Wall,M., Wang,Q., Warren,J., Warry,G.L., Wei,X.,
            West,A., Whitehead,S.L., Whiteley,M.N., Wilkinson,J.E.,
            Willey,D.L., Williams,G., Williams,L., Williamson,A.,
            Williamson,H., Wilming,L., Woodmansey,R.L., Wray,P.W., Yen,J.,
            Zhang,J., Zhou,J., Zoghbi,H., Zorilla,S., Buck,D., Reinhardt,R.,
            Poustka,A., Rosenthal,A., Lehrach,H., Meindl,A., Minx,P.J.,
            Hillier,L.W., Willard,H.F., Wilson,R.K., Waterston,R.H., Rice,C.M.,
            Vaudin,M., Coulson,A., Nelson,D.L., Weinstock,G., Sulston,J.E.,
            Durbin,R., Hubbard,T., Gibbs,R.A., Beck,S., Rogers,J. and
            Bentley,D.R.
  TITLE     The DNA sequence of the human X chromosome
  JOURNAL   Nature 434 (7031), 325-337 (2005)
   PUBMED   15772651
REFERENCE   7  (bases 1 to 7445)
  AUTHORS   Jin,J., Smith,F.D., Stark,C., Wells,C.D., Fawcett,J.P.,
            Kulkarni,S., Metalnikov,P., O'Donnell,P., Taylor,P., Taylor,L.,
            Zougman,A., Woodgett,J.R., Langeberg,L.K., Scott,J.D. and Pawson,T.
  TITLE     Proteomic, functional, and domain-based analysis of in vivo 14-3-3
            binding proteins involved in cytoskeletal regulation and cellular
            organization
  JOURNAL   Curr. Biol. 14 (16), 1436-1450 (2004)
   PUBMED   15324660
REFERENCE   8  (bases 1 to 7445)
  AUTHORS   Schiaffino,M.V., Bassi,M.T., Rugarli,E.I., Renieri,A., Galli,L. and
            Ballabio,A.
  TITLE     Cloning of a human homologue of the Xenopus laevis APX gene from
            the ocular albinism type 1 critical region
  JOURNAL   Hum. Mol. Genet. 4 (3), 373-382 (1995)
   PUBMED   7795590
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from X83543.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jan 25, 2002 this sequence version replaced gi:4502174.
            
            Summary: The protein encoded by this gene shares significant
            similarities with the apical protein from Xenopus laevis which is
            implicated in amiloride-sensitive sodium channel activity. This
            gene is a strong candidate gene for ocular albinism type 1
            syndrome. [provided by RefSeq, Jul 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: X83543.1, BC140866.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025086 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..7445
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp22.3"
     gene            1..7445
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="shroom family member 2"
                     /db_xref="GeneID:357"
                     /db_xref="HGNC:630"
                     /db_xref="HPRD:02113"
                     /db_xref="MIM:300103"
     exon            1..255
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     CDS             91..4941
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="APX homolog of Xenopus; apical-like protein"
                     /codon_start=1
                     /product="protein Shroom2"
                     /protein_id="NP_001640.1"
                     /db_xref="GI:4502175"
                     /db_xref="CCDS:CCDS14135.1"
                     /db_xref="GeneID:357"
                     /db_xref="HGNC:630"
                     /db_xref="HPRD:02113"
                     /db_xref="MIM:300103"
                     /translation="
MEGAEPRARPERLAEAETRAADGGRLVEVQLSGGAPWGFTLKGGREHGEPLVITKIEEGSKAAAVDKLLAGDEIVGINDIGLSGFRQEAICLVKGSHKTLKLVVKRRSELGWRPHSWHATKFSDSHPELAASPFTSTSGCPSWSGRHHASSSSHDLSSSWEQTNLQRTLDHFSSLGSVDSLDHPSSRLSVAKSNSSIDHLGSHSKRDSAYGSFSTSSSTPDHTLSKADTSSAENILYTVGLWEAPRQGGRQAQAAGDPQGSEEKLSCFPPRVPGDSGKGPRPEYNAEPKLAAPGRSNFGPVWYVPDKKKAPSSPPPPPPPLRSDSFAATKSHEKAQGPVFSEAAAAQHFTALAQAQPRGDRRPELTDRPWRSAHPGSLGKGSGGPGCPQEAHADGSWPPSKDGASSRLQASLSSSDVRFPQSPHSGRHPPLYSDHSPLCADSLGQEPGAASFQNDSPPQVRGLSSCDQKLGSGWQGPRPCVQGDLQAAQLWAGCWPSDTALGALESLPPPTVGQSPRHHLPQPEGPPDARETGRCYPLDKGAEGCSAGAQEPPRASRAEKASQRLAASITWADGESSRICPQETPLLHSLTQEGKRRPESSPEDSATRPPPFDAHVGKPTRRSDRFATTLRNEIQMHRAKLQKSRSTVALTAAGEAEDGTGRWRAGLGGGTQEGPLAGTYKDHLKEAQARVLRATSFKRRDLDPNPGDLYPESLEHRMGDPDTVPHFWEAGLAQPPSSTSGGPHPPRIGGRRRFTAEQKLKSYSEPEKMNEVGLTRGYSPHQHPRTSEDTVGTFADRWKFFEETSKPVPQRPAQKQALHGIPRDKPERPRTAGRTCEGTEPWSRTTSLGDSLNAHSAAEKAGTSDLPRRLGTFAEYQASWKEQRKPLEARSSGRCHSADDILDVSLDPQERPQHVHGRSRSSPSTDHYKQEASVELRRQAGDPGEPREELPSAVRAEEGQSTPRQADAQCREGSPGSQQHPPSQKAPNPPTFSELSHCRGAPELPREGRGRAGTLPRDYRYSEESTPADLGPRAQSPGSPLHARGQDSWPVSSALLSKRPAPQRPPPPKREPRRYRATDGAPADAPVGVLGRPFPTPSPASLDVYVARLSLSHSPSVFSSAQPQDTPKATVCERGSQHVSGDASRPLPEALLPPKQQHLRLQTATMETSRSPSPQFAPQKLTDKPPLLIQDEDSTRIERVMDNNTTVKMVPIKIVHSESQPEKESRQSLACPAEPPALPHGLEKDQIKTLSTSEQFYSRFCLYTRQGAEPEAPHRAQPAEPQPLGTQVPPEKDRCTSPPGLSYMKAKEKTVEDLKSEELAREIVGKDKSLADILDPSVKIKTTMDLMEGIFPKDEHLLEEAQQRRKLLPKIPSPRSTEERKEEPSVPAAVSLATNSTYYSTSAPKAELLIKMKDLQEQQEHEEDSGSDLDHDLSVKKQELIESISRKLQVLREARESLLEDVQANTVLGAEVEAIVKGVCKPSEFDKFRMFIGDLDKVVNLLLSLSGRLARVENALNNLDDGASPGDRQSLLEKQRVLIQQHEDAKELKENLDRRERIVFDILANYLSEESLADYEHFVKMKSALIIEQRELEDKIHLGEEQLKCLLDSLQPERGK
"
     misc_feature    163..405
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(196..207,211..213,355..360,367..372)
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    1186..1188
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2005..2508
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="Apx/Shroom domain ASD1; Region: ASD1; pfam08688"
                     /db_xref="CDD:149670"
     misc_feature    3010..3012
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13796.1); phosphorylation site"
     misc_feature    3196..3198
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13796.1); phosphorylation site"
     misc_feature    3205..3207
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13796.1); phosphorylation site"
     misc_feature    4039..4920
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /note="Apx/Shroom domain ASD2; Region: ASD2; pfam08687"
                     /db_xref="CDD:204026"
     variation       104
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112679936"
     exon            256..407
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       256
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199860180"
     variation       276
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374833426"
     variation       278
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201114383"
     variation       279
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201633094"
     variation       282
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139542964"
     variation       285
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149912209"
     variation       287
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145000598"
     variation       298
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149096987"
     variation       312
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201837863"
     variation       313
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142199040"
     variation       328
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200846360"
     variation       357
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146757558"
     variation       399
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140479341"
     exon            408..539
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       431
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368951794"
     variation       447
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372670795"
     variation       462
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201142240"
     variation       480
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200350857"
     variation       489
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6640543"
     variation       499
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61739329"
     variation       501
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140977199"
     variation       503
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375673849"
     variation       522
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369952785"
     variation       523
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150231382"
     variation       527
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201833019"
     exon            540..2880
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       548
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373986332"
     variation       553
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138886901"
     variation       559
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200610499"
     variation       573
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61999277"
     variation       579
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377602826"
     variation       589
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192496291"
     variation       657
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377463965"
     variation       678
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184520696"
     variation       693
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374969022"
     variation       720
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147529383"
     variation       721
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138558321"
     variation       732
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144133328"
     STS             735..958
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599415"
                     /db_xref="UniSTS:158145"
     variation       745
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367633047"
     variation       772
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147346721"
     variation       784
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201212186"
     variation       813
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200157143"
     variation       823
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148416024"
     variation       852
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372373323"
     variation       853
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111899727"
     STS             870..1025
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="G49443"
                     /db_xref="UniSTS:109186"
     variation       873
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74461072"
     variation       897
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375430450"
     variation       910
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373429063"
     variation       965
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139545607"
     variation       986
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188033438"
     variation       1005
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372285834"
     variation       1076
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149724569"
     variation       1094
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192556048"
     variation       1139
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201766478"
     variation       1151
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369354783"
     variation       1158
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199746357"
     variation       1175
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146745184"
     variation       1183
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139392103"
     variation       1192
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374781496"
     variation       1244
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368840731"
     variation       1254
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6530341"
     variation       1268
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201195196"
     variation       1272
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377422277"
     variation       1282
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149593227"
     variation       1283
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144299681"
     STS             1284..1456
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599441"
                     /db_xref="UniSTS:158152"
     variation       1300
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146545805"
     variation       1319
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184636687"
     variation       1342
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369881284"
     variation       1347
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373737070"
     variation       1365
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377633199"
     variation       1389
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201743318"
     variation       1391
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149149058"
     variation       1399
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112628472"
     variation       1401
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200302584"
     variation       1408
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151274823"
     variation       1428
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140533569"
     variation       1432
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147084526"
     variation       1438
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200380404"
     variation       1452
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375147235"
     variation       1507
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734873"
     variation       1516
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201256775"
     variation       1533
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370272422"
     STS             1565..1769
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599465"
                     /db_xref="UniSTS:158158"
     variation       1566
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374614082"
     variation       1568
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61738461"
     variation       1569
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368967278"
     variation       1585
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144092420"
     variation       1603
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146916164"
     variation       1616
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137866742"
     variation       1622
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199877667"
     variation       1639
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149459016"
     variation       1640
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61744793"
     variation       1670
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148641753"
     variation       1679
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371072821"
     variation       1680
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374387368"
     variation       1691
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61744807"
     STS             1703..1929
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599475"
                     /db_xref="UniSTS:158160"
     variation       1729
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61739685"
     variation       1773
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376118391"
     variation       1848
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371670140"
     STS             1879..2105
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599486"
                     /db_xref="UniSTS:158161"
     variation       1879
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374862299"
     variation       1905
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189876719"
     variation       1916
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201911751"
     variation       1917
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367727332"
     variation       1923
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146235996"
     variation       1929
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371921297"
     variation       1952
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139350587"
     variation       1960
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144144863"
     variation       2023
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374898048"
     variation       2024
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200488769"
     variation       2057
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201141236"
     variation       2071
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146519576"
     variation       2074
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370184337"
     variation       2075
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373360048"
     variation       2086
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733859"
     variation       2158
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139667079"
     variation       2185
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369472774"
     variation       2227
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149540115"
     variation       2232
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200988135"
     STS             2253..2485
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599499"
                     /db_xref="UniSTS:158164"
     variation       2285
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145727348"
     variation       2329
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61740917"
     variation       2401
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373819870"
     variation       2404
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148949490"
     variation       2424
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147074512"
     variation       2435
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200879529"
     STS             2440..2613
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599508"
                     /db_xref="UniSTS:158165"
     variation       2440
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147717742"
     variation       2481
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377485600"
     variation       2517
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142549415"
     variation       2543
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61744804"
     STS             2544..2765
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599514"
                     /db_xref="UniSTS:158166"
     variation       2548
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61739700"
     variation       2551
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141610350"
     variation       2583
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150083189"
     variation       2585
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12006769"
     variation       2586
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200542562"
     variation       2590
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141630186"
     variation       2607
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373190071"
     variation       2625
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146225710"
     variation       2628
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137979992"
     variation       2648
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376124648"
     variation       2658
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371590825"
     variation       2663
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73474584"
     variation       2664
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144110998"
     variation       2691
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202190752"
     variation       2692
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374462030"
     variation       2693
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148686929"
     variation       2701
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368355034"
     variation       2762
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235851"
     variation       2770
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370597896"
     variation       2771
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201437719"
     variation       2783
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147796126"
     variation       2792
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150824034"
     variation       2826
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200547169"
     variation       2832
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139914920"
     exon            2881..2981
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       2884
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61752518"
     variation       2900
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147695083"
     variation       2916
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16985780"
     variation       2920
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375921653"
     variation       2947
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144840238"
     variation       2949
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16985782"
     variation       2979
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61750846"
     exon            2982..3677
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       2984
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372502934"
     variation       3002
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149000944"
     variation       3030
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143842098"
     variation       3046
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199645557"
     variation       3115
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200219705"
     variation       3116
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369591362"
     variation       3122
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148190447"
     variation       3124
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201633306"
     variation       3125
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200564339"
     variation       3126
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140239325"
     variation       3128
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145299371"
     variation       3139
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201265738"
     variation       3155
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12388875"
     variation       3234
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:137947571"
     variation       3282
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200123909"
     variation       3299
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142493970"
     variation       3300
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150556964"
     variation       3348
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138615994"
     variation       3353
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61744805"
     variation       3361
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144623135"
     variation       3378
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374276560"
     STS             3387..3554
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599536"
                     /db_xref="UniSTS:158170"
     variation       3390
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139824966"
     variation       3392
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145370363"
     variation       3432
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375527730"
     variation       3439
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369568712"
     variation       3578
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372814254"
     variation       3579
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140797565"
     variation       3608
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370073720"
     variation       3619
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200243509"
     variation       3623
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373440832"
     variation       3631
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142364771"
     variation       3661
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151298781"
     variation       3676
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140571503"
     exon            3678..4229
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       3685
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201326634"
     variation       3698
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376695556"
     variation       3708
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150051019"
     variation       3715
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145408951"
     variation       3747
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184423737"
     variation       3777
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140219129"
     variation       3787
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145258676"
     variation       3798
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61185401"
     variation       3828
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200251672"
     variation       3846
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2073945"
     variation       3855
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373880246"
     variation       3864
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7881210"
     variation       3881
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148235958"
     variation       3900
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141261555"
     variation       3924
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200401546"
     variation       3938
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199872836"
     variation       3944
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150369562"
     STS             3949..4093
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:599551"
                     /db_xref="UniSTS:158174"
     variation       3955
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200823186"
     variation       3961
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374843987"
     variation       3970
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368647776"
     variation       3971
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372702575"
     variation       3978
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200451659"
     variation       4038
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201847453"
     variation       4050
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372131284"
     variation       4083
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375110528"
     variation       4084
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138215112"
     variation       4110
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199742414"
     variation       4120
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143769341"
     variation       4131
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369215971"
     variation       4134
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184617103"
     variation       4136
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201897769"
     variation       4170
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201079297"
     variation       4195
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372636460"
     exon            4230..4401
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       4237
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147239057"
     variation       4242
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200100847"
     variation       4253
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200112379"
     variation       4274
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377359384"
     variation       4296
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140758778"
     variation       4353
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370681330"
     variation       4364
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149373874"
     variation       4371
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144736449"
     variation       4383
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374770438"
     exon            4402..4674
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     variation       4427
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374474315"
     variation       4444
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201285005"
     variation       4445
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189631774"
     variation       4449
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148547697"
     variation       4473
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741856"
     variation       4498
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193024785"
     variation       4501
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146625316"
     variation       4508
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372130733"
     variation       4513
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12012202"
     variation       4525
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201500406"
     variation       4554
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143951833"
     variation       4556
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376434792"
     variation       4578
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369326337"
     variation       4605
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371560341"
     variation       4650
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183701518"
     variation       4653
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374782377"
     variation       4657
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146420450"
     variation       4673
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200309657"
     exon            4675..7445
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /inference="alignment:Splign:1.39.8"
     STS             4706..4930
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="SHROOM2"
                     /db_xref="UniSTS:506511"
     variation       4722
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200352588"
     variation       4731
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377424861"
     variation       4748
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199608665"
     variation       4752
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140718348"
     variation       4756
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150102691"
     variation       4760
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201047041"
     variation       4811
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370115524"
     STS             4831..5049
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="GDB:603631"
                     /db_xref="UniSTS:158184"
     variation       4842
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374319773"
     variation       4870
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200670691"
     variation       4911
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2073942"
     variation       4955
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368804670"
     variation       4980
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139494419"
     variation       4996
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7057824"
     variation       5111
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145538076"
     variation       5129
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886128"
     variation       5152
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185927412"
     variation       5266
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141116076"
     variation       5354
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188878911"
     variation       5471
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181291636"
     variation       5706
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12010339"
     variation       5813
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1858884"
     variation       5884
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886129"
     variation       5953
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73476659"
     variation       5995
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370283857"
     variation       6029
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374127613"
     variation       6059
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148351641"
     variation       6067..6068
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:199882707"
     STS             6085..6331
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="A007I24"
                     /db_xref="UniSTS:79357"
     STS             6104..6279
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /standard_name="RH18181"
                     /db_xref="UniSTS:6455"
     variation       6147
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185461645"
     variation       6250
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189880029"
     variation       6258
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182893990"
     variation       6259
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185775419"
     variation       6347
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6640571"
     variation       6374
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369802679"
     variation       6527
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150426398"
     variation       6673
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138353784"
     variation       6687
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192399312"
     variation       6781
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183717132"
     variation       6837
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17321218"
     variation       6880
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372668813"
     variation       7019
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146066675"
     variation       7065
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187601712"
     variation       7100
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4830680"
     variation       7167
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1061198"
     variation       7183
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139375749"
     variation       7202
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:71737636"
     variation       7249
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192135042"
     variation       7275
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182811535"
     polyA_signal    7423..7428
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
     polyA_site      7445
                     /gene="SHROOM2"
                     /gene_synonym="APXL; HSAPXL"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
tctgcggcgctcggagcctcccttgcgatcccacggccgggactgcccggagtgcatgggcgcgggccagggacgctgagcggtcgcgccatggagggcgccgagccccgcgcgcggcccgagcgcctggccgaggccgagacgcgggcggcggacggcgggcgcctggtggaggtgcagctgagcggcggcgccccgtggggcttcaccctgaagggcggccgcgagcacggcgagccgctggtcatcaccaagattgaagagggcagtaaagccgcggcggtcgacaagttactggctggagatgagatcgtcggcatcaatgacattggtctctcagggtttagacaggaagcgatttgcctggtgaaggggtcccataagaccctgaagctggtcgtcaaaaggaggagcgagctgggctggaggcctcactcctggcatgccaccaagttctctgacagccaccccgagctagcggcctccccattcacctccaccagcggctgtccttcctggtccggccgacaccacgcgagttcttcctcccacgacctgtccagttcctgggagcagacgaacctacagcgcaccttagatcacttcagctccttggggagcgttgacagcctggaccacccctccagtcgcctctcggtggccaagtccaacagcagcatcgaccacctgggcagccacagcaagcgcgactcggcctacggctccttctccaccagctctagcactcctgaccacaccttgtccaaagccgacacgtcctccgcagagaacatcctctacactgtgggcctctgggaggctcccaggcagggtggccggcaggcccaggccgcaggcgaccctcagggctcggaggagaagctcagttgtttcccgcccagggtccccggtgacagcggcaaaggccccaggccagagtacaatgccgagcccaagctggctgcccctgggaggtccaattttgggccagtctggtatgttcccgataagaagaaagcaccatcatccccacctcctccccctccccctctccgcagtgacagctttgctgccaccaagagccacgagaaggcccagggccctgtgttctcagaggcggctgcggcacagcactttacggccctggcccaggctcagcctcgtggtgaccggagaccagagctcaccgatcggccttggaggtcagcacacccggggagcctcgggaagggatcgggaggcccgggctgcccacaggaggcccacgcagacggcagctggccgccctccaaggatggagcttccagtaggctgcaggcctctctgtccagctcagatgtgcgcttccctcagtctcctcatagcggccgacaccctcccctatacagcgaccacagccccctctgtgctgacagccttgggcaggagccaggggctgccagcttccagaacgacagccctcctcaggtgagggggctcagcagctgtgaccagaagctggggagcggctggcagggtccccggccctgtgtgcagggagacctgcaagcagcacagctctgggcgggatgctggccttctgacacagcccttggagccctcgagagtcttcccccacccacggtgggccagagcccacgccatcacctacctcagcctgagggtcctccggatgcccgcgagacaggacggtgttacccgctggacaaaggggccgagggctgctccgcgggagcccaggagcctcccagggccagccgtgcagaaaaagccagccagaggctggcagccagcatcacgtgggcagatggggagagcagcaggatctgcccgcaggagacgcccctgttgcactccctgacccaggaggggaagcgccggcctgagagcagtccagaggacagcgccaccagaccgccaccgttcgacgcccacgtgggcaagcccacccgaagaagcgaccgctttgccaccaccctgcggaatgagatccagatgcatagagccaagctgcagaagagccggagcacagtggctctgactgcagcaggggaggcggaggatggcaccggccgctggagggccgggttgggaggtggcacccaggaaggacccctcgctggcacctataaagaccacctgaaagaggcccaagcccgggtcctgagggccacgtccttcaagcgccgcgacttggaccccaacccaggagacctatacccggagtcactggaacaccggatgggggatccagacactgtcccccacttctgggaggcaggcctggcccagccaccctcatctacaagtggcgggccccacccgccccgcatcggaggccggagacggttcacagctgagcagaaattgaagtcctactcggaacctgagaagatgaacgaggtgggcctcacgaggggctacagtcctcaccagcaccccaggacatctgaggatactgtgggcacgtttgctgacaggtggaagttttttgaggaaacgagcaaacctgttccccagaggcctgcccagaagcaagctcttcacggaatcccgagagacaagccagagaggccgcggacagcgggccgcacatgtgagggcacggagccctggtcgcgcaccacctcccttggggacagcctcaacgctcacagcgcagcggagaaggcagggacttcagacctgccgcggaggctcggcacctttgcagagtatcaggcctcttggaaggaacagaggaaacctctggaggccaggagctctgggcgctgccactcagcggatgacatcctggatgtgagcctggacccacaggagaggccgcagcacgttcatgggaggtcccggtcttcaccgtccacagaccactacaagcaggaagcttctgtcgaactgcgaaggcaggcaggggaccccggcgagcccagagaagagcttccctccgcagtccgggccgaggagggacagtccacgccgagacaagcagatgcccagtgtcgggaaggcagcccaggatcacagcagcacccaccgagtcagaaggcaccgaacccacccacattctctgaactatctcactgccggggagccccagagctgccccgggagggccggggccgagcgggaaccctacctcgagattatagatactcggaggagagcaccccagcagacttgggaccccgagcccagagccctggctcacccctgcatgctcgaggacaagactcgtggccagtgagctcagccctgctctccaagaggccagccccacagaggccaccgccacccaagcgcgagcccaggagatacagggccacagacggcgcacctgctgacgcccccgtgggcgtcctcggcaggcccttcccaacgccatcccctgcgtccctggatgtgtatgtggcccgcctgtccctctcccacagcccctctgtgttcagcagtgcccagccccaggacaccccgaaggccactgtctgtgagcgtggaagccagcatgtgagcggggacgcatcacgtcctctgccagaagcactgctccctcccaagcagcagcacctgcgcctgcagacggccaccatggagacctcgcgctccccctcgccccagttcgccccccagaaactgacggacaaacctcccctgctcatccaggatgaggattcaaccagaattgagcgggtgatggacaacaacaccacggtgaagatggtgcccatcaagatcgtgcactcggagagccagccagagaaggagagccgccagagcctggcatgccccgccgagccacctgccctgccccacgggctggagaaagaccagatcaagacgctgagcacatctgagcagttctactcgcgcttctgtctgtacacgcggcagggtgctgagcccgaggccccacatagggcccagccggctgagccccagcccctgggcacccaggtgccccccgagaaagaccgctgcacctcccctccagggctcagctacatgaaggccaaagagaagactgtggaagacctgaagtcggaggagctggccagggagatcgtggggaaggataagtccctggccgacatcctggatcccagtgtgaagatcaaaaccactatggacttgatggaaggcatcttccccaaagacgagcacctcctggaagaagcccagcaacggaggaagctgctccccaaaatcccctctcctagaagcacagaggagaggaaagaggagcccagcgtgcctgcggccgtgtccctggccaccaattctacctactacagcacgtcggcccccaaggcggagctgctgatcaagatgaaggacctgcaggagcagcaggagcacgaagaggattcgggaagcgacttggaccacgacctgtcggtgaagaagcaggagctcatcgagagcatcagccgcaagctgcaggtgctccgggaggcccgcgagagcctgctggaggacgtgcaggccaacaccgtgctgggggccgaggtggaggccatcgtgaaaggcgtctgcaagcccagcgagtttgacaagttccggatgttcattggagacctggacaaagtggtgaacctcctgctgtcgctgtcaggccgcctggcccgggtggagaatgccctcaataatttggacgacggcgcttctcccggtgatcggcaatcactgcttgagaagcagagagtcctgatccagcagcacgaggacgccaaggagctcaaggagaacctggaccgccgcgagcgcatcgtctttgacattttggccaactatctgagcgaggagagcctcgcggactatgagcacttcgtgaagatgaagtcggccctcatcatcgagcagcgggagctggaagataaaatccaccttggtgaagagcagctgaagtgcttattggacagccttcagcccgaaaggggcaaataagagaccagtccccggtggaggaggggcacggggcctccgagctccagctccgttcccaaggatactcgtgaagaccccatctgtgttcatggcctggaaagagacttctcccatagcaaagaggctgttataaaagcaataacttttgtgtttgtgtgggatgatttatttaattttttagtttcccctttgattgctgagagccattttcctttacacataactacacctgacaccaggctctgctggatgtgagtttccactgcatgggctgtgggctgggcctgtggtgcctgccgagtggtcactgtcagtgggaaacccgttgttcctcccgtcttcagatgctgagccaactgcttggacagcagccagcgcgtcatgacgtgcatgagagggggaccctggtgctcatcttctcttgtcattcatccaggcatgggctgccaggttttgtccctgctcgttcaacagtgtgagcatttgtctctgttatctaatgatgttctctgacccagcagaaatcatcatcatgatgatgataatttattaactttttggaagggtgaatagtttcctaatggttaaaaaccaactgtgaaaggaaccacctgtgtggttgggttcactcattctcagattaaattgccacttaaagaaataacgtgcatgctttaaaaaacacagtcacgcaccaagcaggcaaatagctttagtccttctcacctcacatcacagttgttctgcaaagtaaaattttttggttaagagcgtgtccagtagtaatgtgcttgttagctgtttctcaagaccaacagaagattttttcagttactttccccccatgtattttgtatgcatatgattgtccgtgataattggctacttttccattgtttcctccttaaatcgtttagcatggcatgagggccacattccatggacgggaagaccccttcctcttcagaggtcccgtggactacacagctcctgagcttgatctttttctgccatgaagtttaaagattctatgcccatttccttgattgaaatggcaggattctaaagagagcctggtttgttaaaagaaaacactgtcatgctgtcagttcccaattgacaagtcacagactgggagaaaatatttgcaaatcgtgtatctgacaaaaggtttgtgtccaggatgtacaaagaactctcaaaccggatagtaagaaaacaaacagcccaagtgaaaagcaggcaaaagacttgaatagacacttcaccaaagagcatacacgcgtggcaaacaagcacacgaaaagacgttcagccgccgatggcttggttataatttataacttacttatttttatctaataattgtagattcagtgtatttcttcaaaaaatgtttaattaaatgcatgttaatggtgagtgaatcccttgggtgacttcgtgtttaggtcgtattagggcatttgttggatcaacggatcattttaaccctgacttccccttattcccataaaagaagttttccagtggaatggagatttcattttgtcagcagcagtgaccacagccttaccaaagcagacgcgtgcgcgtgcacagatgcacacacacagatgtcttaaaagactagaatccacacttcctgagccagaggggccgtgttgacggtaatgcattctctatagagccaagtccaaactggcaagctcaatgatgcaggcaataaaccgcctttttggcagcctaccaatgccaaaaggataaatgtctttccaaaagtgtgtattcctgttaaattaagctcttgctaacttgaaaaatccctgttctgccagcgaagcttcctcctcctctccagctggtagtcacttgcgtgaatgctggtcagtctgaaaaggtgaagctggctgtgcacttacccccatctttctccctcggggagacgacccaaggaatttcagagtattttgtttggcagagcttttacctgttattctttgccctcaaatacagtattgtggtcattttgatgatatgtgtgtaaaatgtgaataatccaattggtgtctgtactcagccttttgatgtctttttaggactttctcttctacacagcaatacgtcgtgctcgagtatccttgtagcaaagcacatagagccagctgtcctgtcagttcccctgtttgcctctgaaacgtctggttagtggggacccaaagattctagtgagtcaacatccataactctgtatctagttgtattattcatagaaaatcaatctggtgctaatggttggccctggtgttgttgggtggcagctgctccttcgccctcttgtagtgtggctgtggagggctctgcctatggggggtggcctgtggcttgtatccttcagtccaccacagcaaatgtgtgtagatttcatgctcgacacttaccactcacctatcaacagatcatcctgcttgactgtaacaaaataaatagtgtctcttcaagtg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:357 -> Molecular function: GO:0003779 [actin binding] evidence: ISS
            GeneID:357 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:357 -> Molecular function: GO:0008013 [beta-catenin binding] evidence: ISS
            GeneID:357 -> Molecular function: GO:0015280 [ligand-gated sodium channel activity] evidence: TAS
            GeneID:357 -> Molecular function: GO:0019904 [protein domain specific binding] evidence: IEA
            GeneID:357 -> Molecular function: GO:0051015 [actin filament binding] evidence: ISS
            GeneID:357 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IDA
            GeneID:357 -> Biological process: GO:0000902 [cell morphogenesis] evidence: ISS
            GeneID:357 -> Biological process: GO:0002089 [lens morphogenesis in camera-type eye] evidence: ISS
            GeneID:357 -> Biological process: GO:0007420 [brain development] evidence: ISS
            GeneID:357 -> Biological process: GO:0008057 [eye pigment granule organization] evidence: ISS
            GeneID:357 -> Biological process: GO:0016477 [cell migration] evidence: ISS
            GeneID:357 -> Biological process: GO:0030835 [negative regulation of actin filament depolymerization] evidence: IEA
            GeneID:357 -> Biological process: GO:0032401 [establishment of melanosome localization] evidence: ISS
            GeneID:357 -> Biological process: GO:0032438 [melanosome organization] evidence: ISS
            GeneID:357 -> Biological process: GO:0043010 [camera-type eye development] evidence: ISS
            GeneID:357 -> Biological process: GO:0043482 [cellular pigment accumulation] evidence: ISS
            GeneID:357 -> Biological process: GO:0043583 [ear development] evidence: ISS
            GeneID:357 -> Biological process: GO:0045176 [apical protein localization] evidence: ISS
            GeneID:357 -> Biological process: GO:0045217 [cell-cell junction maintenance] evidence: IEA
            GeneID:357 -> Biological process: GO:0048593 [camera-type eye morphogenesis] evidence: ISS
            GeneID:357 -> Biological process: GO:0051017 [actin filament bundle assembly] evidence: ISS
            GeneID:357 -> Cellular component: GO:0005856 [cytoskeleton] evidence: ISS
            GeneID:357 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
            GeneID:357 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
            GeneID:357 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: ISS
            GeneID:357 -> Cellular component: GO:0005923 [tight junction] evidence: ISS
            GeneID:357 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: ISS
            GeneID:357 -> Cellular component: GO:0030864 [cortical actin cytoskeleton] evidence: IDA
            GeneID:357 -> Cellular component: GO:0030864 [cortical actin cytoskeleton] evidence: ISS
            GeneID:357 -> Cellular component: GO:0031941 [filamentous actin] evidence: IEA
            GeneID:357 -> Cellular component: GO:0043025 [neuronal cell body] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.