Home |
Help |
Advanced search
2024-04-25 22:33:27, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001649 7445 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens shroom family member 2 (SHROOM2), mRNA.
ACCESSION NM_001649
VERSION NM_001649.2 GI:18375508
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 7445)
AUTHORS Dunlop,M.G., Dobbins,S.E., Farrington,S.M., Jones,A.M., Palles,C.,
Whiffin,N., Tenesa,A., Spain,S., Broderick,P., Ooi,L.Y.,
Domingo,E., Smillie,C., Henrion,M., Frampton,M., Martin,L.,
Grimes,G., Gorman,M., Semple,C., Ma,Y.P., Barclay,E.,
Prendergast,J., Cazier,J.B., Olver,B., Penegar,S., Lubbe,S.,
Chander,I., Carvajal-Carmona,L.G., Ballereau,S., Lloyd,A.,
Vijayakrishnan,J., Zgaga,L., Rudan,I., Theodoratou,E., Starr,J.M.,
Deary,I., Kirac,I., Kovacevic,D., Aaltonen,L.A.,
Renkonen-Sinisalo,L., Mecklin,J.P., Matsuda,K., Nakamura,Y.,
Okada,Y., Gallinger,S., Duggan,D.J., Conti,D., Newcomb,P.,
Hopper,J., Jenkins,M.A., Schumacher,F., Casey,G., Easton,D.,
Shah,M., Pharoah,P., Lindblom,A., Liu,T., Smith,C.G., West,H.,
Cheadle,J.P., Midgley,R., Kerr,D.J., Campbell,H., Tomlinson,I.P.
and Houlston,R.S.
CONSRTM Colorectal Tumour Gene Identification (CORGI) Consortium; Swedish
Low-Risk Colorectal Cancer Study Group; COIN Collaborative Group
TITLE Common variation near CDKN1A, POLD3 and SHROOM2 influences
colorectal cancer risk
JOURNAL Nat. Genet. 44 (7), 770-776 (2012)
PUBMED 22634755
REMARK GeneRIF: We identified three new CRC risk loci at 6p21 (rs1321311,
near CDKN1A; P = 1.14 x 10(-10)), 11q13.4 (rs3824999, intronic to
POLD3; P = 3.65 x 10(-10)) and Xp22.2 (rs5934683, near SHROOM2; P =
7.30 x 10(-10)).
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 7445)
AUTHORS Farber,M.J., Rizaldy,R. and Hildebrand,J.D.
TITLE Shroom2 regulates contractility to control endothelial
morphogenesis
JOURNAL Mol. Biol. Cell 22 (6), 795-805 (2011)
PUBMED 21248203
REMARK GeneRIF: Data suggest that Shroom2 facilitates the formation of a
contractile network within endothelial cells, the loss of which
leads to an increase in endothelial sprouting, migration, and
angiogenesis.
REFERENCE 3 (bases 1 to 7445)
AUTHORS Wu,C., Ma,M.H., Brown,K.R., Geisler,M., Li,L., Tzeng,E., Jia,C.Y.,
Jurisica,I. and Li,S.S.
TITLE Systematic identification of SH3 domain-mediated human
protein-protein interactions by peptide array target screening
JOURNAL Proteomics 7 (11), 1775-1785 (2007)
PUBMED 17474147
REFERENCE 4 (bases 1 to 7445)
AUTHORS Dietz,M.L., Bernaciak,T.M., Vendetti,F., Kielec,J.M. and
Hildebrand,J.D.
TITLE Differential actin-dependent localization modulates the
evolutionarily conserved activity of Shroom family proteins
JOURNAL J. Biol. Chem. 281 (29), 20542-20554 (2006)
PUBMED 16684770
REFERENCE 5 (bases 1 to 7445)
AUTHORS Hagens,O., Ballabio,A., Kalscheuer,V., Kraehenbuhl,J.P.,
Schiaffino,M.V., Smith,P., Staub,O., Hildebrand,J. and
Wallingford,J.B.
TITLE A new standard nomenclature for proteins related to Apx and Shroom
JOURNAL BMC Cell Biol. 7, 18 (2006)
PUBMED 16615870
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 7445)
AUTHORS Ross,M.T., Grafham,D.V., Coffey,A.J., Scherer,S., McLay,K.,
Muzny,D., Platzer,M., Howell,G.R., Burrows,C., Bird,C.P.,
Frankish,A., Lovell,F.L., Howe,K.L., Ashurst,J.L., Fulton,R.S.,
Sudbrak,R., Wen,G., Jones,M.C., Hurles,M.E., Andrews,T.D.,
Scott,C.E., Searle,S., Ramser,J., Whittaker,A., Deadman,R.,
Carter,N.P., Hunt,S.E., Chen,R., Cree,A., Gunaratne,P., Havlak,P.,
Hodgson,A., Metzker,M.L., Richards,S., Scott,G., Steffen,D.,
Sodergren,E., Wheeler,D.A., Worley,K.C., Ainscough,R.,
Ambrose,K.D., Ansari-Lari,M.A., Aradhya,S., Ashwell,R.I.,
Babbage,A.K., Bagguley,C.L., Ballabio,A., Banerjee,R., Barker,G.E.,
Barlow,K.F., Barrett,I.P., Bates,K.N., Beare,D.M., Beasley,H.,
Beasley,O., Beck,A., Bethel,G., Blechschmidt,K., Brady,N.,
Bray-Allen,S., Bridgeman,A.M., Brown,A.J., Brown,M.J., Bonnin,D.,
Bruford,E.A., Buhay,C., Burch,P., Burford,D., Burgess,J.,
Burrill,W., Burton,J., Bye,J.M., Carder,C., Carrel,L., Chako,J.,
Chapman,J.C., Chavez,D., Chen,E., Chen,G., Chen,Y., Chen,Z.,
Chinault,C., Ciccodicola,A., Clark,S.Y., Clarke,G., Clee,C.M.,
Clegg,S., Clerc-Blankenburg,K., Clifford,K., Cobley,V., Cole,C.G.,
Conquer,J.S., Corby,N., Connor,R.E., David,R., Davies,J., Davis,C.,
Davis,J., Delgado,O., Deshazo,D., Dhami,P., Ding,Y., Dinh,H.,
Dodsworth,S., Draper,H., Dugan-Rocha,S., Dunham,A., Dunn,M.,
Durbin,K.J., Dutta,I., Eades,T., Ellwood,M., Emery-Cohen,A.,
Errington,H., Evans,K.L., Faulkner,L., Francis,F., Frankland,J.,
Fraser,A.E., Galgoczy,P., Gilbert,J., Gill,R., Glockner,G.,
Gregory,S.G., Gribble,S., Griffiths,C., Grocock,R., Gu,Y.,
Gwilliam,R., Hamilton,C., Hart,E.A., Hawes,A., Heath,P.D.,
Heitmann,K., Hennig,S., Hernandez,J., Hinzmann,B., Ho,S., Hoffs,M.,
Howden,P.J., Huckle,E.J., Hume,J., Hunt,P.J., Hunt,A.R.,
Isherwood,J., Jacob,L., Johnson,D., Jones,S., de Jong,P.J.,
Joseph,S.S., Keenan,S., Kelly,S., Kershaw,J.K., Khan,Z.,
Kioschis,P., Klages,S., Knights,A.J., Kosiura,A., Kovar-Smith,C.,
Laird,G.K., Langford,C., Lawlor,S., Leversha,M., Lewis,L., Liu,W.,
Lloyd,C., Lloyd,D.M., Loulseged,H., Loveland,J.E., Lovell,J.D.,
Lozado,R., Lu,J., Lyne,R., Ma,J., Maheshwari,M., Matthews,L.H.,
McDowall,J., McLaren,S., McMurray,A., Meidl,P., Meitinger,T.,
Milne,S., Miner,G., Mistry,S.L., Morgan,M., Morris,S., Muller,I.,
Mullikin,J.C., Nguyen,N., Nordsiek,G., Nyakatura,G., O'Dell,C.N.,
Okwuonu,G., Palmer,S., Pandian,R., Parker,D., Parrish,J.,
Pasternak,S., Patel,D., Pearce,A.V., Pearson,D.M., Pelan,S.E.,
Perez,L., Porter,K.M., Ramsey,Y., Reichwald,K., Rhodes,S.,
Ridler,K.A., Schlessinger,D., Schueler,M.G., Sehra,H.K.,
Shaw-Smith,C., Shen,H., Sheridan,E.M., Shownkeen,R., Skuce,C.D.,
Smith,M.L., Sotheran,E.C., Steingruber,H.E., Steward,C.A.,
Storey,R., Swann,R.M., Swarbreck,D., Tabor,P.E., Taudien,S.,
Taylor,T., Teague,B., Thomas,K., Thorpe,A., Timms,K., Tracey,A.,
Trevanion,S., Tromans,A.C., d'Urso,M., Verduzco,D., Villasana,D.,
Waldron,L., Wall,M., Wang,Q., Warren,J., Warry,G.L., Wei,X.,
West,A., Whitehead,S.L., Whiteley,M.N., Wilkinson,J.E.,
Willey,D.L., Williams,G., Williams,L., Williamson,A.,
Williamson,H., Wilming,L., Woodmansey,R.L., Wray,P.W., Yen,J.,
Zhang,J., Zhou,J., Zoghbi,H., Zorilla,S., Buck,D., Reinhardt,R.,
Poustka,A., Rosenthal,A., Lehrach,H., Meindl,A., Minx,P.J.,
Hillier,L.W., Willard,H.F., Wilson,R.K., Waterston,R.H., Rice,C.M.,
Vaudin,M., Coulson,A., Nelson,D.L., Weinstock,G., Sulston,J.E.,
Durbin,R., Hubbard,T., Gibbs,R.A., Beck,S., Rogers,J. and
Bentley,D.R.
TITLE The DNA sequence of the human X chromosome
JOURNAL Nature 434 (7031), 325-337 (2005)
PUBMED 15772651
REFERENCE 7 (bases 1 to 7445)
AUTHORS Jin,J., Smith,F.D., Stark,C., Wells,C.D., Fawcett,J.P.,
Kulkarni,S., Metalnikov,P., O'Donnell,P., Taylor,P., Taylor,L.,
Zougman,A., Woodgett,J.R., Langeberg,L.K., Scott,J.D. and Pawson,T.
TITLE Proteomic, functional, and domain-based analysis of in vivo 14-3-3
binding proteins involved in cytoskeletal regulation and cellular
organization
JOURNAL Curr. Biol. 14 (16), 1436-1450 (2004)
PUBMED 15324660
REFERENCE 8 (bases 1 to 7445)
AUTHORS Schiaffino,M.V., Bassi,M.T., Rugarli,E.I., Renieri,A., Galli,L. and
Ballabio,A.
TITLE Cloning of a human homologue of the Xenopus laevis APX gene from
the ocular albinism type 1 critical region
JOURNAL Hum. Mol. Genet. 4 (3), 373-382 (1995)
PUBMED 7795590
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from X83543.1.
This sequence is a reference standard in the RefSeqGene project.
On Jan 25, 2002 this sequence version replaced gi:4502174.
Summary: The protein encoded by this gene shares significant
similarities with the apical protein from Xenopus laevis which is
implicated in amiloride-sensitive sodium channel activity. This
gene is a strong candidate gene for ocular albinism type 1
syndrome. [provided by RefSeq, Jul 2008].
##Evidence-Data-START##
Transcript exon combination :: X83543.1, BC140866.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025086 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..7445
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp22.3"
gene 1..7445
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="shroom family member 2"
/db_xref="GeneID:357"
/db_xref="HGNC:630"
/db_xref="HPRD:02113"
/db_xref="MIM:300103"
exon 1..255
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
CDS 91..4941
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="APX homolog of Xenopus; apical-like protein"
/codon_start=1
/product="protein Shroom2"
/protein_id="NP_001640.1"
/db_xref="GI:4502175"
/db_xref="CCDS:CCDS14135.1"
/db_xref="GeneID:357"
/db_xref="HGNC:630"
/db_xref="HPRD:02113"
/db_xref="MIM:300103"
/translation="
MEGAEPRARPERLAEAETRAADGGRLVEVQLSGGAPWGFTLKGGREHGEPLVITKIEEGSKAAAVDKLLAGDEIVGINDIGLSGFRQEAICLVKGSHKTLKLVVKRRSELGWRPHSWHATKFSDSHPELAASPFTSTSGCPSWSGRHHASSSSHDLSSSWEQTNLQRTLDHFSSLGSVDSLDHPSSRLSVAKSNSSIDHLGSHSKRDSAYGSFSTSSSTPDHTLSKADTSSAENILYTVGLWEAPRQGGRQAQAAGDPQGSEEKLSCFPPRVPGDSGKGPRPEYNAEPKLAAPGRSNFGPVWYVPDKKKAPSSPPPPPPPLRSDSFAATKSHEKAQGPVFSEAAAAQHFTALAQAQPRGDRRPELTDRPWRSAHPGSLGKGSGGPGCPQEAHADGSWPPSKDGASSRLQASLSSSDVRFPQSPHSGRHPPLYSDHSPLCADSLGQEPGAASFQNDSPPQVRGLSSCDQKLGSGWQGPRPCVQGDLQAAQLWAGCWPSDTALGALESLPPPTVGQSPRHHLPQPEGPPDARETGRCYPLDKGAEGCSAGAQEPPRASRAEKASQRLAASITWADGESSRICPQETPLLHSLTQEGKRRPESSPEDSATRPPPFDAHVGKPTRRSDRFATTLRNEIQMHRAKLQKSRSTVALTAAGEAEDGTGRWRAGLGGGTQEGPLAGTYKDHLKEAQARVLRATSFKRRDLDPNPGDLYPESLEHRMGDPDTVPHFWEAGLAQPPSSTSGGPHPPRIGGRRRFTAEQKLKSYSEPEKMNEVGLTRGYSPHQHPRTSEDTVGTFADRWKFFEETSKPVPQRPAQKQALHGIPRDKPERPRTAGRTCEGTEPWSRTTSLGDSLNAHSAAEKAGTSDLPRRLGTFAEYQASWKEQRKPLEARSSGRCHSADDILDVSLDPQERPQHVHGRSRSSPSTDHYKQEASVELRRQAGDPGEPREELPSAVRAEEGQSTPRQADAQCREGSPGSQQHPPSQKAPNPPTFSELSHCRGAPELPREGRGRAGTLPRDYRYSEESTPADLGPRAQSPGSPLHARGQDSWPVSSALLSKRPAPQRPPPPKREPRRYRATDGAPADAPVGVLGRPFPTPSPASLDVYVARLSLSHSPSVFSSAQPQDTPKATVCERGSQHVSGDASRPLPEALLPPKQQHLRLQTATMETSRSPSPQFAPQKLTDKPPLLIQDEDSTRIERVMDNNTTVKMVPIKIVHSESQPEKESRQSLACPAEPPALPHGLEKDQIKTLSTSEQFYSRFCLYTRQGAEPEAPHRAQPAEPQPLGTQVPPEKDRCTSPPGLSYMKAKEKTVEDLKSEELAREIVGKDKSLADILDPSVKIKTTMDLMEGIFPKDEHLLEEAQQRRKLLPKIPSPRSTEERKEEPSVPAAVSLATNSTYYSTSAPKAELLIKMKDLQEQQEHEEDSGSDLDHDLSVKKQELIESISRKLQVLREARESLLEDVQANTVLGAEVEAIVKGVCKPSEFDKFRMFIGDLDKVVNLLLSLSGRLARVENALNNLDDGASPGDRQSLLEKQRVLIQQHEDAKELKENLDRRERIVFDILANYLSEESLADYEHFVKMKSALIIEQRELEDKIHLGEEQLKCLLDSLQPERGK
"
misc_feature 163..405
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="PDZ domain found in a variety of Eumetazoan
signaling molecules, often in tandem arrangements. May be
responsible for specific protein-protein interactions, as
most PDZ domains bind C-terminal polypeptides, and binding
to internal (non-C-terminal)...; Region: PDZ_signaling;
cd00992"
/db_xref="CDD:29049"
misc_feature order(196..207,211..213,355..360,367..372)
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="protein binding site [polypeptide binding]; other
site"
/db_xref="CDD:29049"
misc_feature 1186..1188
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2005..2508
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="Apx/Shroom domain ASD1; Region: ASD1; pfam08688"
/db_xref="CDD:149670"
misc_feature 3010..3012
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13796.1); phosphorylation site"
misc_feature 3196..3198
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13796.1); phosphorylation site"
misc_feature 3205..3207
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13796.1); phosphorylation site"
misc_feature 4039..4920
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/note="Apx/Shroom domain ASD2; Region: ASD2; pfam08687"
/db_xref="CDD:204026"
variation 104
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:112679936"
exon 256..407
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 256
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:199860180"
variation 276
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374833426"
variation 278
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201114383"
variation 279
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201633094"
variation 282
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:139542964"
variation 285
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149912209"
variation 287
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:145000598"
variation 298
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:149096987"
variation 312
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201837863"
variation 313
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:142199040"
variation 328
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200846360"
variation 357
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146757558"
variation 399
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:140479341"
exon 408..539
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 431
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:368951794"
variation 447
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:372670795"
variation 462
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:201142240"
variation 480
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200350857"
variation 489
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:6640543"
variation 499
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61739329"
variation 501
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:140977199"
variation 503
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:375673849"
variation 522
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:369952785"
variation 523
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:150231382"
variation 527
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201833019"
exon 540..2880
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 548
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:373986332"
variation 553
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:138886901"
variation 559
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:200610499"
variation 573
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61999277"
variation 579
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:377602826"
variation 589
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:192496291"
variation 657
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:377463965"
variation 678
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:184520696"
variation 693
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374969022"
variation 720
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:147529383"
variation 721
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:138558321"
variation 732
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:144133328"
STS 735..958
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599415"
/db_xref="UniSTS:158145"
variation 745
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:367633047"
variation 772
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:147346721"
variation 784
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:201212186"
variation 813
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:200157143"
variation 823
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:148416024"
variation 852
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:372373323"
variation 853
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:111899727"
STS 870..1025
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="G49443"
/db_xref="UniSTS:109186"
variation 873
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:74461072"
variation 897
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:375430450"
variation 910
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:373429063"
variation 965
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:139545607"
variation 986
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:188033438"
variation 1005
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:372285834"
variation 1076
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149724569"
variation 1094
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:192556048"
variation 1139
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201766478"
variation 1151
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:369354783"
variation 1158
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:199746357"
variation 1175
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:146745184"
variation 1183
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:139392103"
variation 1192
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374781496"
variation 1244
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:368840731"
variation 1254
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:6530341"
variation 1268
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:201195196"
variation 1272
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:377422277"
variation 1282
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149593227"
variation 1283
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:144299681"
STS 1284..1456
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599441"
/db_xref="UniSTS:158152"
variation 1300
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146545805"
variation 1319
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:184636687"
variation 1342
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:369881284"
variation 1347
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:373737070"
variation 1365
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:377633199"
variation 1389
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201743318"
variation 1391
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:149149058"
variation 1399
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:112628472"
variation 1401
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:200302584"
variation 1408
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:151274823"
variation 1428
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:140533569"
variation 1432
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:147084526"
variation 1438
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200380404"
variation 1452
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:375147235"
variation 1507
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61734873"
variation 1516
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:201256775"
variation 1533
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:370272422"
STS 1565..1769
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599465"
/db_xref="UniSTS:158158"
variation 1566
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:374614082"
variation 1568
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:61738461"
variation 1569
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:368967278"
variation 1585
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:144092420"
variation 1603
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146916164"
variation 1616
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:137866742"
variation 1622
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:199877667"
variation 1639
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149459016"
variation 1640
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61744793"
variation 1670
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:148641753"
variation 1679
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:371072821"
variation 1680
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374387368"
variation 1691
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61744807"
STS 1703..1929
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599475"
/db_xref="UniSTS:158160"
variation 1729
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61739685"
variation 1773
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:376118391"
variation 1848
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:371670140"
STS 1879..2105
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599486"
/db_xref="UniSTS:158161"
variation 1879
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374862299"
variation 1905
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:189876719"
variation 1916
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201911751"
variation 1917
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:367727332"
variation 1923
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146235996"
variation 1929
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:371921297"
variation 1952
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:139350587"
variation 1960
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:144144863"
variation 2023
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374898048"
variation 2024
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200488769"
variation 2057
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201141236"
variation 2071
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146519576"
variation 2074
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:370184337"
variation 2075
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:373360048"
variation 2086
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:61733859"
variation 2158
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:139667079"
variation 2185
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:369472774"
variation 2227
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149540115"
variation 2232
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200988135"
STS 2253..2485
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599499"
/db_xref="UniSTS:158164"
variation 2285
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:145727348"
variation 2329
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:61740917"
variation 2401
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:373819870"
variation 2404
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:148949490"
variation 2424
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:147074512"
variation 2435
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200879529"
STS 2440..2613
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599508"
/db_xref="UniSTS:158165"
variation 2440
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:147717742"
variation 2481
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:377485600"
variation 2517
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:142549415"
variation 2543
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:61744804"
STS 2544..2765
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599514"
/db_xref="UniSTS:158166"
variation 2548
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61739700"
variation 2551
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:141610350"
variation 2583
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:150083189"
variation 2585
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:12006769"
variation 2586
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:200542562"
variation 2590
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:141630186"
variation 2607
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:373190071"
variation 2625
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:146225710"
variation 2628
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:137979992"
variation 2648
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:376124648"
variation 2658
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:371590825"
variation 2663
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:73474584"
variation 2664
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:144110998"
variation 2691
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:202190752"
variation 2692
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374462030"
variation 2693
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:148686929"
variation 2701
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:368355034"
variation 2762
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:142235851"
variation 2770
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:370597896"
variation 2771
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201437719"
variation 2783
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:147796126"
variation 2792
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:150824034"
variation 2826
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200547169"
variation 2832
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:139914920"
exon 2881..2981
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 2884
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:61752518"
variation 2900
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:147695083"
variation 2916
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:16985780"
variation 2920
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:375921653"
variation 2947
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:144840238"
variation 2949
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:16985782"
variation 2979
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:61750846"
exon 2982..3677
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 2984
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:372502934"
variation 3002
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:149000944"
variation 3030
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:143842098"
variation 3046
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:199645557"
variation 3115
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:200219705"
variation 3116
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:369591362"
variation 3122
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:148190447"
variation 3124
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201633306"
variation 3125
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:200564339"
variation 3126
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:140239325"
variation 3128
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:145299371"
variation 3139
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201265738"
variation 3155
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:12388875"
variation 3234
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:137947571"
variation 3282
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200123909"
variation 3299
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:142493970"
variation 3300
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:150556964"
variation 3348
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:138615994"
variation 3353
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:61744805"
variation 3361
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:144623135"
variation 3378
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:374276560"
STS 3387..3554
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599536"
/db_xref="UniSTS:158170"
variation 3390
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:139824966"
variation 3392
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:145370363"
variation 3432
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:375527730"
variation 3439
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:369568712"
variation 3578
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:372814254"
variation 3579
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:140797565"
variation 3608
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:370073720"
variation 3619
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200243509"
variation 3623
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:373440832"
variation 3631
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:142364771"
variation 3661
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:151298781"
variation 3676
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:140571503"
exon 3678..4229
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 3685
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:201326634"
variation 3698
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:376695556"
variation 3708
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:150051019"
variation 3715
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:145408951"
variation 3747
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:184423737"
variation 3777
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:140219129"
variation 3787
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:145258676"
variation 3798
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:61185401"
variation 3828
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:200251672"
variation 3846
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:2073945"
variation 3855
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:373880246"
variation 3864
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:7881210"
variation 3881
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:148235958"
variation 3900
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:141261555"
variation 3924
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200401546"
variation 3938
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:199872836"
variation 3944
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:150369562"
STS 3949..4093
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:599551"
/db_xref="UniSTS:158174"
variation 3955
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:200823186"
variation 3961
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:374843987"
variation 3970
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:368647776"
variation 3971
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:372702575"
variation 3978
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:200451659"
variation 4038
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201847453"
variation 4050
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:372131284"
variation 4083
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:375110528"
variation 4084
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:138215112"
variation 4110
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:199742414"
variation 4120
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:143769341"
variation 4131
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:369215971"
variation 4134
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:184617103"
variation 4136
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:201897769"
variation 4170
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201079297"
variation 4195
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:372636460"
exon 4230..4401
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 4237
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:147239057"
variation 4242
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:200100847"
variation 4253
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:200112379"
variation 4274
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:377359384"
variation 4296
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:140758778"
variation 4353
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:370681330"
variation 4364
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:149373874"
variation 4371
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:144736449"
variation 4383
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374770438"
exon 4402..4674
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
variation 4427
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:374474315"
variation 4444
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:201285005"
variation 4445
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:189631774"
variation 4449
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:148547697"
variation 4473
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:61741856"
variation 4498
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:193024785"
variation 4501
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146625316"
variation 4508
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:372130733"
variation 4513
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:12012202"
variation 4525
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201500406"
variation 4554
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:143951833"
variation 4556
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:376434792"
variation 4578
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:369326337"
variation 4605
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:371560341"
variation 4650
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:183701518"
variation 4653
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374782377"
variation 4657
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:146420450"
variation 4673
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:200309657"
exon 4675..7445
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/inference="alignment:Splign:1.39.8"
STS 4706..4930
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="SHROOM2"
/db_xref="UniSTS:506511"
variation 4722
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:200352588"
variation 4731
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:377424861"
variation 4748
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="c"
/db_xref="dbSNP:199608665"
variation 4752
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:140718348"
variation 4756
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:150102691"
variation 4760
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:201047041"
variation 4811
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:370115524"
STS 4831..5049
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="GDB:603631"
/db_xref="UniSTS:158184"
variation 4842
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:374319773"
variation 4870
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:200670691"
variation 4911
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:2073942"
variation 4955
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:368804670"
variation 4980
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:139494419"
variation 4996
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:7057824"
variation 5111
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:145538076"
variation 5129
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:886128"
variation 5152
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:185927412"
variation 5266
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:141116076"
variation 5354
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:188878911"
variation 5471
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:181291636"
variation 5706
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:12010339"
variation 5813
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:1858884"
variation 5884
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:886129"
variation 5953
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:73476659"
variation 5995
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:370283857"
variation 6029
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:374127613"
variation 6059
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:148351641"
variation 6067..6068
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace=""
/replace="ca"
/db_xref="dbSNP:199882707"
STS 6085..6331
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="A007I24"
/db_xref="UniSTS:79357"
STS 6104..6279
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/standard_name="RH18181"
/db_xref="UniSTS:6455"
variation 6147
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:185461645"
variation 6250
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:189880029"
variation 6258
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:182893990"
variation 6259
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:185775419"
variation 6347
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:6640571"
variation 6374
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="t"
/db_xref="dbSNP:369802679"
variation 6527
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:150426398"
variation 6673
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:138353784"
variation 6687
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:192399312"
variation 6781
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:183717132"
variation 6837
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="a"
/replace="g"
/db_xref="dbSNP:17321218"
variation 6880
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:372668813"
variation 7019
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:146066675"
variation 7065
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:187601712"
variation 7100
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="g"
/db_xref="dbSNP:4830680"
variation 7167
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:1061198"
variation 7183
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:139375749"
variation 7202
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace=""
/replace="tg"
/db_xref="dbSNP:71737636"
variation 7249
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="g"
/replace="t"
/db_xref="dbSNP:192135042"
variation 7275
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/replace="c"
/replace="t"
/db_xref="dbSNP:182811535"
polyA_signal 7423..7428
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
polyA_site 7445
/gene="SHROOM2"
/gene_synonym="APXL; HSAPXL"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
tctgcggcgctcggagcctcccttgcgatcccacggccgggactgcccggagtgcatgggcgcgggccagggacgctgagcggtcgcgccatggagggcgccgagccccgcgcgcggcccgagcgcctggccgaggccgagacgcgggcggcggacggcgggcgcctggtggaggtgcagctgagcggcggcgccccgtggggcttcaccctgaagggcggccgcgagcacggcgagccgctggtcatcaccaagattgaagagggcagtaaagccgcggcggtcgacaagttactggctggagatgagatcgtcggcatcaatgacattggtctctcagggtttagacaggaagcgatttgcctggtgaaggggtcccataagaccctgaagctggtcgtcaaaaggaggagcgagctgggctggaggcctcactcctggcatgccaccaagttctctgacagccaccccgagctagcggcctccccattcacctccaccagcggctgtccttcctggtccggccgacaccacgcgagttcttcctcccacgacctgtccagttcctgggagcagacgaacctacagcgcaccttagatcacttcagctccttggggagcgttgacagcctggaccacccctccagtcgcctctcggtggccaagtccaacagcagcatcgaccacctgggcagccacagcaagcgcgactcggcctacggctccttctccaccagctctagcactcctgaccacaccttgtccaaagccgacacgtcctccgcagagaacatcctctacactgtgggcctctgggaggctcccaggcagggtggccggcaggcccaggccgcaggcgaccctcagggctcggaggagaagctcagttgtttcccgcccagggtccccggtgacagcggcaaaggccccaggccagagtacaatgccgagcccaagctggctgcccctgggaggtccaattttgggccagtctggtatgttcccgataagaagaaagcaccatcatccccacctcctccccctccccctctccgcagtgacagctttgctgccaccaagagccacgagaaggcccagggccctgtgttctcagaggcggctgcggcacagcactttacggccctggcccaggctcagcctcgtggtgaccggagaccagagctcaccgatcggccttggaggtcagcacacccggggagcctcgggaagggatcgggaggcccgggctgcccacaggaggcccacgcagacggcagctggccgccctccaaggatggagcttccagtaggctgcaggcctctctgtccagctcagatgtgcgcttccctcagtctcctcatagcggccgacaccctcccctatacagcgaccacagccccctctgtgctgacagccttgggcaggagccaggggctgccagcttccagaacgacagccctcctcaggtgagggggctcagcagctgtgaccagaagctggggagcggctggcagggtccccggccctgtgtgcagggagacctgcaagcagcacagctctgggcgggatgctggccttctgacacagcccttggagccctcgagagtcttcccccacccacggtgggccagagcccacgccatcacctacctcagcctgagggtcctccggatgcccgcgagacaggacggtgttacccgctggacaaaggggccgagggctgctccgcgggagcccaggagcctcccagggccagccgtgcagaaaaagccagccagaggctggcagccagcatcacgtgggcagatggggagagcagcaggatctgcccgcaggagacgcccctgttgcactccctgacccaggaggggaagcgccggcctgagagcagtccagaggacagcgccaccagaccgccaccgttcgacgcccacgtgggcaagcccacccgaagaagcgaccgctttgccaccaccctgcggaatgagatccagatgcatagagccaagctgcagaagagccggagcacagtggctctgactgcagcaggggaggcggaggatggcaccggccgctggagggccgggttgggaggtggcacccaggaaggacccctcgctggcacctataaagaccacctgaaagaggcccaagcccgggtcctgagggccacgtccttcaagcgccgcgacttggaccccaacccaggagacctatacccggagtcactggaacaccggatgggggatccagacactgtcccccacttctgggaggcaggcctggcccagccaccctcatctacaagtggcgggccccacccgccccgcatcggaggccggagacggttcacagctgagcagaaattgaagtcctactcggaacctgagaagatgaacgaggtgggcctcacgaggggctacagtcctcaccagcaccccaggacatctgaggatactgtgggcacgtttgctgacaggtggaagttttttgaggaaacgagcaaacctgttccccagaggcctgcccagaagcaagctcttcacggaatcccgagagacaagccagagaggccgcggacagcgggccgcacatgtgagggcacggagccctggtcgcgcaccacctcccttggggacagcctcaacgctcacagcgcagcggagaaggcagggacttcagacctgccgcggaggctcggcacctttgcagagtatcaggcctcttggaaggaacagaggaaacctctggaggccaggagctctgggcgctgccactcagcggatgacatcctggatgtgagcctggacccacaggagaggccgcagcacgttcatgggaggtcccggtcttcaccgtccacagaccactacaagcaggaagcttctgtcgaactgcgaaggcaggcaggggaccccggcgagcccagagaagagcttccctccgcagtccgggccgaggagggacagtccacgccgagacaagcagatgcccagtgtcgggaaggcagcccaggatcacagcagcacccaccgagtcagaaggcaccgaacccacccacattctctgaactatctcactgccggggagccccagagctgccccgggagggccggggccgagcgggaaccctacctcgagattatagatactcggaggagagcaccccagcagacttgggaccccgagcccagagccctggctcacccctgcatgctcgaggacaagactcgtggccagtgagctcagccctgctctccaagaggccagccccacagaggccaccgccacccaagcgcgagcccaggagatacagggccacagacggcgcacctgctgacgcccccgtgggcgtcctcggcaggcccttcccaacgccatcccctgcgtccctggatgtgtatgtggcccgcctgtccctctcccacagcccctctgtgttcagcagtgcccagccccaggacaccccgaaggccactgtctgtgagcgtggaagccagcatgtgagcggggacgcatcacgtcctctgccagaagcactgctccctcccaagcagcagcacctgcgcctgcagacggccaccatggagacctcgcgctccccctcgccccagttcgccccccagaaactgacggacaaacctcccctgctcatccaggatgaggattcaaccagaattgagcgggtgatggacaacaacaccacggtgaagatggtgcccatcaagatcgtgcactcggagagccagccagagaaggagagccgccagagcctggcatgccccgccgagccacctgccctgccccacgggctggagaaagaccagatcaagacgctgagcacatctgagcagttctactcgcgcttctgtctgtacacgcggcagggtgctgagcccgaggccccacatagggcccagccggctgagccccagcccctgggcacccaggtgccccccgagaaagaccgctgcacctcccctccagggctcagctacatgaaggccaaagagaagactgtggaagacctgaagtcggaggagctggccagggagatcgtggggaaggataagtccctggccgacatcctggatcccagtgtgaagatcaaaaccactatggacttgatggaaggcatcttccccaaagacgagcacctcctggaagaagcccagcaacggaggaagctgctccccaaaatcccctctcctagaagcacagaggagaggaaagaggagcccagcgtgcctgcggccgtgtccctggccaccaattctacctactacagcacgtcggcccccaaggcggagctgctgatcaagatgaaggacctgcaggagcagcaggagcacgaagaggattcgggaagcgacttggaccacgacctgtcggtgaagaagcaggagctcatcgagagcatcagccgcaagctgcaggtgctccgggaggcccgcgagagcctgctggaggacgtgcaggccaacaccgtgctgggggccgaggtggaggccatcgtgaaaggcgtctgcaagcccagcgagtttgacaagttccggatgttcattggagacctggacaaagtggtgaacctcctgctgtcgctgtcaggccgcctggcccgggtggagaatgccctcaataatttggacgacggcgcttctcccggtgatcggcaatcactgcttgagaagcagagagtcctgatccagcagcacgaggacgccaaggagctcaaggagaacctggaccgccgcgagcgcatcgtctttgacattttggccaactatctgagcgaggagagcctcgcggactatgagcacttcgtgaagatgaagtcggccctcatcatcgagcagcgggagctggaagataaaatccaccttggtgaagagcagctgaagtgcttattggacagccttcagcccgaaaggggcaaataagagaccagtccccggtggaggaggggcacggggcctccgagctccagctccgttcccaaggatactcgtgaagaccccatctgtgttcatggcctggaaagagacttctcccatagcaaagaggctgttataaaagcaataacttttgtgtttgtgtgggatgatttatttaattttttagtttcccctttgattgctgagagccattttcctttacacataactacacctgacaccaggctctgctggatgtgagtttccactgcatgggctgtgggctgggcctgtggtgcctgccgagtggtcactgtcagtgggaaacccgttgttcctcccgtcttcagatgctgagccaactgcttggacagcagccagcgcgtcatgacgtgcatgagagggggaccctggtgctcatcttctcttgtcattcatccaggcatgggctgccaggttttgtccctgctcgttcaacagtgtgagcatttgtctctgttatctaatgatgttctctgacccagcagaaatcatcatcatgatgatgataatttattaactttttggaagggtgaatagtttcctaatggttaaaaaccaactgtgaaaggaaccacctgtgtggttgggttcactcattctcagattaaattgccacttaaagaaataacgtgcatgctttaaaaaacacagtcacgcaccaagcaggcaaatagctttagtccttctcacctcacatcacagttgttctgcaaagtaaaattttttggttaagagcgtgtccagtagtaatgtgcttgttagctgtttctcaagaccaacagaagattttttcagttactttccccccatgtattttgtatgcatatgattgtccgtgataattggctacttttccattgtttcctccttaaatcgtttagcatggcatgagggccacattccatggacgggaagaccccttcctcttcagaggtcccgtggactacacagctcctgagcttgatctttttctgccatgaagtttaaagattctatgcccatttccttgattgaaatggcaggattctaaagagagcctggtttgttaaaagaaaacactgtcatgctgtcagttcccaattgacaagtcacagactgggagaaaatatttgcaaatcgtgtatctgacaaaaggtttgtgtccaggatgtacaaagaactctcaaaccggatagtaagaaaacaaacagcccaagtgaaaagcaggcaaaagacttgaatagacacttcaccaaagagcatacacgcgtggcaaacaagcacacgaaaagacgttcagccgccgatggcttggttataatttataacttacttatttttatctaataattgtagattcagtgtatttcttcaaaaaatgtttaattaaatgcatgttaatggtgagtgaatcccttgggtgacttcgtgtttaggtcgtattagggcatttgttggatcaacggatcattttaaccctgacttccccttattcccataaaagaagttttccagtggaatggagatttcattttgtcagcagcagtgaccacagccttaccaaagcagacgcgtgcgcgtgcacagatgcacacacacagatgtcttaaaagactagaatccacacttcctgagccagaggggccgtgttgacggtaatgcattctctatagagccaagtccaaactggcaagctcaatgatgcaggcaataaaccgcctttttggcagcctaccaatgccaaaaggataaatgtctttccaaaagtgtgtattcctgttaaattaagctcttgctaacttgaaaaatccctgttctgccagcgaagcttcctcctcctctccagctggtagtcacttgcgtgaatgctggtcagtctgaaaaggtgaagctggctgtgcacttacccccatctttctccctcggggagacgacccaaggaatttcagagtattttgtttggcagagcttttacctgttattctttgccctcaaatacagtattgtggtcattttgatgatatgtgtgtaaaatgtgaataatccaattggtgtctgtactcagccttttgatgtctttttaggactttctcttctacacagcaatacgtcgtgctcgagtatccttgtagcaaagcacatagagccagctgtcctgtcagttcccctgtttgcctctgaaacgtctggttagtggggacccaaagattctagtgagtcaacatccataactctgtatctagttgtattattcatagaaaatcaatctggtgctaatggttggccctggtgttgttgggtggcagctgctccttcgccctcttgtagtgtggctgtggagggctctgcctatggggggtggcctgtggcttgtatccttcagtccaccacagcaaatgtgtgtagatttcatgctcgacacttaccactcacctatcaacagatcatcctgcttgactgtaacaaaataaatagtgtctcttcaagtg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:357 -> Molecular function: GO:0003779 [actin binding] evidence: ISS
GeneID:357 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:357 -> Molecular function: GO:0008013 [beta-catenin binding] evidence: ISS
GeneID:357 -> Molecular function: GO:0015280 [ligand-gated sodium channel activity] evidence: TAS
GeneID:357 -> Molecular function: GO:0019904 [protein domain specific binding] evidence: IEA
GeneID:357 -> Molecular function: GO:0051015 [actin filament binding] evidence: ISS
GeneID:357 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IDA
GeneID:357 -> Biological process: GO:0000902 [cell morphogenesis] evidence: ISS
GeneID:357 -> Biological process: GO:0002089 [lens morphogenesis in camera-type eye] evidence: ISS
GeneID:357 -> Biological process: GO:0007420 [brain development] evidence: ISS
GeneID:357 -> Biological process: GO:0008057 [eye pigment granule organization] evidence: ISS
GeneID:357 -> Biological process: GO:0016477 [cell migration] evidence: ISS
GeneID:357 -> Biological process: GO:0030835 [negative regulation of actin filament depolymerization] evidence: IEA
GeneID:357 -> Biological process: GO:0032401 [establishment of melanosome localization] evidence: ISS
GeneID:357 -> Biological process: GO:0032438 [melanosome organization] evidence: ISS
GeneID:357 -> Biological process: GO:0043010 [camera-type eye development] evidence: ISS
GeneID:357 -> Biological process: GO:0043482 [cellular pigment accumulation] evidence: ISS
GeneID:357 -> Biological process: GO:0043583 [ear development] evidence: ISS
GeneID:357 -> Biological process: GO:0045176 [apical protein localization] evidence: ISS
GeneID:357 -> Biological process: GO:0045217 [cell-cell junction maintenance] evidence: IEA
GeneID:357 -> Biological process: GO:0048593 [camera-type eye morphogenesis] evidence: ISS
GeneID:357 -> Biological process: GO:0051017 [actin filament bundle assembly] evidence: ISS
GeneID:357 -> Cellular component: GO:0005856 [cytoskeleton] evidence: ISS
GeneID:357 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
GeneID:357 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
GeneID:357 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: ISS
GeneID:357 -> Cellular component: GO:0005923 [tight junction] evidence: ISS
GeneID:357 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: ISS
GeneID:357 -> Cellular component: GO:0030864 [cortical actin cytoskeleton] evidence: IDA
GeneID:357 -> Cellular component: GO:0030864 [cortical actin cytoskeleton] evidence: ISS
GeneID:357 -> Cellular component: GO:0031941 [filamentous actin] evidence: IEA
GeneID:357 -> Cellular component: GO:0043025 [neuronal cell body] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.