2024-04-25 15:00:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001605 3344 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens alanyl-tRNA synthetase (AARS), mRNA. ACCESSION NM_001605 VERSION NM_001605.2 GI:109148541 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3344) AUTHORS Zhao,Z., Hashiguchi,A., Hu,J., Sakiyama,Y., Okamoto,Y., Tokunaga,S., Zhu,L., Shen,H. and Takashima,H. TITLE Alanyl-tRNA synthetase mutation in a family with dominant distal hereditary motor neuropathy JOURNAL Neurology 78 (21), 1644-1649 (2012) PUBMED 22573628 REMARK GeneRIF: in a family with distal hereditary motor neuropathy (dHMN), all 4 affected family members had a heterozygous missense mutation c.2677G>A (p.D893N) of (AARS), not found in the 4 unaffected members and control subjects; conclude AARS mutation caused dHMN in a Chinese family; AARS mutations result in not only a CMT phenotype but also a dHMN phenotype REFERENCE 2 (bases 1 to 3344) AUTHORS McLaughlin,H.M., Sakaguchi,R., Giblin,W., Wilson,T.E., Biesecker,L., Lupski,J.R., Talbot,K., Vance,J.M., Zuchner,S., Lee,Y.C., Kennerson,M., Hou,Y.M., Nicholson,G. and Antonellis,A. CONSRTM NISC Comparative Sequencing Program TITLE A recurrent loss-of-function alanyl-tRNA synthetase (AARS) mutation in patients with Charcot-Marie-Tooth disease type 2N (CMT2N) JOURNAL Hum. Mutat. 33 (1), 244-253 (2012) PUBMED 22009580 REMARK GeneRIF: Methylation-mediated deamination of a CpG dinucleotide gives rise to the recurrent p.Arg329His alanyl-tRNA synthetase mutation in patients with Charcot-Marie-Tooth disease type 2N (CMT2N). REFERENCE 3 (bases 1 to 3344) AUTHORS Gotz,A., Tyynismaa,H., Euro,L., Ellonen,P., Hyotylainen,T., Ojala,T., Hamalainen,R.H., Tommiska,J., Raivio,T., Oresic,M., Karikoski,R., Tammela,O., Simola,K.O., Paetau,A., Tyni,T. and Suomalainen,A. TITLE Exome sequencing identifies mitochondrial alanyl-tRNA synthetase mutations in infantile mitochondrial cardiomyopathy JOURNAL Am. J. Hum. Genet. 88 (5), 635-642 (2011) PUBMED 21549344 REMARK GeneRIF: We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. REFERENCE 4 (bases 1 to 3344) AUTHORS Latour,P., Thauvin-Robinet,C., Baudelet-Mery,C., Soichot,P., Cusin,V., Faivre,L., Locatelli,M.C., Mayencon,M., Sarcey,A., Broussolle,E., Camu,W., David,A. and Rousson,R. TITLE A major determinant for binding and aminoacylation of tRNA(Ala) in cytoplasmic Alanyl-tRNA synthetase is mutated in dominant axonal Charcot-Marie-Tooth disease JOURNAL Am. J. Hum. Genet. 86 (1), 77-82 (2010) PUBMED 20045102 REMARK GeneRIF: cytoplasmic Alanyl-tRNA synthetase may have a role in dominant axonal Charcot-Marie-Tooth disease, as shown by its mutation in a major determinant for binding and aminoacylation REFERENCE 5 (bases 1 to 3344) AUTHORS Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A. TITLE A germline-specific class of small RNAs binds mammalian Piwi proteins JOURNAL Nature 442 (7099), 199-202 (2006) PUBMED 16751776 REFERENCE 6 (bases 1 to 3344) AUTHORS Nichols,R.C., Pai,S.I., Ge,Q., Targoff,I.N., Plotz,P.H. and Liu,P. TITLE Localization of two human autoantigen genes by PCR screening and in situ hybridization--glycyl-tRNA synthetase locates to 7p15 and alanyl-tRNA synthetase locates to 16q22 JOURNAL Genomics 30 (1), 131-132 (1995) PUBMED 8595897 REFERENCE 7 (bases 1 to 3344) AUTHORS Shiba,K., Ripmaster,T., Suzuki,N., Nichols,R., Plotz,P., Noda,T. and Schimmel,P. TITLE Human alanyl-tRNA synthetase: conservation in evolution of catalytic core and microhelix recognition JOURNAL Biochemistry 34 (33), 10340-10349 (1995) PUBMED 7654687 REFERENCE 8 (bases 1 to 3344) AUTHORS Ripmaster,T.L., Shiba,K. and Schimmel,P. TITLE Wide cross-species aminoacyl-tRNA synthetase replacement in vivo: yeast cytoplasmic alanine enzyme replaced by human polymyositis serum antigen JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (11), 4932-4936 (1995) PUBMED 7761427 REFERENCE 9 (bases 1 to 3344) AUTHORS Matoba,R., Okubo,K., Hori,N., Fukushima,A. and Matsubara,K. TITLE The addition of 5'-coding information to a 3'-directed cDNA library improves analysis of gene expression JOURNAL Gene 146 (2), 199-207 (1994) PUBMED 8076819 REFERENCE 10 (bases 1 to 3344) AUTHORS Francklyn,C. and Schimmel,P. TITLE Aminoacylation of RNA minihelices with alanine JOURNAL Nature 337 (6206), 478-481 (1989) PUBMED 2915692 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from D32050.1, BC011451.1, BG764123.1 and BU178772.1. This sequence is a reference standard in the RefSeqGene project. On Jun 15, 2006 this sequence version replaced gi:4501840. Summary: The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: D32050.1, AK222824.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-355 D32050.1 1-355 356-1012 BC011451.1 288-944 1013-1581 BG764123.1 9-577 1582-2824 BC011451.1 1514-2756 2825-3344 BU178772.1 234-753 FEATURES Location/Qualifiers source 1..3344 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="16" /map="16q22" gene 1..3344 /gene="AARS" /gene_synonym="CMT2N" /note="alanyl-tRNA synthetase" /db_xref="GeneID:16" /db_xref="HGNC:20" /db_xref="MIM:601065" exon 1..89 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 90..254 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" CDS 111..3017 /gene="AARS" /gene_synonym="CMT2N" /EC_number="6.1.1.7" /note="alanine tRNA ligase 1, cytoplasmic; alanyl-tRNA synthetase, cytoplasmic; alaRS; renal carcinoma antigen NY-REN-42" /codon_start=1 /product="alanine--tRNA ligase, cytoplasmic" /protein_id="NP_001596.2" /db_xref="GI:109148542" /db_xref="CCDS:CCDS32474.1" /db_xref="GeneID:16" /db_xref="HGNC:20" /db_xref="MIM:601065" /translation="
MDSTLTASEIRQRFIDFFKRNEHTYVHSSATIPLDDPTLLFANAGMNQFKPIFLNTIDPSHPMAKLSRAANTQKCIRAGGKHNDLDDVGKDVYHHTFFEMLGSWSFGDYFKELACKMALELLTQEFGIPIERLYVTYFGGDEAAGLEADLECKQIWQNLGLDDTKILPGNMKDNFWEMGDTGPCGPCSEIHYDRIGGRDAAHLVNQDDPNVLEIWNLVFIQYNREADGILKPLPKKSIDTGMGLERLVSVLQNKMSNYDTDLFVPYFEAIQKGTGARPYTGKVGAEDADGIDMAYRVLADHARTITVALADGGRPDNTGRGYVLRRILRRAVRYAHEKLNASRGFFATLVDVVVQSLGDAFPELKKDPDMVKDIINEEEVQFLKTLSRGRRILDRKIQSLGDSKTIPGDTAWLLYDTYGFPVDLTGLIAEEKGLVVDMDGFEEERKLAQLKSQGKGAGGEDLIMLDIYAIEELRARGLEVTDDSPKYNYHLDSSGSYVFENTVATVMALRREKMFVEEVSTGQECGVVLDKTCFYAEQGGQIYDEGYLVKVDDSSEDKTEFTVKNAQVRGGYVLHIGTIYGDLKVGDQVWLFIDEPRRRPIMSNHTATHILNFALRSVLGEADQKGSLVAPDRLRFDFTAKGAMSTQQIKKAEEIANEMIEAAKAVYTQDCPLAAAKAIQGLRAVFDETYPDPVRVVSIGVPVSELLDDPSGPAGSLTSVEFCGGTHLRNSSHAGAFVIVTEEAIAKGIRRIVAVTGAEAQKALRKAESLKKCLSVMEAKVKAQTAPNKDVQREIADLGEALATAVIPQWQKDELRETLKSLKKVMDDLDRASKADVQKRVLEKTKQFIDSNPNQPLVILEMESGASAKALNEALKLFKMHSPQTSAMLFTVDNEAGKITCLCQVPQNAANRGLKASEWVQQVSGLMDGKGGGKDVSAQATGKNVGCLQEALQLATSFAQLRLGDVKN
" misc_feature 111..113 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="N-acetylmethionine; propagated from UniProtKB/Swiss-Prot (P49588.2); acetylation site" misc_feature 126..2993 /gene="AARS" /gene_synonym="CMT2N" /note="alanyl-tRNA synthetase; Region: PLN02900" /db_xref="CDD:178488" misc_feature 129..872 /gene="AARS" /gene_synonym="CMT2N" /note="Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent formation of...; Region: AlaRS_core; cd00673" /db_xref="CDD:29811" misc_feature 165..167 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (P49588.2); acetylation site" misc_feature 183..197 /gene="AARS" /gene_synonym="CMT2N" /note="motif 1; other site" /db_xref="CDD:29811" misc_feature order(264..266,270..272,339..341,402..404,408..410, 414..422,747..752,762..764,819..824,834..839,846..848) /gene="AARS" /gene_synonym="CMT2N" /note="active site" /db_xref="CDD:29811" misc_feature 336..344 /gene="AARS" /gene_synonym="CMT2N" /note="motif 2; other site" /db_xref="CDD:29811" misc_feature 831..848 /gene="AARS" /gene_synonym="CMT2N" /note="motif 3; other site" /db_xref="CDD:29811" misc_feature 1305..1307 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P49588.2); phosphorylation site" misc_feature <1572..1703 /gene="AARS" /gene_synonym="CMT2N" /note="Translation_Factor_II_like: Elongation factor Tu (EF-Tu) domain II-like proteins. Elongation factor Tu consists of three structural domains, this family represents the second domain. Domain II adopts a beta barrel structure and is involved in binding to...; Region: Translation_Factor_II_like; cl02787" /db_xref="CDD:207732" misc_feature 1773..1775 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P49588.2); phosphorylation site" misc_feature 1842..1844 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1848..1850 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2190..2369 /gene="AARS" /gene_synonym="CMT2N" /note="Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973" /db_xref="CDD:203824" misc_feature 2736..2738 /gene="AARS" /gene_synonym="CMT2N" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (P49588.2); acetylation site" misc_feature 2766..2975 /gene="AARS" /gene_synonym="CMT2N" /note="DHHA1 domain; Region: DHHA1; pfam02272" /db_xref="CDD:202185" exon 255..443 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" STS 268..396 /gene="AARS" /gene_synonym="CMT2N" /standard_name="RH65736" /db_xref="UniSTS:75263" exon 444..589 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 590..781 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 680 /gene="AARS" /gene_synonym="CMT2N" /replace="c" /replace="g" /db_xref="dbSNP:34306553" exon 782..926 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 927..1072 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 934 /gene="AARS" /gene_synonym="CMT2N" /replace="a" /replace="g" /db_xref="dbSNP:11537667" variation 950..951 /gene="AARS" /gene_synonym="CMT2N" /replace="" /replace="g" /db_xref="dbSNP:34296479" variation 1013 /gene="AARS" /gene_synonym="CMT2N" /replace="c" /replace="t" /db_xref="dbSNP:2070203" exon 1073..1181 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 1182..1332 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 1185 /gene="AARS" /gene_synonym="CMT2N" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1130535" exon 1333..1457 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 1458..1602 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 1603..1781 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 1782..1895 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 1896..2102 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" STS 2030..2206 /gene="AARS" /gene_synonym="CMT2N" /standard_name="RH66606" /db_xref="UniSTS:19748" exon 2103..2287 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 2288..2396 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 2397..2510 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 2432 /gene="AARS" /gene_synonym="CMT2N" /replace="c" /replace="g" /db_xref="dbSNP:35769308" exon 2511..2630 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 2631..2717 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 2702 /gene="AARS" /gene_synonym="CMT2N" /replace="c" /replace="t" /db_xref="dbSNP:11537665" exon 2718..2831 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" exon 2832..3344 /gene="AARS" /gene_synonym="CMT2N" /inference="alignment:Splign:1.39.8" variation 3010 /gene="AARS" /gene_synonym="CMT2N" /replace="a" /replace="t" /db_xref="dbSNP:35744709" STS 3128..3270 /gene="AARS" /gene_synonym="CMT2N" /standard_name="A002L29" /db_xref="UniSTS:35285" variation 3181 /gene="AARS" /gene_synonym="CMT2N" /replace="c" /replace="t" /db_xref="dbSNP:1049384" polyA_signal 3327..3332 /gene="AARS" /gene_synonym="CMT2N" ORIGIN
ggtacagctgcgcgtctgcgggaataggtgcagcgggcccttggcgggggactctgagggaggagctggggacggcgaccctaggagagttctttggggtgactttcaagatggactctactctaacagcaagtgaaatccggcagcgatttatagatttcttcaagaggaacgagcatacgtatgttcactcgtctgccaccatcccattggatgaccccactttgctctttgccaatgcaggcatgaaccagtttaaacccattttcctgaacacaattgacccatctcaccccatggcaaagctgagcagagctgccaatacccagaagtgcatccgggctgggggcaaacataatgacctggacgatgtgggcaaggatgtctatcatcacaccttcttcgagatgctgggctcttggtcttttggagattactttaaggaattggcatgtaagatggctctggaactcctcacccaagagtttggcattcccattgaaagactttatgttacttactttggcggggatgaagcagctggcttagaagcagatctggaatgcaaacagatctggcaaaatttggggctggatgacaccaaaatcctcccaggcaacatgaaggataacttctgggagatgggtgacacgggcccctgtggtccttgcagtgagatccactacgaccggattggtggtcgggacgccgcacatcttgtcaaccaggacgaccctaatgtgctggagatctggaaccttgtgttcatccagtataacagggaagctgatggcattctgaaacctcttcccaagaaaagcattgacacagggatgggcctggaacgactggtatctgtgctgcagaataagatgtccaactatgacactgacctttttgtcccttactttgaagccattcagaagggcacaggtgcccgaccatacactgggaaagttggtgctgaggatgccgatgggattgacatggcctaccgggtgctggctgaccacgctcggaccatcactgtggcactggctgatggtggccggcctgacaacacagggcgtggatatgtgttgagacggattctccgccgagctgtccgatacgcccatgaaaagctcaatgccagcaggggcttctttgctacgttagtggatgttgtcgtccagtccctgggagatgcatttcctgagctgaagaaggacccagacatggtgaaggacatcattaatgaagaagaggtgcagtttctcaagactctcagcagagggcgtcgcatcctggacaggaaaattcagagcctgggagacagcaagaccattcccggagacactgcttggctcctctatgacacctatgggtttccagtggatctgactggactgattgctgaagagaagggcctggtggtagacatggatggctttgaagaggagaggaaactggcccagctgaaatcacagggcaagggagctggtggggaagacctcattatgctggacatttacgctatcgaagagctccgggcacggggtctggaggtcacagatgattccccaaagtacaattaccatttggactccagtggtagctatgtatttgagaacacagtggctacggtgatggctctgcgcagggagaagatgttcgtggaagaggtgtccacaggccaggagtgtggagtggtgctggacaagacctgtttctatgctgagcaaggaggccagatctatgacgaaggctacctggtgaaggtggatgacagcagtgaagataaaacagagtttacagtgaagaatgctcaggtccgaggagggtatgtgctacacattggaaccatctacggtgacctgaaagtgggggatcaggtctggctgtttattgatgagccccgacgaagacccatcatgagcaaccacacagctacgcacattctgaacttcgccctgcgctcagtgcttggggaagctgaccagaaaggctcattggttgctcctgaccgcctcagatttgactttactgccaagggagccatgtccacccaacagatcaagaaggctgaagagattgctaatgagatgattgaggcagccaaggccgtctatacccaggattgccccctggcagcagcgaaagccatccagggcctacgggctgtgtttgatgagacctatcctgaccctgtgcgagtcgtctccattggggtcccggtgtccgagttgctggatgacccctctgggcctgctggctccctgacttctgttgagttctgtgggggaacgcacctgcggaactcgagtcatgcaggagcttttgtgatcgtgacggaagaagccattgccaagggtatccggaggattgtggctgtcacaggtgccgaggcccagaaggccctcaggaaagcagagagcttgaagaaatgtctctctgtcatggaagccaaagtgaaggctcagactgctccaaacaaggatgtgcagagggagatcgctgaccttggagaggccctggccactgcagtcatcccccagtggcagaaggatgaattgcgggagactctcaaatccctaaagaaggtcatggatgacttggaccgagccagcaaagccgatgtccagaaacgagtgttagagaagacgaagcagttcatcgacagcaaccccaaccagcctcttgtcatcctggagatggagagcggcgcctcagccaaggccctgaatgaagccttgaagctcttcaagatgcactcccctcagacttctgccatgctcttcacggtggacaatgaggctggcaagatcacgtgcctgtgtcaagttccccagaatgcagccaatcggggcttaaaagccagcgagtgggtgcagcaggtgtcaggcttgatggacggtaaaggtggtggcaaggatgtgtctgcacaggccacaggcaagaacgttggctgcctgcaggaggcgctgcagctggccacttccttcgcccagctgcgcctcggggatgtaaagaactgagtggggaaggaggaggctcccactggatccatccgtccagccaagagctcttcatctgctacaagaacatttgaatcttgggacctttaaagagcccctcctaacccagcagtaactggaacacacttgggagcagtcctatgtctcagtgccccttaaatttctgccctgagccctccacgtcagtgccatcggtctagaaccactaaccccgcattgctgttgatcgtcacgctcgcatctatagataacggctctccagacctgagctttccgcgtcagcaagtaggaatcgtttttgctgcagagaataaaaggaccacgtgc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:16 -> Molecular function: GO:0000049 [tRNA binding] evidence: IEA GeneID:16 -> Molecular function: GO:0002161 [aminoacyl-tRNA editing activity] evidence: IEA GeneID:16 -> Molecular function: GO:0004813 [alanine-tRNA ligase activity] evidence: IEA GeneID:16 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:16 -> Molecular function: GO:0016597 [amino acid binding] evidence: IEA GeneID:16 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA GeneID:16 -> Biological process: GO:0001942 [hair follicle development] evidence: IEA GeneID:16 -> Biological process: GO:0006400 [tRNA modification] evidence: IEA GeneID:16 -> Biological process: GO:0006418 [tRNA aminoacylation for protein translation] evidence: TAS GeneID:16 -> Biological process: GO:0006419 [alanyl-tRNA aminoacylation] evidence: IEA GeneID:16 -> Biological process: GO:0006457 [protein folding] evidence: IEA GeneID:16 -> Biological process: GO:0008033 [tRNA processing] evidence: TAS GeneID:16 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:16 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA GeneID:16 -> Biological process: GO:0030968 [endoplasmic reticulum unfolded protein response] evidence: IEA GeneID:16 -> Biological process: GO:0043200 [response to amino acid stimulus] evidence: IEA GeneID:16 -> Biological process: GO:0043524 [negative regulation of neuron apoptotic process] evidence: IEA GeneID:16 -> Biological process: GO:0050885 [neuromuscular process controlling balance] evidence: IEA GeneID:16 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS GeneID:16 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001596 -> EC 6.1.1.7
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.