Home |
Help |
Advanced search
2024-04-20 08:13:33, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001605 3344 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens alanyl-tRNA synthetase (AARS), mRNA.
ACCESSION NM_001605
VERSION NM_001605.2 GI:109148541
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3344)
AUTHORS Zhao,Z., Hashiguchi,A., Hu,J., Sakiyama,Y., Okamoto,Y.,
Tokunaga,S., Zhu,L., Shen,H. and Takashima,H.
TITLE Alanyl-tRNA synthetase mutation in a family with dominant distal
hereditary motor neuropathy
JOURNAL Neurology 78 (21), 1644-1649 (2012)
PUBMED 22573628
REMARK GeneRIF: in a family with distal hereditary motor neuropathy
(dHMN), all 4 affected family members had a heterozygous missense
mutation c.2677G>A (p.D893N) of (AARS), not found in the 4
unaffected members and control subjects; conclude AARS mutation
caused dHMN in a Chinese family; AARS mutations result in not only
a CMT phenotype but also a dHMN phenotype
REFERENCE 2 (bases 1 to 3344)
AUTHORS McLaughlin,H.M., Sakaguchi,R., Giblin,W., Wilson,T.E.,
Biesecker,L., Lupski,J.R., Talbot,K., Vance,J.M., Zuchner,S.,
Lee,Y.C., Kennerson,M., Hou,Y.M., Nicholson,G. and Antonellis,A.
CONSRTM NISC Comparative Sequencing Program
TITLE A recurrent loss-of-function alanyl-tRNA synthetase (AARS) mutation
in patients with Charcot-Marie-Tooth disease type 2N (CMT2N)
JOURNAL Hum. Mutat. 33 (1), 244-253 (2012)
PUBMED 22009580
REMARK GeneRIF: Methylation-mediated deamination of a CpG dinucleotide
gives rise to the recurrent p.Arg329His alanyl-tRNA synthetase
mutation in patients with Charcot-Marie-Tooth disease type 2N
(CMT2N).
REFERENCE 3 (bases 1 to 3344)
AUTHORS Gotz,A., Tyynismaa,H., Euro,L., Ellonen,P., Hyotylainen,T.,
Ojala,T., Hamalainen,R.H., Tommiska,J., Raivio,T., Oresic,M.,
Karikoski,R., Tammela,O., Simola,K.O., Paetau,A., Tyni,T. and
Suomalainen,A.
TITLE Exome sequencing identifies mitochondrial alanyl-tRNA synthetase
mutations in infantile mitochondrial cardiomyopathy
JOURNAL Am. J. Hum. Genet. 88 (5), 635-642 (2011)
PUBMED 21549344
REMARK GeneRIF: We show here that mutations in AARS2 cause perinatal or
infantile cardiomyopathy with near-total combined mitochondrial
respiratory chain deficiency in the heart.
REFERENCE 4 (bases 1 to 3344)
AUTHORS Latour,P., Thauvin-Robinet,C., Baudelet-Mery,C., Soichot,P.,
Cusin,V., Faivre,L., Locatelli,M.C., Mayencon,M., Sarcey,A.,
Broussolle,E., Camu,W., David,A. and Rousson,R.
TITLE A major determinant for binding and aminoacylation of tRNA(Ala) in
cytoplasmic Alanyl-tRNA synthetase is mutated in dominant axonal
Charcot-Marie-Tooth disease
JOURNAL Am. J. Hum. Genet. 86 (1), 77-82 (2010)
PUBMED 20045102
REMARK GeneRIF: cytoplasmic Alanyl-tRNA synthetase may have a role in
dominant axonal Charcot-Marie-Tooth disease, as shown by its
mutation in a major determinant for binding and aminoacylation
REFERENCE 5 (bases 1 to 3344)
AUTHORS Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A.
TITLE A germline-specific class of small RNAs binds mammalian Piwi
proteins
JOURNAL Nature 442 (7099), 199-202 (2006)
PUBMED 16751776
REFERENCE 6 (bases 1 to 3344)
AUTHORS Nichols,R.C., Pai,S.I., Ge,Q., Targoff,I.N., Plotz,P.H. and Liu,P.
TITLE Localization of two human autoantigen genes by PCR screening and in
situ hybridization--glycyl-tRNA synthetase locates to 7p15 and
alanyl-tRNA synthetase locates to 16q22
JOURNAL Genomics 30 (1), 131-132 (1995)
PUBMED 8595897
REFERENCE 7 (bases 1 to 3344)
AUTHORS Shiba,K., Ripmaster,T., Suzuki,N., Nichols,R., Plotz,P., Noda,T.
and Schimmel,P.
TITLE Human alanyl-tRNA synthetase: conservation in evolution of
catalytic core and microhelix recognition
JOURNAL Biochemistry 34 (33), 10340-10349 (1995)
PUBMED 7654687
REFERENCE 8 (bases 1 to 3344)
AUTHORS Ripmaster,T.L., Shiba,K. and Schimmel,P.
TITLE Wide cross-species aminoacyl-tRNA synthetase replacement in vivo:
yeast cytoplasmic alanine enzyme replaced by human polymyositis
serum antigen
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (11), 4932-4936 (1995)
PUBMED 7761427
REFERENCE 9 (bases 1 to 3344)
AUTHORS Matoba,R., Okubo,K., Hori,N., Fukushima,A. and Matsubara,K.
TITLE The addition of 5'-coding information to a 3'-directed cDNA library
improves analysis of gene expression
JOURNAL Gene 146 (2), 199-207 (1994)
PUBMED 8076819
REFERENCE 10 (bases 1 to 3344)
AUTHORS Francklyn,C. and Schimmel,P.
TITLE Aminoacylation of RNA minihelices with alanine
JOURNAL Nature 337 (6206), 478-481 (1989)
PUBMED 2915692
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from D32050.1, BC011451.1,
BG764123.1 and BU178772.1.
This sequence is a reference standard in the RefSeqGene project.
On Jun 15, 2006 this sequence version replaced gi:4501840.
Summary: The human alanyl-tRNA synthetase (AARS) belongs to a
family of tRNA synthases, of the class II enzymes. Class II tRNA
synthases evolved early in evolution and are highly conserved.
This is reflected by the fact that 498 of the 968-residue
polypeptide human AARS shares 41% identity witht the E.coli
protein. tRNA synthases are the enzymes that interpret the RNA
code and attach specific aminoacids to the tRNAs that contain the
cognate trinucleotide anticodons. They consist of a catalytic
domain which interacts with the amino acid acceptor-T psi C helix
of the tRNA, and a second domain which interacts with the rest of
the tRNA structure. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: D32050.1, AK222824.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-355 D32050.1 1-355
356-1012 BC011451.1 288-944
1013-1581 BG764123.1 9-577
1582-2824 BC011451.1 1514-2756
2825-3344 BU178772.1 234-753
FEATURES Location/Qualifiers
source 1..3344
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="16"
/map="16q22"
gene 1..3344
/gene="AARS"
/gene_synonym="CMT2N"
/note="alanyl-tRNA synthetase"
/db_xref="GeneID:16"
/db_xref="HGNC:20"
/db_xref="MIM:601065"
exon 1..89
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 90..254
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
CDS 111..3017
/gene="AARS"
/gene_synonym="CMT2N"
/EC_number="6.1.1.7"
/note="alanine tRNA ligase 1, cytoplasmic; alanyl-tRNA
synthetase, cytoplasmic; alaRS; renal carcinoma antigen
NY-REN-42"
/codon_start=1
/product="alanine--tRNA ligase, cytoplasmic"
/protein_id="NP_001596.2"
/db_xref="GI:109148542"
/db_xref="CCDS:CCDS32474.1"
/db_xref="GeneID:16"
/db_xref="HGNC:20"
/db_xref="MIM:601065"
/translation="
MDSTLTASEIRQRFIDFFKRNEHTYVHSSATIPLDDPTLLFANAGMNQFKPIFLNTIDPSHPMAKLSRAANTQKCIRAGGKHNDLDDVGKDVYHHTFFEMLGSWSFGDYFKELACKMALELLTQEFGIPIERLYVTYFGGDEAAGLEADLECKQIWQNLGLDDTKILPGNMKDNFWEMGDTGPCGPCSEIHYDRIGGRDAAHLVNQDDPNVLEIWNLVFIQYNREADGILKPLPKKSIDTGMGLERLVSVLQNKMSNYDTDLFVPYFEAIQKGTGARPYTGKVGAEDADGIDMAYRVLADHARTITVALADGGRPDNTGRGYVLRRILRRAVRYAHEKLNASRGFFATLVDVVVQSLGDAFPELKKDPDMVKDIINEEEVQFLKTLSRGRRILDRKIQSLGDSKTIPGDTAWLLYDTYGFPVDLTGLIAEEKGLVVDMDGFEEERKLAQLKSQGKGAGGEDLIMLDIYAIEELRARGLEVTDDSPKYNYHLDSSGSYVFENTVATVMALRREKMFVEEVSTGQECGVVLDKTCFYAEQGGQIYDEGYLVKVDDSSEDKTEFTVKNAQVRGGYVLHIGTIYGDLKVGDQVWLFIDEPRRRPIMSNHTATHILNFALRSVLGEADQKGSLVAPDRLRFDFTAKGAMSTQQIKKAEEIANEMIEAAKAVYTQDCPLAAAKAIQGLRAVFDETYPDPVRVVSIGVPVSELLDDPSGPAGSLTSVEFCGGTHLRNSSHAGAFVIVTEEAIAKGIRRIVAVTGAEAQKALRKAESLKKCLSVMEAKVKAQTAPNKDVQREIADLGEALATAVIPQWQKDELRETLKSLKKVMDDLDRASKADVQKRVLEKTKQFIDSNPNQPLVILEMESGASAKALNEALKLFKMHSPQTSAMLFTVDNEAGKITCLCQVPQNAANRGLKASEWVQQVSGLMDGKGGGKDVSAQATGKNVGCLQEALQLATSFAQLRLGDVKN
"
misc_feature 111..113
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P49588.2); acetylation site"
misc_feature 126..2993
/gene="AARS"
/gene_synonym="CMT2N"
/note="alanyl-tRNA synthetase; Region: PLN02900"
/db_xref="CDD:178488"
misc_feature 129..872
/gene="AARS"
/gene_synonym="CMT2N"
/note="Alanyl-tRNA synthetase (AlaRS) class II core
catalytic domain. AlaRS is a homodimer. It is responsible
for the attachment of alanine to the 3' OH group of ribose
of the appropriate tRNA. This domain is primarily
responsible for ATP-dependent formation of...; Region:
AlaRS_core; cd00673"
/db_xref="CDD:29811"
misc_feature 165..167
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P49588.2); acetylation site"
misc_feature 183..197
/gene="AARS"
/gene_synonym="CMT2N"
/note="motif 1; other site"
/db_xref="CDD:29811"
misc_feature order(264..266,270..272,339..341,402..404,408..410,
414..422,747..752,762..764,819..824,834..839,846..848)
/gene="AARS"
/gene_synonym="CMT2N"
/note="active site"
/db_xref="CDD:29811"
misc_feature 336..344
/gene="AARS"
/gene_synonym="CMT2N"
/note="motif 2; other site"
/db_xref="CDD:29811"
misc_feature 831..848
/gene="AARS"
/gene_synonym="CMT2N"
/note="motif 3; other site"
/db_xref="CDD:29811"
misc_feature 1305..1307
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P49588.2); phosphorylation site"
misc_feature <1572..1703
/gene="AARS"
/gene_synonym="CMT2N"
/note="Translation_Factor_II_like: Elongation factor Tu
(EF-Tu) domain II-like proteins. Elongation factor Tu
consists of three structural domains, this family
represents the second domain. Domain II adopts a beta
barrel structure and is involved in binding to...; Region:
Translation_Factor_II_like; cl02787"
/db_xref="CDD:207732"
misc_feature 1773..1775
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P49588.2); phosphorylation site"
misc_feature 1842..1844
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1848..1850
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2190..2369
/gene="AARS"
/gene_synonym="CMT2N"
/note="Threonyl and Alanyl tRNA synthetase second
additional domain; Region: tRNA_SAD; pfam07973"
/db_xref="CDD:203824"
misc_feature 2736..2738
/gene="AARS"
/gene_synonym="CMT2N"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P49588.2); acetylation site"
misc_feature 2766..2975
/gene="AARS"
/gene_synonym="CMT2N"
/note="DHHA1 domain; Region: DHHA1; pfam02272"
/db_xref="CDD:202185"
exon 255..443
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
STS 268..396
/gene="AARS"
/gene_synonym="CMT2N"
/standard_name="RH65736"
/db_xref="UniSTS:75263"
exon 444..589
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 590..781
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 680
/gene="AARS"
/gene_synonym="CMT2N"
/replace="c"
/replace="g"
/db_xref="dbSNP:34306553"
exon 782..926
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 927..1072
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 934
/gene="AARS"
/gene_synonym="CMT2N"
/replace="a"
/replace="g"
/db_xref="dbSNP:11537667"
variation 950..951
/gene="AARS"
/gene_synonym="CMT2N"
/replace=""
/replace="g"
/db_xref="dbSNP:34296479"
variation 1013
/gene="AARS"
/gene_synonym="CMT2N"
/replace="c"
/replace="t"
/db_xref="dbSNP:2070203"
exon 1073..1181
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 1182..1332
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 1185
/gene="AARS"
/gene_synonym="CMT2N"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1130535"
exon 1333..1457
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 1458..1602
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 1603..1781
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 1782..1895
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 1896..2102
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
STS 2030..2206
/gene="AARS"
/gene_synonym="CMT2N"
/standard_name="RH66606"
/db_xref="UniSTS:19748"
exon 2103..2287
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 2288..2396
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 2397..2510
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 2432
/gene="AARS"
/gene_synonym="CMT2N"
/replace="c"
/replace="g"
/db_xref="dbSNP:35769308"
exon 2511..2630
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 2631..2717
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 2702
/gene="AARS"
/gene_synonym="CMT2N"
/replace="c"
/replace="t"
/db_xref="dbSNP:11537665"
exon 2718..2831
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
exon 2832..3344
/gene="AARS"
/gene_synonym="CMT2N"
/inference="alignment:Splign:1.39.8"
variation 3010
/gene="AARS"
/gene_synonym="CMT2N"
/replace="a"
/replace="t"
/db_xref="dbSNP:35744709"
STS 3128..3270
/gene="AARS"
/gene_synonym="CMT2N"
/standard_name="A002L29"
/db_xref="UniSTS:35285"
variation 3181
/gene="AARS"
/gene_synonym="CMT2N"
/replace="c"
/replace="t"
/db_xref="dbSNP:1049384"
polyA_signal 3327..3332
/gene="AARS"
/gene_synonym="CMT2N"
ORIGIN
ggtacagctgcgcgtctgcgggaataggtgcagcgggcccttggcgggggactctgagggaggagctggggacggcgaccctaggagagttctttggggtgactttcaagatggactctactctaacagcaagtgaaatccggcagcgatttatagatttcttcaagaggaacgagcatacgtatgttcactcgtctgccaccatcccattggatgaccccactttgctctttgccaatgcaggcatgaaccagtttaaacccattttcctgaacacaattgacccatctcaccccatggcaaagctgagcagagctgccaatacccagaagtgcatccgggctgggggcaaacataatgacctggacgatgtgggcaaggatgtctatcatcacaccttcttcgagatgctgggctcttggtcttttggagattactttaaggaattggcatgtaagatggctctggaactcctcacccaagagtttggcattcccattgaaagactttatgttacttactttggcggggatgaagcagctggcttagaagcagatctggaatgcaaacagatctggcaaaatttggggctggatgacaccaaaatcctcccaggcaacatgaaggataacttctgggagatgggtgacacgggcccctgtggtccttgcagtgagatccactacgaccggattggtggtcgggacgccgcacatcttgtcaaccaggacgaccctaatgtgctggagatctggaaccttgtgttcatccagtataacagggaagctgatggcattctgaaacctcttcccaagaaaagcattgacacagggatgggcctggaacgactggtatctgtgctgcagaataagatgtccaactatgacactgacctttttgtcccttactttgaagccattcagaagggcacaggtgcccgaccatacactgggaaagttggtgctgaggatgccgatgggattgacatggcctaccgggtgctggctgaccacgctcggaccatcactgtggcactggctgatggtggccggcctgacaacacagggcgtggatatgtgttgagacggattctccgccgagctgtccgatacgcccatgaaaagctcaatgccagcaggggcttctttgctacgttagtggatgttgtcgtccagtccctgggagatgcatttcctgagctgaagaaggacccagacatggtgaaggacatcattaatgaagaagaggtgcagtttctcaagactctcagcagagggcgtcgcatcctggacaggaaaattcagagcctgggagacagcaagaccattcccggagacactgcttggctcctctatgacacctatgggtttccagtggatctgactggactgattgctgaagagaagggcctggtggtagacatggatggctttgaagaggagaggaaactggcccagctgaaatcacagggcaagggagctggtggggaagacctcattatgctggacatttacgctatcgaagagctccgggcacggggtctggaggtcacagatgattccccaaagtacaattaccatttggactccagtggtagctatgtatttgagaacacagtggctacggtgatggctctgcgcagggagaagatgttcgtggaagaggtgtccacaggccaggagtgtggagtggtgctggacaagacctgtttctatgctgagcaaggaggccagatctatgacgaaggctacctggtgaaggtggatgacagcagtgaagataaaacagagtttacagtgaagaatgctcaggtccgaggagggtatgtgctacacattggaaccatctacggtgacctgaaagtgggggatcaggtctggctgtttattgatgagccccgacgaagacccatcatgagcaaccacacagctacgcacattctgaacttcgccctgcgctcagtgcttggggaagctgaccagaaaggctcattggttgctcctgaccgcctcagatttgactttactgccaagggagccatgtccacccaacagatcaagaaggctgaagagattgctaatgagatgattgaggcagccaaggccgtctatacccaggattgccccctggcagcagcgaaagccatccagggcctacgggctgtgtttgatgagacctatcctgaccctgtgcgagtcgtctccattggggtcccggtgtccgagttgctggatgacccctctgggcctgctggctccctgacttctgttgagttctgtgggggaacgcacctgcggaactcgagtcatgcaggagcttttgtgatcgtgacggaagaagccattgccaagggtatccggaggattgtggctgtcacaggtgccgaggcccagaaggccctcaggaaagcagagagcttgaagaaatgtctctctgtcatggaagccaaagtgaaggctcagactgctccaaacaaggatgtgcagagggagatcgctgaccttggagaggccctggccactgcagtcatcccccagtggcagaaggatgaattgcgggagactctcaaatccctaaagaaggtcatggatgacttggaccgagccagcaaagccgatgtccagaaacgagtgttagagaagacgaagcagttcatcgacagcaaccccaaccagcctcttgtcatcctggagatggagagcggcgcctcagccaaggccctgaatgaagccttgaagctcttcaagatgcactcccctcagacttctgccatgctcttcacggtggacaatgaggctggcaagatcacgtgcctgtgtcaagttccccagaatgcagccaatcggggcttaaaagccagcgagtgggtgcagcaggtgtcaggcttgatggacggtaaaggtggtggcaaggatgtgtctgcacaggccacaggcaagaacgttggctgcctgcaggaggcgctgcagctggccacttccttcgcccagctgcgcctcggggatgtaaagaactgagtggggaaggaggaggctcccactggatccatccgtccagccaagagctcttcatctgctacaagaacatttgaatcttgggacctttaaagagcccctcctaacccagcagtaactggaacacacttgggagcagtcctatgtctcagtgccccttaaatttctgccctgagccctccacgtcagtgccatcggtctagaaccactaaccccgcattgctgttgatcgtcacgctcgcatctatagataacggctctccagacctgagctttccgcgtcagcaagtaggaatcgtttttgctgcagagaataaaaggaccacgtgc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:16 -> Molecular function: GO:0000049 [tRNA binding] evidence: IEA
GeneID:16 -> Molecular function: GO:0002161 [aminoacyl-tRNA editing activity] evidence: IEA
GeneID:16 -> Molecular function: GO:0004813 [alanine-tRNA ligase activity] evidence: IEA
GeneID:16 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:16 -> Molecular function: GO:0016597 [amino acid binding] evidence: IEA
GeneID:16 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:16 -> Biological process: GO:0001942 [hair follicle development] evidence: IEA
GeneID:16 -> Biological process: GO:0006400 [tRNA modification] evidence: IEA
GeneID:16 -> Biological process: GO:0006418 [tRNA aminoacylation for protein translation] evidence: TAS
GeneID:16 -> Biological process: GO:0006419 [alanyl-tRNA aminoacylation] evidence: IEA
GeneID:16 -> Biological process: GO:0006457 [protein folding] evidence: IEA
GeneID:16 -> Biological process: GO:0008033 [tRNA processing] evidence: TAS
GeneID:16 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:16 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA
GeneID:16 -> Biological process: GO:0030968 [endoplasmic reticulum unfolded protein response] evidence: IEA
GeneID:16 -> Biological process: GO:0043200 [response to amino acid stimulus] evidence: IEA
GeneID:16 -> Biological process: GO:0043524 [negative regulation of neuron apoptotic process] evidence: IEA
GeneID:16 -> Biological process: GO:0050885 [neuromuscular process controlling balance] evidence: IEA
GeneID:16 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS
GeneID:16 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001596 -> EC 6.1.1.7
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.