GGRNA Home | Help | Advanced search

2020-10-24 06:29:25, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001605               3344 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens alanyl-tRNA synthetase (AARS), mRNA.
ACCESSION   NM_001605
VERSION     NM_001605.2  GI:109148541
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3344)
  AUTHORS   Zhao,Z., Hashiguchi,A., Hu,J., Sakiyama,Y., Okamoto,Y.,
            Tokunaga,S., Zhu,L., Shen,H. and Takashima,H.
  TITLE     Alanyl-tRNA synthetase mutation in a family with dominant distal
            hereditary motor neuropathy
  JOURNAL   Neurology 78 (21), 1644-1649 (2012)
   PUBMED   22573628
  REMARK    GeneRIF: in a family with distal hereditary motor neuropathy
            (dHMN), all 4 affected family members had a heterozygous missense
            mutation c.2677G>A (p.D893N) of (AARS), not found in the 4
            unaffected members and control subjects; conclude AARS mutation
            caused dHMN in a Chinese family; AARS mutations result in not only
            a CMT phenotype but also a dHMN phenotype
REFERENCE   2  (bases 1 to 3344)
  AUTHORS   McLaughlin,H.M., Sakaguchi,R., Giblin,W., Wilson,T.E.,
            Biesecker,L., Lupski,J.R., Talbot,K., Vance,J.M., Zuchner,S.,
            Lee,Y.C., Kennerson,M., Hou,Y.M., Nicholson,G. and Antonellis,A.
  CONSRTM   NISC Comparative Sequencing Program
  TITLE     A recurrent loss-of-function alanyl-tRNA synthetase (AARS) mutation
            in patients with Charcot-Marie-Tooth disease type 2N (CMT2N)
  JOURNAL   Hum. Mutat. 33 (1), 244-253 (2012)
   PUBMED   22009580
  REMARK    GeneRIF: Methylation-mediated deamination of a CpG dinucleotide
            gives rise to the recurrent p.Arg329His alanyl-tRNA synthetase
            mutation in patients with Charcot-Marie-Tooth disease type 2N
            (CMT2N).
REFERENCE   3  (bases 1 to 3344)
  AUTHORS   Gotz,A., Tyynismaa,H., Euro,L., Ellonen,P., Hyotylainen,T.,
            Ojala,T., Hamalainen,R.H., Tommiska,J., Raivio,T., Oresic,M.,
            Karikoski,R., Tammela,O., Simola,K.O., Paetau,A., Tyni,T. and
            Suomalainen,A.
  TITLE     Exome sequencing identifies mitochondrial alanyl-tRNA synthetase
            mutations in infantile mitochondrial cardiomyopathy
  JOURNAL   Am. J. Hum. Genet. 88 (5), 635-642 (2011)
   PUBMED   21549344
  REMARK    GeneRIF: We show here that mutations in AARS2 cause perinatal or
            infantile cardiomyopathy with near-total combined mitochondrial
            respiratory chain deficiency in the heart.
REFERENCE   4  (bases 1 to 3344)
  AUTHORS   Latour,P., Thauvin-Robinet,C., Baudelet-Mery,C., Soichot,P.,
            Cusin,V., Faivre,L., Locatelli,M.C., Mayencon,M., Sarcey,A.,
            Broussolle,E., Camu,W., David,A. and Rousson,R.
  TITLE     A major determinant for binding and aminoacylation of tRNA(Ala) in
            cytoplasmic Alanyl-tRNA synthetase is mutated in dominant axonal
            Charcot-Marie-Tooth disease
  JOURNAL   Am. J. Hum. Genet. 86 (1), 77-82 (2010)
   PUBMED   20045102
  REMARK    GeneRIF: cytoplasmic Alanyl-tRNA synthetase may have a role in
            dominant axonal Charcot-Marie-Tooth disease, as shown by its
            mutation in a major determinant for binding and aminoacylation
REFERENCE   5  (bases 1 to 3344)
  AUTHORS   Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A.
  TITLE     A germline-specific class of small RNAs binds mammalian Piwi
            proteins
  JOURNAL   Nature 442 (7099), 199-202 (2006)
   PUBMED   16751776
REFERENCE   6  (bases 1 to 3344)
  AUTHORS   Nichols,R.C., Pai,S.I., Ge,Q., Targoff,I.N., Plotz,P.H. and Liu,P.
  TITLE     Localization of two human autoantigen genes by PCR screening and in
            situ hybridization--glycyl-tRNA synthetase locates to 7p15 and
            alanyl-tRNA synthetase locates to 16q22
  JOURNAL   Genomics 30 (1), 131-132 (1995)
   PUBMED   8595897
REFERENCE   7  (bases 1 to 3344)
  AUTHORS   Shiba,K., Ripmaster,T., Suzuki,N., Nichols,R., Plotz,P., Noda,T.
            and Schimmel,P.
  TITLE     Human alanyl-tRNA synthetase: conservation in evolution of
            catalytic core and microhelix recognition
  JOURNAL   Biochemistry 34 (33), 10340-10349 (1995)
   PUBMED   7654687
REFERENCE   8  (bases 1 to 3344)
  AUTHORS   Ripmaster,T.L., Shiba,K. and Schimmel,P.
  TITLE     Wide cross-species aminoacyl-tRNA synthetase replacement in vivo:
            yeast cytoplasmic alanine enzyme replaced by human polymyositis
            serum antigen
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (11), 4932-4936 (1995)
   PUBMED   7761427
REFERENCE   9  (bases 1 to 3344)
  AUTHORS   Matoba,R., Okubo,K., Hori,N., Fukushima,A. and Matsubara,K.
  TITLE     The addition of 5'-coding information to a 3'-directed cDNA library
            improves analysis of gene expression
  JOURNAL   Gene 146 (2), 199-207 (1994)
   PUBMED   8076819
REFERENCE   10 (bases 1 to 3344)
  AUTHORS   Francklyn,C. and Schimmel,P.
  TITLE     Aminoacylation of RNA minihelices with alanine
  JOURNAL   Nature 337 (6206), 478-481 (1989)
   PUBMED   2915692
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from D32050.1, BC011451.1,
            BG764123.1 and BU178772.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 15, 2006 this sequence version replaced gi:4501840.
            
            Summary: The human alanyl-tRNA synthetase (AARS) belongs to a
            family of tRNA synthases, of the class II enzymes.  Class II tRNA
            synthases evolved early in evolution and are highly conserved.
            This is reflected by the fact that 498 of the 968-residue
            polypeptide human AARS shares 41% identity witht the E.coli
            protein.  tRNA synthases are the enzymes that interpret the RNA
            code and attach specific aminoacids to the tRNAs that contain the
            cognate trinucleotide anticodons.  They consist of a catalytic
            domain which interacts with the amino acid acceptor-T psi C helix
            of the tRNA, and a second domain which interacts with the rest of
            the tRNA structure. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: D32050.1, AK222824.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-355               D32050.1           1-355
            356-1012            BC011451.1         288-944
            1013-1581           BG764123.1         9-577
            1582-2824           BC011451.1         1514-2756
            2825-3344           BU178772.1         234-753
FEATURES             Location/Qualifiers
     source          1..3344
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16q22"
     gene            1..3344
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="alanyl-tRNA synthetase"
                     /db_xref="GeneID:16"
                     /db_xref="HGNC:20"
                     /db_xref="MIM:601065"
     exon            1..89
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            90..254
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     CDS             111..3017
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /EC_number="6.1.1.7"
                     /note="alanine tRNA ligase 1, cytoplasmic; alanyl-tRNA
                     synthetase, cytoplasmic; alaRS; renal carcinoma antigen
                     NY-REN-42"
                     /codon_start=1
                     /product="alanine--tRNA ligase, cytoplasmic"
                     /protein_id="NP_001596.2"
                     /db_xref="GI:109148542"
                     /db_xref="CCDS:CCDS32474.1"
                     /db_xref="GeneID:16"
                     /db_xref="HGNC:20"
                     /db_xref="MIM:601065"
                     /translation="
MDSTLTASEIRQRFIDFFKRNEHTYVHSSATIPLDDPTLLFANAGMNQFKPIFLNTIDPSHPMAKLSRAANTQKCIRAGGKHNDLDDVGKDVYHHTFFEMLGSWSFGDYFKELACKMALELLTQEFGIPIERLYVTYFGGDEAAGLEADLECKQIWQNLGLDDTKILPGNMKDNFWEMGDTGPCGPCSEIHYDRIGGRDAAHLVNQDDPNVLEIWNLVFIQYNREADGILKPLPKKSIDTGMGLERLVSVLQNKMSNYDTDLFVPYFEAIQKGTGARPYTGKVGAEDADGIDMAYRVLADHARTITVALADGGRPDNTGRGYVLRRILRRAVRYAHEKLNASRGFFATLVDVVVQSLGDAFPELKKDPDMVKDIINEEEVQFLKTLSRGRRILDRKIQSLGDSKTIPGDTAWLLYDTYGFPVDLTGLIAEEKGLVVDMDGFEEERKLAQLKSQGKGAGGEDLIMLDIYAIEELRARGLEVTDDSPKYNYHLDSSGSYVFENTVATVMALRREKMFVEEVSTGQECGVVLDKTCFYAEQGGQIYDEGYLVKVDDSSEDKTEFTVKNAQVRGGYVLHIGTIYGDLKVGDQVWLFIDEPRRRPIMSNHTATHILNFALRSVLGEADQKGSLVAPDRLRFDFTAKGAMSTQQIKKAEEIANEMIEAAKAVYTQDCPLAAAKAIQGLRAVFDETYPDPVRVVSIGVPVSELLDDPSGPAGSLTSVEFCGGTHLRNSSHAGAFVIVTEEAIAKGIRRIVAVTGAEAQKALRKAESLKKCLSVMEAKVKAQTAPNKDVQREIADLGEALATAVIPQWQKDELRETLKSLKKVMDDLDRASKADVQKRVLEKTKQFIDSNPNQPLVILEMESGASAKALNEALKLFKMHSPQTSAMLFTVDNEAGKITCLCQVPQNAANRGLKASEWVQQVSGLMDGKGGGKDVSAQATGKNVGCLQEALQLATSFAQLRLGDVKN
"
     misc_feature    111..113
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylmethionine; propagated from
                     UniProtKB/Swiss-Prot (P49588.2); acetylation site"
     misc_feature    126..2993
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="alanyl-tRNA synthetase; Region: PLN02900"
                     /db_xref="CDD:178488"
     misc_feature    129..872
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="Alanyl-tRNA synthetase (AlaRS) class II core
                     catalytic domain. AlaRS is a homodimer. It is responsible
                     for the attachment of alanine to the 3' OH group of ribose
                     of the appropriate tRNA. This domain is primarily
                     responsible for ATP-dependent formation of...; Region:
                     AlaRS_core; cd00673"
                     /db_xref="CDD:29811"
     misc_feature    165..167
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (P49588.2); acetylation site"
     misc_feature    183..197
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="motif 1; other site"
                     /db_xref="CDD:29811"
     misc_feature    order(264..266,270..272,339..341,402..404,408..410,
                     414..422,747..752,762..764,819..824,834..839,846..848)
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="active site"
                     /db_xref="CDD:29811"
     misc_feature    336..344
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="motif 2; other site"
                     /db_xref="CDD:29811"
     misc_feature    831..848
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="motif 3; other site"
                     /db_xref="CDD:29811"
     misc_feature    1305..1307
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P49588.2); phosphorylation site"
     misc_feature    <1572..1703
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="Translation_Factor_II_like: Elongation factor Tu
                     (EF-Tu) domain II-like proteins. Elongation factor Tu
                     consists of three structural domains, this family
                     represents the second domain. Domain II adopts a beta
                     barrel structure and is involved in binding to...; Region:
                     Translation_Factor_II_like; cl02787"
                     /db_xref="CDD:207732"
     misc_feature    1773..1775
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P49588.2); phosphorylation site"
     misc_feature    1842..1844
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1848..1850
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2190..2369
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="Threonyl and Alanyl tRNA synthetase second
                     additional domain; Region: tRNA_SAD; pfam07973"
                     /db_xref="CDD:203824"
     misc_feature    2736..2738
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (P49588.2); acetylation site"
     misc_feature    2766..2975
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /note="DHHA1 domain; Region: DHHA1; pfam02272"
                     /db_xref="CDD:202185"
     exon            255..443
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     STS             268..396
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /standard_name="RH65736"
                     /db_xref="UniSTS:75263"
     exon            444..589
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            590..781
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       680
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34306553"
     exon            782..926
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            927..1072
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       934
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11537667"
     variation       950..951
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34296479"
     variation       1013
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2070203"
     exon            1073..1181
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            1182..1332
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       1185
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1130535"
     exon            1333..1457
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            1458..1602
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            1603..1781
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            1782..1895
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            1896..2102
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     STS             2030..2206
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /standard_name="RH66606"
                     /db_xref="UniSTS:19748"
     exon            2103..2287
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            2288..2396
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            2397..2510
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       2432
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35769308"
     exon            2511..2630
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            2631..2717
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       2702
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11537665"
     exon            2718..2831
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     exon            2832..3344
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /inference="alignment:Splign:1.39.8"
     variation       3010
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:35744709"
     STS             3128..3270
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /standard_name="A002L29"
                     /db_xref="UniSTS:35285"
     variation       3181
                     /gene="AARS"
                     /gene_synonym="CMT2N"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049384"
     polyA_signal    3327..3332
                     /gene="AARS"
                     /gene_synonym="CMT2N"
ORIGIN      
ggtacagctgcgcgtctgcgggaataggtgcagcgggcccttggcgggggactctgagggaggagctggggacggcgaccctaggagagttctttggggtgactttcaagatggactctactctaacagcaagtgaaatccggcagcgatttatagatttcttcaagaggaacgagcatacgtatgttcactcgtctgccaccatcccattggatgaccccactttgctctttgccaatgcaggcatgaaccagtttaaacccattttcctgaacacaattgacccatctcaccccatggcaaagctgagcagagctgccaatacccagaagtgcatccgggctgggggcaaacataatgacctggacgatgtgggcaaggatgtctatcatcacaccttcttcgagatgctgggctcttggtcttttggagattactttaaggaattggcatgtaagatggctctggaactcctcacccaagagtttggcattcccattgaaagactttatgttacttactttggcggggatgaagcagctggcttagaagcagatctggaatgcaaacagatctggcaaaatttggggctggatgacaccaaaatcctcccaggcaacatgaaggataacttctgggagatgggtgacacgggcccctgtggtccttgcagtgagatccactacgaccggattggtggtcgggacgccgcacatcttgtcaaccaggacgaccctaatgtgctggagatctggaaccttgtgttcatccagtataacagggaagctgatggcattctgaaacctcttcccaagaaaagcattgacacagggatgggcctggaacgactggtatctgtgctgcagaataagatgtccaactatgacactgacctttttgtcccttactttgaagccattcagaagggcacaggtgcccgaccatacactgggaaagttggtgctgaggatgccgatgggattgacatggcctaccgggtgctggctgaccacgctcggaccatcactgtggcactggctgatggtggccggcctgacaacacagggcgtggatatgtgttgagacggattctccgccgagctgtccgatacgcccatgaaaagctcaatgccagcaggggcttctttgctacgttagtggatgttgtcgtccagtccctgggagatgcatttcctgagctgaagaaggacccagacatggtgaaggacatcattaatgaagaagaggtgcagtttctcaagactctcagcagagggcgtcgcatcctggacaggaaaattcagagcctgggagacagcaagaccattcccggagacactgcttggctcctctatgacacctatgggtttccagtggatctgactggactgattgctgaagagaagggcctggtggtagacatggatggctttgaagaggagaggaaactggcccagctgaaatcacagggcaagggagctggtggggaagacctcattatgctggacatttacgctatcgaagagctccgggcacggggtctggaggtcacagatgattccccaaagtacaattaccatttggactccagtggtagctatgtatttgagaacacagtggctacggtgatggctctgcgcagggagaagatgttcgtggaagaggtgtccacaggccaggagtgtggagtggtgctggacaagacctgtttctatgctgagcaaggaggccagatctatgacgaaggctacctggtgaaggtggatgacagcagtgaagataaaacagagtttacagtgaagaatgctcaggtccgaggagggtatgtgctacacattggaaccatctacggtgacctgaaagtgggggatcaggtctggctgtttattgatgagccccgacgaagacccatcatgagcaaccacacagctacgcacattctgaacttcgccctgcgctcagtgcttggggaagctgaccagaaaggctcattggttgctcctgaccgcctcagatttgactttactgccaagggagccatgtccacccaacagatcaagaaggctgaagagattgctaatgagatgattgaggcagccaaggccgtctatacccaggattgccccctggcagcagcgaaagccatccagggcctacgggctgtgtttgatgagacctatcctgaccctgtgcgagtcgtctccattggggtcccggtgtccgagttgctggatgacccctctgggcctgctggctccctgacttctgttgagttctgtgggggaacgcacctgcggaactcgagtcatgcaggagcttttgtgatcgtgacggaagaagccattgccaagggtatccggaggattgtggctgtcacaggtgccgaggcccagaaggccctcaggaaagcagagagcttgaagaaatgtctctctgtcatggaagccaaagtgaaggctcagactgctccaaacaaggatgtgcagagggagatcgctgaccttggagaggccctggccactgcagtcatcccccagtggcagaaggatgaattgcgggagactctcaaatccctaaagaaggtcatggatgacttggaccgagccagcaaagccgatgtccagaaacgagtgttagagaagacgaagcagttcatcgacagcaaccccaaccagcctcttgtcatcctggagatggagagcggcgcctcagccaaggccctgaatgaagccttgaagctcttcaagatgcactcccctcagacttctgccatgctcttcacggtggacaatgaggctggcaagatcacgtgcctgtgtcaagttccccagaatgcagccaatcggggcttaaaagccagcgagtgggtgcagcaggtgtcaggcttgatggacggtaaaggtggtggcaaggatgtgtctgcacaggccacaggcaagaacgttggctgcctgcaggaggcgctgcagctggccacttccttcgcccagctgcgcctcggggatgtaaagaactgagtggggaaggaggaggctcccactggatccatccgtccagccaagagctcttcatctgctacaagaacatttgaatcttgggacctttaaagagcccctcctaacccagcagtaactggaacacacttgggagcagtcctatgtctcagtgccccttaaatttctgccctgagccctccacgtcagtgccatcggtctagaaccactaaccccgcattgctgttgatcgtcacgctcgcatctatagataacggctctccagacctgagctttccgcgtcagcaagtaggaatcgtttttgctgcagagaataaaaggaccacgtgc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:16 -> Molecular function: GO:0000049 [tRNA binding] evidence: IEA
            GeneID:16 -> Molecular function: GO:0002161 [aminoacyl-tRNA editing activity] evidence: IEA
            GeneID:16 -> Molecular function: GO:0004813 [alanine-tRNA ligase activity] evidence: IEA
            GeneID:16 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:16 -> Molecular function: GO:0016597 [amino acid binding] evidence: IEA
            GeneID:16 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:16 -> Biological process: GO:0001942 [hair follicle development] evidence: IEA
            GeneID:16 -> Biological process: GO:0006400 [tRNA modification] evidence: IEA
            GeneID:16 -> Biological process: GO:0006418 [tRNA aminoacylation for protein translation] evidence: TAS
            GeneID:16 -> Biological process: GO:0006419 [alanyl-tRNA aminoacylation] evidence: IEA
            GeneID:16 -> Biological process: GO:0006457 [protein folding] evidence: IEA
            GeneID:16 -> Biological process: GO:0008033 [tRNA processing] evidence: TAS
            GeneID:16 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:16 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA
            GeneID:16 -> Biological process: GO:0030968 [endoplasmic reticulum unfolded protein response] evidence: IEA
            GeneID:16 -> Biological process: GO:0043200 [response to amino acid stimulus] evidence: IEA
            GeneID:16 -> Biological process: GO:0043524 [negative regulation of neuron apoptotic process] evidence: IEA
            GeneID:16 -> Biological process: GO:0050885 [neuromuscular process controlling balance] evidence: IEA
            GeneID:16 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS
            GeneID:16 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001596 -> EC 6.1.1.7

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.