Home |
Help |
Advanced search
2024-04-20 22:45:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001433 4005 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens endoplasmic reticulum to nucleus signaling 1 (ERN1),
mRNA.
ACCESSION NM_001433
VERSION NM_001433.3 GI:153946420
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4005)
AUTHORS Maurel,M., Dejeans,N., Taouji,S., Chevet,E. and Grosset,C.F.
TITLE MicroRNA-1291-mediated silencing of IRE1alpha enhances Glypican-3
expression
JOURNAL RNA 19 (6), 778-788 (2013)
PUBMED 23598528
REMARK GeneRIF: miR-1291 is a biologically relevant regulator of GPC3
expression in hepatoma cells and acts through silencing of the
endoplasmic reticulum stress sensor IRE1alpha.
REFERENCE 2 (bases 1 to 4005)
AUTHORS Minchenko,D.O., Kharkova,A.P., Hubenia,O.V. and Minchenko,O.H.
TITLE Insulin receptor, IRS1, IRS2, INSIG1, INSIG2, RRAD, and BAIAP2 gene
expressions in glioma U87 cells with ERN1 loss of function: effect
of hypoxia and glutamine or glucose deprivation
JOURNAL Endocr Regul 47 (1), 15-26 (2013)
PUBMED 23363253
REMARK GeneRIF: Results of this study demonstrated the dependence of INSR
and related to insulin receptor signaling gene expressions in U87
glioma cells on ERN1 enzyme function indicating its participation
in the regulation of metabolic and proliferative processes via
endoplasmic reticulum stress which is important component of tumor
growth and metabolic diseases.
REFERENCE 3 (bases 1 to 4005)
AUTHORS Upton,J.P., Wang,L., Han,D., Wang,E.S., Huskey,N.E., Lim,L.,
Truitt,M., McManus,M.T., Ruggero,D., Goga,A., Papa,F.R. and
Oakes,S.A.
TITLE IRE1alpha cleaves select microRNAs during ER stress to derepress
translation of proapoptotic Caspase-2
JOURNAL Science 338 (6108), 818-822 (2012)
PUBMED 23042294
REMARK GeneRIF: IRE1alpha regulates translation of a proapoptotic protein,
Caspase-2, through terminating microRNA biogenesis, and noncoding
RNAs are part of the ER stress response
REFERENCE 4 (bases 1 to 4005)
AUTHORS Jwa,M. and Chang,P.
TITLE PARP16 is a tail-anchored endoplasmic reticulum protein required
for the PERK- and IRE1alpha-mediated unfolded protein response
JOURNAL Nat. Cell Biol. 14 (11), 1223-1230 (2012)
PUBMED 23103912
REMARK GeneRIF: PARP16 is a tail-anchored endoplasmic reticulum protein
required for the PERK- and IRE1alpha-mediated unfolded protein
response.
Erratum:[Nat Cell Biol. 2013 Jan;15(1):123]
REFERENCE 5 (bases 1 to 4005)
AUTHORS Tam,A.B., Mercado,E.L., Hoffmann,A. and Niwa,M.
TITLE ER stress activates NF-kappaB by integrating functions of basal IKK
activity, IRE1 and PERK
JOURNAL PLoS ONE 7 (10), E45078 (2012)
PUBMED 23110043
REMARK GeneRIF: ER stress activates NF-kappaB by integrating functions of
basal IKK activity, IRE1 and PERK.
REFERENCE 6 (bases 1 to 4005)
AUTHORS Yoneda,T., Imaizumi,K., Oono,K., Yui,D., Gomi,F., Katayama,T. and
Tohyama,M.
TITLE Activation of caspase-12, an endoplastic reticulum (ER) resident
caspase, through tumor necrosis factor receptor-associated factor
2-dependent mechanism in response to the ER stress
JOURNAL J. Biol. Chem. 276 (17), 13935-13940 (2001)
PUBMED 11278723
REFERENCE 7 (bases 1 to 4005)
AUTHORS Iwawaki,T., Hosoda,A., Okuda,T., Kamigori,Y., Nomura-Furuwatari,C.,
Kimata,Y., Tsuru,A. and Kohno,K.
TITLE Translational control by the ER transmembrane kinase/ribonuclease
IRE1 under ER stress
JOURNAL Nat. Cell Biol. 3 (2), 158-164 (2001)
PUBMED 11175748
REFERENCE 8 (bases 1 to 4005)
AUTHORS Urano,F., Wang,X., Bertolotti,A., Zhang,Y., Chung,P., Harding,H.P.
and Ron,D.
TITLE Coupling of stress in the ER to activation of JNK protein kinases
by transmembrane protein kinase IRE1
JOURNAL Science 287 (5453), 664-666 (2000)
PUBMED 10650002
REFERENCE 9 (bases 1 to 4005)
AUTHORS Katayama,T., Imaizumi,K., Sato,N., Miyoshi,K., Kudo,T., Hitomi,J.,
Morihara,T., Yoneda,T., Gomi,F., Mori,Y., Nakano,Y., Takeda,J.,
Tsuda,T., Itoyama,Y., Murayama,O., Takashima,A., St
George-Hyslop,P., Takeda,M. and Tohyama,M.
TITLE Presenilin-1 mutations downregulate the signalling pathway of the
unfolded-protein response
JOURNAL Nat. Cell Biol. 1 (8), 479-485 (1999)
PUBMED 10587643
REFERENCE 10 (bases 1 to 4005)
AUTHORS Tirasophon,W., Welihinda,A.A. and Kaufman,R.J.
TITLE A stress response pathway from the endoplasmic reticulum to the
nucleus requires a novel bifunctional protein
kinase/endoribonuclease (Ire1p) in mammalian cells
JOURNAL Genes Dev. 12 (12), 1812-1824 (1998)
PUBMED 9637683
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB128514.1, AB209869.1,
AC005803.1 and BC130405.1.
On Jul 26, 2007 this sequence version replaced gi:50346000.
Summary: The protein encoded by this gene is the ER to nucleus
signalling 1 protein, a human homologue of the yeast Ire1 gene
product. This protein possesses intrinsic kinase activity and an
endoribonuclease activity and it is important in altering gene
expression as a response to endoplasmic reticulum-based stress
signals. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AB209869.1, AF059198.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-17 DB128514.1 1-17
18-1090 AB209869.1 1-1073
1091-1200 AC005803.1 144670-144779 c
1201-2587 AB209869.1 1184-2570
2588-2642 AC005803.1 128542-128596 c
2643-3502 BC130405.1 2576-3435
3503-4005 AC005803.1 123714-124216 c
FEATURES Location/Qualifiers
source 1..4005
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q24.2"
gene 1..4005
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="endoplasmic reticulum to nucleus signaling 1"
/db_xref="GeneID:2081"
/db_xref="HGNC:3449"
/db_xref="MIM:604033"
exon 1..167
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
misc_feature 24..26
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="upstream in-frame stop codon"
CDS 114..3047
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/EC_number="2.7.11.1"
/note="ER to nucleus signalling 1; inositol-requiring 1;
protein kinase/endoribonuclease; serine/threonine-protein
kinase/endoribonuclease IRE1; ire1-alpha;
inositol-requiring protein 1; endoplasmic
reticulum-to-nucleus signaling 1; inositol-requiring
enzyme 1"
/codon_start=1
/product="serine/threonine-protein kinase/endoribonuclease
IRE1 precursor"
/protein_id="NP_001424.3"
/db_xref="GI:153946421"
/db_xref="CCDS:CCDS45762.1"
/db_xref="GeneID:2081"
/db_xref="HGNC:3449"
/db_xref="MIM:604033"
/translation="
MPARRLLLLLTLLLPGLGIFGSTSTVTLPETLLFVSTLDGSLHAVSKRTGSIKWTLKEDPVLQVPTHVEEPAFLPDPNDGSLYTLGSKNNEGLTKLPFTIPELVQASPCRSSDGILYMGKKQDIWYVIDLLTGEKQQTLSSAFADSLCPSTSLLYLGRTEYTITMYDTKTRELRWNATYFDYAASLPEDDVDYKMSHFVSNGDGLVVTVDSESGDVLWIQNYASPVVAFYVWQREGLRKVMHINVAVETLRYLTFMSGEVGRITKWKYPFPKETEAKSKLTPTLYVGKYSTSLYASPSMVHEGVAVVPRGSTLPLLEGPQTDGVTIGDKGECVITPSTDVKFDPGLKSKNKLNYLRNYWLLIGHHETPLSASTKMLERFPNNLPKHRENVIPADSEKKSFEEVINLVDQTSENAPTTVSRDVEEKPAHAPARPEAPVDSMLKDMATIILSTFLLIGWVAFIITYPLSMHQQQQLQHQQFQKELEKIQLLQQQQQQLPFHPPGDTAQDGELLDTSGPYSESSGTSSPSTSPRASNHSLCSGSSASKAGSSPSLEQDDGDEETSVVIVGKISFCPKDVLGHGAEGTIVYRGMFDNRDVAVKRILPECFSFADREVQLLRESDEHPNVIRYFCTEKDRQFQYIAIELCAATLQEYVEQKDFAHLGLEPITLLQQTTSGLAHLHSLNIVHRDLKPHNILISMPNAHGKIKAMISDFGLCKKLAVGRHSFSRRSGVPGTEGWIAPEMLSEDCKENPTYTVDIFSAGCVFYYVISEGSHPFGKSLQRQANILLGACSLDCLHPEKHEDVIARELIEKMIAMDPQKRPSAKHVLKHPFFWSLEKQLQFFQDVSDRIEKESLDGPIVKQLERGGRAVVKMDWRENITVPLQTDLRKFRTYKGGSVRDLLRAMRNKKHHYRELPAEVRETLGSLPDDFVCYFTSRFPHLLAHTYRAMELCSHERLFQPYYFHEPPEPQPPVTPDAL
"
sig_peptide 114..167
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 174..773
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="PQQ-like domain; Region: PQQ_2; pfam13360"
/db_xref="CDD:205539"
misc_feature 201..1007
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="The Luminal domain, a dimerization domain, of the
Serine/Threonine protein kinase, Inositol-requiring
protein 1; Region: Luminal_IRE1; cd09769"
/db_xref="CDD:188875"
misc_feature order(429..443,459..461,465..476,480..488,522..524,
528..536,543..545,582..587,609..611,615..617,660..662,
666..674)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="homodimer interface [polypeptide binding]; other
site"
/db_xref="CDD:188875"
misc_feature 1443..1505
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75460.2);
transmembrane region"
misc_feature 1824..2609
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature 1842..2603
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="Catalytic domain of Protein Kinases; Region: PKc;
cd00180"
/db_xref="CDD:173623"
misc_feature order(1842..1856,1869..1871,1902..1904,1908..1910,
1989..1991,2037..2048,2055..2057,2061..2063,2175..2177,
2181..2183,2187..2192,2196..2198,2244..2246,2253..2255,
2310..2321)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(1842..1856,1869..1871,1902..1904,1908..1910,
1989..1991,2037..2048,2055..2057,2175..2177,2181..2183,
2187..2192,2196..2198,2244..2246)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(1854..1856,2055..2057,2061..2063,2175..2177,
2181..2183,2187..2189,2253..2255,2310..2321)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(2241..2261,2310..2321)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 2619..2978
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="RNase domain (also known as the kinase extension
nuclease domain) of Ire1; Region: RNase_Ire1; cd10422"
/db_xref="CDD:199217"
misc_feature order(2619..2624,2631..2633,2643..2645,2835..2837,
2889..2891)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:199217"
misc_feature order(2625..2627,2913..2915,2925..2927,2934..2939,
2949..2951)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="kinase interface [polypeptide binding]; other site"
/db_xref="CDD:199217"
misc_feature order(2631..2633,2643..2645,2652..2657,2826..2828,
2835..2840,2847..2849,2886..2894,2976..2978)
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/note="homodimer interface [polypeptide binding]; other
site"
/db_xref="CDD:199217"
misc_feature 3030..3032
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O75460.2); phosphorylation site"
exon 168..288
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 289..322
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 323..395
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 396..468
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 469..591
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 592..693
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 694..955
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 956..1034
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 1035..1200
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 1201..1319
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 1320..1511
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 1512..1785
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
STS 1542..1788
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/standard_name="G10027"
/db_xref="UniSTS:61621"
exon 1786..1876
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 1877..2066
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2067..2166
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2167..2366
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2367..2514
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2515..2642
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2643..2766
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2767..2834
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
exon 2835..4005
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/inference="alignment:Splign:1.39.8"
variation 3632
/gene="ERN1"
/gene_synonym="hIRE1p; IRE1; IRE1a; IRE1P"
/replace="a"
/replace="g"
/db_xref="dbSNP:34576024"
ORIGIN
tgcctagtcagttctgcgtccgctgaggctcggtcaccgcctcgctgtcgtcgcggcgcccccgccccgtcctctgtccgtaccgcccccggagccagggccgagtcctcgccatgccggcccggcggctgctgctgctgctgacgctgctgctgcccggcctcgggatttttggaagtaccagcacagtgacgcttcctgaaaccttgttgtttgtgtcaacgctggatggaagtttgcatgctgtcagcaagaggacaggctcaatcaaatggactttaaaagaagatccagtcctgcaggtcccaacacatgtggaagagcctgcctttctcccagatcctaatgatggcagcctgtatacgcttggaagcaagaataatgaaggcctgacgaaacttccttttaccatcccagaattggtgcaggcatccccatgccgaagttcagatggaatcctctacatgggtaaaaagcaggacatctggtatgttattgacctcctgaccggagagaagcagcagactttgtcatcggcctttgcagatagtctctgcccatcaacctctcttctgtatcttgggcgaacagaatacaccatcaccatgtacgacaccaaaacccgagagctccggtggaatgccacctactttgactatgcggcctcactgcctgaggacgacgtggactacaagatgtcccactttgtgtccaatggtgatgggctggtggtgactgtggacagtgaatctggggacgtcctgtggatccaaaactacgcctcccctgtggtggccttttatgtctggcagcgggagggtctgaggaaggtgatgcacatcaatgtcgctgtggagaccctgcgctatctgaccttcatgtctggggaggtggggcgcatcacaaagtggaagtacccgttccccaaggagacagaggccaagagcaagctgacgcccactctgtatgttgggaaatactctaccagcctctatgcctctccctcaatggtacacgagggggttgctgtcgtgccccgcggcagcacacttcctttgctggaagggccccagactgatggcgtcaccattggggacaagggggagtgtgtgatcacgcccagcacggacgtcaagtttgatcccggactcaaaagcaagaacaagctcaactacttgaggaattactggcttctgataggacaccatgaaaccccactgtctgcgtctaccaagatgctggagagatttcccaacaatctacccaaacatcgggaaaatgtgattcctgctgattcagagaaaaagagctttgaggaagttatcaacctggttgaccagacttcagaaaacgcacctaccaccgtgtctcgggatgtggaggagaagcccgcccatgcccctgcccggcccgaggcccccgtggactccatgcttaaggacatggctaccatcatcctgagcaccttcctgctgattggctgggtggccttcatcatcacctatcccctgagcatgcatcagcagcagcagctccagcaccagcagttccagaaggaactggagaagatccagctcctgcagcagcagcagcagcagctgcccttccacccacctggagacacggctcaggacggcgagctcctggacacgtctggcccgtactcagagagctcgggcaccagcagccccagcacgtcccccagggcctccaaccactcgctctgctccggcagctctgcctccaaggctggcagcagcccctccctggaacaagacgatggagatgaggaaaccagcgtggtgatagttgggaaaatttccttctgtcccaaggatgtcctgggccatggagctgagggcacaattgtgtaccggggcatgtttgacaaccgcgacgtggccgtgaagaggatcctccccgagtgttttagcttcgcagaccgtgaggtccagctgttgcgagaatcggatgagcacccgaacgtgatccgctacttctgcacggagaaggaccggcaattccagtacattgccatcgagctgtgtgcagccaccctgcaagagtatgtggagcagaaggactttgcgcatctcggcctggagcccatcaccttgctgcagcagaccacctcgggcctggcccacctccactccctcaacatcgttcacagagacctaaagccacacaacatcctcatatccatgcccaatgcacacggcaagatcaaggccatgatctccgactttggcctctgcaagaagctggcagtgggcagacacagtttcagccgccgatctggggtgcctggcacagaaggctggatcgctccagagatgctgagcgaagactgtaaggagaaccctacctacacggtggacatcttttctgcaggctgcgtcttttactacgtaatctctgagggcagccacccttttggcaagtccctgcagcggcaggccaacatcctcctgggtgcctgcagccttgactgcttgcacccagagaagcacgaagacgtcattgcacgtgaattgatagagaagatgattgcgatggatcctcagaaacgcccctcagcgaagcatgtgctcaaacacccgttcttctggagcctagagaagcagctccagttcttccaggacgtgagcgacagaatagaaaaggaatccctggatggcccgatcgtgaagcagttagagagaggcgggagagccgtggtgaagatggactggcgggagaacatcactgtccccctccagacagacctgcgtaaattcaggacctataaaggtggttctgtcagagatctcctccgagccatgagaaataagaagcaccactaccgggagctgcctgcagaggtgcgggagacgctggggtccctccccgacgacttcgtgtgctacttcacatctcgcttcccccacctcctcgcacacacctaccgggccatggagctgtgcagccacgagagactcttccagccctactacttccacgagcccccagagccccagcccccagtgactccagacgccctctgagcgagggcggcccctctgttctggtggccccagctgtgactgagggcctggtcaccacaattagagcttgatgcctcccggctttgcagggagaccaggcttcccaaaccaagtgccttgagctgcctgctctgcagcccacagaggacagtgctgaccccaggaagtgggagaagtggcccctcgtgacctacagggaactgggaagatgctggccccaaaagccttacggtcatgatgtctgcaaaggagggcctcagagacagcgcgagtagcacccccagccatctactggataaacttgcttcagactttttaaattcctgcttaatgtcagtctacaggcctttcaggaagggagaggagggaatcgtacattttgcttgcgtgctgggacagctaggctgagatgcaccaagtacagccttcactggagaccggaattgagaggtgggggatgctgaggagggggaggacggagttcagagggtgtcgtcctgcagtgtgagatttctcattgatcacagatgtgcccagagtagcccaggtcactgttaactagtgtttctgcagaggcagcaggagccatgagcatgaggtgtggcattagggactggtcagctatgcatgctggcaggtggggttgtgtctgcaggtctcagaaatgaagaggctgctctgttctggaggcagccgtggcccagtgccagtggccagaacagtggcctttggtgggtgtgtcccgggccatctcggggtggtgctcaggagcgcctggggcaagaggtaaagagttccctggccttcaaggagagcagcgaagacccagacaggggccagccttcaggaccagagggaggccgccgaatgggaccctcctggtcaccaggagaaagccctgggccagcgagtaggcagtcaaactccttcgtccccaaggccggtggaacaagaggct
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:2081 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IDA
GeneID:2081 -> Molecular function: GO:0004521 [endoribonuclease activity] evidence: IDA
GeneID:2081 -> Molecular function: GO:0004521 [endoribonuclease activity] evidence: TAS
GeneID:2081 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:2081 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:2081 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:2081 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:2081 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:2081 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:2081 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA
GeneID:2081 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:2081 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:2081 -> Biological process: GO:0006917 [induction of apoptosis] evidence: ISS
GeneID:2081 -> Biological process: GO:0006987 [activation of signaling protein activity involved in unfolded protein response] evidence: IDA
GeneID:2081 -> Biological process: GO:0006987 [activation of signaling protein activity involved in unfolded protein response] evidence: TAS
GeneID:2081 -> Biological process: GO:0007050 [cell cycle arrest] evidence: ISS
GeneID:2081 -> Biological process: GO:0030968 [endoplasmic reticulum unfolded protein response] evidence: TAS
GeneID:2081 -> Biological process: GO:0044267 [cellular protein metabolic process] evidence: TAS
GeneID:2081 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IEA
GeneID:2081 -> Biological process: GO:1900103 [positive regulation of endoplasmic reticulum unfolded protein response] evidence: IMP
GeneID:2081 -> Cellular component: GO:0005637 [nuclear inner membrane] evidence: IEA
GeneID:2081 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA
GeneID:2081 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
GeneID:2081 -> Cellular component: GO:0030176 [integral to endoplasmic reticulum membrane] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001424 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.