GGRNA Home | Help | Advanced search

2020-10-24 06:54:49, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001373              13788 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dynein, axonemal, heavy chain 14 (DNAH14), transcript
            variant 1, mRNA.
ACCESSION   NM_001373
VERSION     NM_001373.1  GI:223555934
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 13788)
  AUTHORS   Venter,J.C., Adams,M.D., Myers,E.W., Li,P.W., Mural,R.J.,
            Sutton,G.G., Smith,H.O., Yandell,M., Evans,C.A., Holt,R.A.,
            Gocayne,J.D., Amanatides,P., Ballew,R.M., Huson,D.H., Wortman,J.R.,
            Zhang,Q., Kodira,C.D., Zheng,X.H., Chen,L., Skupski,M.,
            Subramanian,G., Thomas,P.D., Zhang,J., Gabor Miklos,G.L.,
            Nelson,C., Broder,S., Clark,A.G., Nadeau,J., McKusick,V.A.,
            Zinder,N., Levine,A.J., Roberts,R.J., Simon,M., Slayman,C.,
            Hunkapiller,M., Bolanos,R., Delcher,A., Dew,I., Fasulo,D.,
            Flanigan,M., Florea,L., Halpern,A., Hannenhalli,S., Kravitz,S.,
            Levy,S., Mobarry,C., Reinert,K., Remington,K., Abu-Threideh,J.,
            Beasley,E., Biddick,K., Bonazzi,V., Brandon,R., Cargill,M.,
            Chandramouliswaran,I., Charlab,R., Chaturvedi,K., Deng,Z., Di
            Francesco,V., Dunn,P., Eilbeck,K., Evangelista,C., Gabrielian,A.E.,
            Gan,W., Ge,W., Gong,F., Gu,Z., Guan,P., Heiman,T.J., Higgins,M.E.,
            Ji,R.R., Ke,Z., Ketchum,K.A., Lai,Z., Lei,Y., Li,Z., Li,J.,
            Liang,Y., Lin,X., Lu,F., Merkulov,G.V., Milshina,N., Moore,H.M.,
            Naik,A.K., Narayan,V.A., Neelam,B., Nusskern,D., Rusch,D.B.,
            Salzberg,S., Shao,W., Shue,B., Sun,J., Wang,Z., Wang,A., Wang,X.,
            Wang,J., Wei,M., Wides,R., Xiao,C., Yan,C., Yao,A., Ye,J., Zhan,M.,
            Zhang,W., Zhang,H., Zhao,Q., Zheng,L., Zhong,F., Zhong,W., Zhu,S.,
            Zhao,S., Gilbert,D., Baumhueter,S., Spier,G., Carter,C.,
            Cravchik,A., Woodage,T., Ali,F., An,H., Awe,A., Baldwin,D.,
            Baden,H., Barnstead,M., Barrow,I., Beeson,K., Busam,D., Carver,A.,
            Center,A., Cheng,M.L., Curry,L., Danaher,S., Davenport,L.,
            Desilets,R., Dietz,S., Dodson,K., Doup,L., Ferriera,S., Garg,N.,
            Gluecksmann,A., Hart,B., Haynes,J., Haynes,C., Heiner,C.,
            Hladun,S., Hostin,D., Houck,J., Howland,T., Ibegwam,C., Johnson,J.,
            Kalush,F., Kline,L., Koduru,S., Love,A., Mann,F., May,D.,
            McCawley,S., McIntosh,T., McMullen,I., Moy,M., Moy,L., Murphy,B.,
            Nelson,K., Pfannkoch,C., Pratts,E., Puri,V., Qureshi,H.,
            Reardon,M., Rodriguez,R., Rogers,Y.H., Romblad,D., Ruhfel,B.,
            Scott,R., Sitter,C., Smallwood,M., Stewart,E., Strong,R., Suh,E.,
            Thomas,R., Tint,N.N., Tse,S., Vech,C., Wang,G., Wetter,J.,
            Williams,S., Williams,M., Windsor,S., Winn-Deen,E., Wolfe,K.,
            Zaveri,J., Zaveri,K., Abril,J.F., Guigo,R., Campbell,M.J.,
            Sjolander,K.V., Karlak,B., Kejariwal,A., Mi,H., Lazareva,B.,
            Hatton,T., Narechania,A., Diemer,K., Muruganujan,A., Guo,N.,
            Sato,S., Bafna,V., Istrail,S., Lippert,R., Schwartz,R., Walenz,B.,
            Yooseph,S., Allen,D., Basu,A., Baxendale,J., Blick,L., Caminha,M.,
            Carnes-Stine,J., Caulk,P., Chiang,Y.H., Coyne,M., Dahlke,C.,
            Mays,A., Dombroski,M., Donnelly,M., Ely,D., Esparham,S., Fosler,C.,
            Gire,H., Glanowski,S., Glasser,K., Glodek,A., Gorokhov,M.,
            Graham,K., Gropman,B., Harris,M., Heil,J., Henderson,S., Hoover,J.,
            Jennings,D., Jordan,C., Jordan,J., Kasha,J., Kagan,L., Kraft,C.,
            Levitsky,A., Lewis,M., Liu,X., Lopez,J., Ma,D., Majoros,W.,
            McDaniel,J., Murphy,S., Newman,M., Nguyen,T., Nguyen,N., Nodell,M.,
            Pan,S., Peck,J., Peterson,M., Rowe,W., Sanders,R., Scott,J.,
            Simpson,M., Smith,T., Sprague,A., Stockwell,T., Turner,R.,
            Venter,E., Wang,M., Wen,M., Wu,D., Wu,M., Xia,A., Zandieh,A. and
            Zhu,X.
  TITLE     The sequence of the human genome
  JOURNAL   Science 291 (5507), 1304-1351 (2001)
   PUBMED   11181995
  REMARK    Erratum:[Science 2001 Jun 5;292(5523):1838]
REFERENCE   2  (bases 1 to 13788)
  AUTHORS   Vaughan,K.T., Mikami,A., Paschal,B.M., Holzbaur,E.L., Hughes,S.M.,
            Echeverri,C.J., Moore,K.J., Gilbert,D.J., Copeland,N.G.,
            Jenkins,N.A. and Vallee,R.B.
  TITLE     Multiple mouse chromosomal loci for dynein-based motility
  JOURNAL   Genomics 36 (1), 29-38 (1996)
   PUBMED   8812413
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC093560.2, AL590547.3, AL645769.9, AL357912.10, AL162738.12,
            AL596134.8 and AC092811.2.
            
            Summary: Dyneins are microtubule-associated motor protein complexes
            composed of several heavy, light, and intermediate chains. Two
            major classes of dyneins, axonemal and cytoplasmic, have been
            identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan
            et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008].
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (1).
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-182               AC093560.2         122795-122976
            183-292             AC093560.2         145811-145920
            293-432             AC093560.2         148100-148239
            433-582             AC093560.2         153294-153443
            583-713             AC093560.2         157620-157750
            714-866             AC093560.2         160572-160724
            867-982             AC093560.2         161900-162015
            983-1045            AC093560.2         167232-167294
            1046-1190           AC093560.2         195924-196068
            1191-1322           AL590547.3         2960-3091
            1323-1573           AL590547.3         19162-19412
            1574-1703           AL590547.3         34241-34370
            1704-1983           AL590547.3         38382-38661
            1984-2029           AL590547.3         39291-39336
            2030-2127           AL590547.3         39433-39530
            2128-2294           AL590547.3         45757-45923
            2295-2639           AL590547.3         46998-47342
            2640-2981           AL645769.9         15635-15976
            2982-3351           AL645769.9         16807-17176
            3352-3542           AL645769.9         18977-19167
            3543-3788           AL645769.9         21972-22217
            3789-3910           AL357912.10        9827-9948
            3911-4082           AL357912.10        13422-13593
            4083-4187           AL357912.10        30393-30497
            4188-4306           AL357912.10        30590-30708
            4307-4381           AL357912.10        31929-32003
            4382-4672           AL357912.10        53440-53730
            4673-4904           AL357912.10        57106-57337
            4905-4958           AL357912.10        58035-58088
            4959-5104           AL357912.10        59813-59958
            5105-5173           AL357912.10        64714-64782
            5174-5360           AL357912.10        65406-65592
            5361-5437           AL357912.10        66459-66535
            5438-5594           AL357912.10        72038-72194
            5595-5684           AL357912.10        80648-80737
            5685-5819           AL357912.10        98000-98134
            5820-6035           AL357912.10        105405-105620
            6036-6126           AL357912.10        116892-116982
            6127-6335           AL357912.10        118680-118888
            6336-6588           AL357912.10        119677-119929
            6589-6667           AL162738.12        13825-13903
            6668-6897           AL162738.12        23345-23574
            6898-6945           AL162738.12        33408-33455
            6946-7062           AL162738.12        35053-35169
            7063-7221           AL162738.12        40712-40870
            7222-7354           AL162738.12        41873-42005
            7355-7419           AL162738.12        46949-47013
            7420-7607           AL162738.12        47934-48121
            7608-7736           AL162738.12        49393-49521
            7737-7868           AL162738.12        53487-53618
            7869-8036           AL162738.12        54658-54825
            8037-8207           AL162738.12        55707-55877
            8208-8405           AL162738.12        72637-72834
            8406-8567           AL162738.12        83621-83782
            8568-8759           AL162738.12        85908-86099
            8760-8941           AL162738.12        87660-87841
            8942-9050           AL162738.12        90213-90321
            9051-9176           AL162738.12        91037-91162
            9177-9271           AL162738.12        101335-101429
            9272-9431           AL162738.12        105416-105575
            9432-9563           AL162738.12        106974-107105
            9564-9659           AL162738.12        107489-107584
            9660-9800           AL162738.12        114189-114329
            9801-10016          AL162738.12        116043-116258
            10017-10247         AL162738.12        120018-120248
            10248-10369         AL162738.12        120813-120934
            10370-10614         AL596134.8         3381-3625
            10615-11033         AC092811.2         185237-185655       c
            11034-11232         AC092811.2         184963-185161       c
            11233-11469         AC092811.2         179734-179970       c
            11470-11555         AC092811.2         177729-177814       c
            11556-11712         AC092811.2         172965-173121       c
            11713-11923         AC092811.2         170726-170936       c
            11924-12026         AC092811.2         166723-166825       c
            12027-12254         AC092811.2         163585-163812       c
            12255-12444         AC092811.2         156740-156929       c
            12445-12625         AC092811.2         154181-154361       c
            12626-12789         AC092811.2         151295-151458       c
            12790-12986         AC092811.2         150038-150234       c
            12987-13099         AC092811.2         143126-143238       c
            13100-13239         AC092811.2         141744-141883       c
            13240-13400         AC092811.2         139166-139326       c
            13401-13547         AC092811.2         132951-133097       c
            13548-13788         AC092811.2         132323-132563       c
FEATURES             Location/Qualifiers
     source          1..13788
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q42.12"
     gene            1..13788
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="dynein, axonemal, heavy chain 14"
                     /db_xref="GeneID:127602"
                     /db_xref="HGNC:2945"
                     /db_xref="MIM:603341"
     exon            1..182
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       15
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189391711"
     variation       88
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373318095"
     variation       99
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34258633"
     exon            183..292
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    195..197
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="upstream in-frame stop codon"
     CDS             216..13763
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="isoform 1 is encoded by transcript variant 1;
                     dynein, axonemal, heavy polypeptide 14; dynein heavy chain
                     14, axonemal; ciliary dynein heavy chain 14; axonemal beta
                     dynein heavy chain 14"
                     /codon_start=1
                     /product="dynein heavy chain 14, axonemal isoform 1"
                     /protein_id="NP_001364.1"
                     /db_xref="GI:223555935"
                     /db_xref="GeneID:127602"
                     /db_xref="HGNC:2945"
                     /db_xref="MIM:603341"
                     /translation="
METFIPIDLTTENQEMDKEETKTKPRLLRYEEKKYEDVKPLETQPAEIAEKETLEYKTVRTFSESLKSEKTEDYLRESIIQQHMVSPEPASLKEKGKSRRKKDQTHACPNVRKARPVSYDRTEPKDDDVIRNIIRLREKLGWQTILPQHSLKYGSSKIAIQKITLKKPLEDDGEFVYCLPRKSPKSLYNPYDLQVVSAHTAKHCKEFWVITASFISKVINIVGSVKEVELIPTLEWLSERRHYYLLRQFKIFSDFRMNKAFVTWKLNVKRIKTEKSRSFLYHHLFLADDLFQTCLVYIRGLCEDAINLKNYNDHENNLSAICLVKLDSSRTYSLDEFCEEQLQQATQALKQLEDIRNKAISEMKSTFLKVAEKNEIKEYFESKLSEDDTTHFKLPKYRRLLETFFKFVMLVDYIFQELIRQLMNTAVTLLLELFNGSAGMPFSVEKKNENLIRTFKDNSFPTGKTTNDCEELVDNSKLHAISVQKSEVKTDTDINEILNSVEVGKDLRKTYAPIFEVNLCLRIPAESDSSENSKENFHESDQCPEECVMFEDEMSENKDNCVKKHSSEELLPKAKKSKEISYNLEDIISDTEIETEFENKYMYYEFPEFPTNLFIDPNRLEFSVKIQNMLTNMEKCITTITPLCQDPQLSIFIDLVSIMDLPNKTGSIIHYKEQTRWPDCHILFETDPAYQNIIVNLLTIIGNSMGLVNAYSHKFIKYCTMTEKAKIMSMKISSMGELTSKEFEAILNRFRNYFRHIVNMAIEKRIGIFNVVSLDYQSECLLYIDNVIHMSHTLIQSVIEKKNKNLLEVVESSLQQLECDPTEIEEFLEHFIFLNAISSKISKLEKEFLTMSQLYSVAKHHQIHISEEQIAIFQVLLLKFSQLKSSMKLSKINKDTAITKFRDNLEACISGLHVDVGNLKAKIRTPLLLCAGTQVSTAMEMIQTLSGEAASLTNKAKAYSHYQDCFSDSQSHMHSVNVEEITQIVLSEISDIEGDLTLRKKLWEAQEEWKRASWEWRNSSLQSIDVESVQRNVSKLMHIISVLEKGLPKSDMVTHLKQVVTEFKQELPIIIALGNPCLKPRHWEALQEIIGKSVPLDKNCKVENLLALKMFQYENEINDMSTSATNEAALEKMLFKIIDFWNTTPLPLILHHTEIYSIFIIPSIDDISAQLEESQVILATIKGSPHIGPIKDLVNEWDQNLTLFSYTLEEWMNCQRNWLYLEPVFHSSEIRRQLPAETELFSQVISMWKKIMSKIQNKQNALQITTSAGVLEILQNCNIHLEHIKKSLEDYLEVKRLIFPRFYFLSNAELLDILADSRNPESVQPHLVKCFENIKQLLIWKQDIGPPAVKMLISAEGEGLVLPKKIRVRSAVEQWLVNVEKSMFDVLKKERYIYNIILLFQSQIMFYNDCVKSFVSSYSREKLEKVHAGLMCHLEEVADLVVLDTSNSRTKAILGALLILYVHCRDIVINLLLKNIFNAEDFEWTRHLQYKWNEKQKLCYVSQGNASFTYGYEYLGCTSRLVITPLTDRCWLTLMEALHLNLGGCPAGPAGTGKTETVKDLAKSLGKHCVVFNCFEDLDYKIVRKFFFGLVQSGAWSCFDEFNLIDLEVLSVIASQILTIKAAKDNYSARFVLEGKEIRINMSCAVFITMNPRYGGGVELPDNLKSLFRPVAMMVPHYQMIAEIILFSFGFKSANSLSGKLTNLYELARKQLSQQDHYNFGLRSLKIVLIMAGTKKREFKCLSEADETLIVIEAIREASLPKCPPEDVPLFENIIGDIFPEVTVLKVNQLALEKVIYTATQQLGLQNWSSQKEKIIQFYNQLQVCVGVMLVGPTGGGKTTVRRILEKALTLLPIADFLSVAERKSASKISERKGKVDICVLNPKCVTLSELYGQLDPNTMEWTDGLLSATIRSYVYFNTPKNTKKDIDLRLKSRISDLSNVFKLDSSDTTETDDNIFEEIEKVVKIPENHNFDWQWIILDGPVDTFWVENLNSVLDDTRTLCLANSERIALTNKIRVIFEVDNLSQASPATVSRCAMVYMDPVDLGWEPYVKSWLLKTSKIISQSGVDCLEFMIKNSVTDGLQFIRNRQKFQPYPMEDITVVITLCRILDAFFDFMGKNGGFEQSDDLNDTSSKEANSQRESVTFKDIEKRDENTWYPEKNPDKLTKIIQKLFVFAFTWAFGGALNREDEHRENIPFCPSLEPDSLAKVTYDFDKLVHELFGNSSQVGWKHWGQSQGRRRKGNCINLPTGECSIFGYFVDIEQCEFIPWSDLVPNDQTLIQRGTSLLTNLQRSGGNFLKITECGECINYTATRDTTCLSFLMSLLLKNSCPVLLTGESGVGKTAAINQMLEKLEGPGAFDIKHGSILGDTLLYSEIKKSSSLKQNITILIPETHKTATGSSDNPTKKPEVRTNKKLLKNNDHKGVVVSTINFSTNVTAAKTKEMILKKLIRRTKDTLGAPKNNRILIFIDDMNMPVSDMYGAQPPLELIRQLLDLGGVYDTEKNTWKNIQDLSIVAACVPVVNDISPRLLKHFSMLVLPHPSQDILCTIFQAHLGIYFSINNFTPEVQKSKDQIISCSLAIYHQVRQNMLPTPTKCHYMFNLRDMFKLLLGLLQADRTVVNSKEMAALLFVHEATRVFHDRLIDFTDKSLFYRLLSRELENCFQIGIDGCGKKTCATLACYLTDNKLYRVPISHKCAYIEFKEVFKKVFIHAGLKGKPTVLMVPNLNIEQDSFLEDLNYIISSGRIPDLFENVELDSIAMKIRYLTEQSGHMDNRQSLLSFFQKRIYKNLHIFVIMSPEGPSFRQNCRVYPSMISSCTIDWYERWPEEALLIVANSFLKEKVNFENRENLKEKLAPTCVQIHKSMKDLNRKYFEETGRFYYTTPNSYLQFMETFAHILRAREEEMQTKRDRFHMGLSTILEATTLVTEMQEELLILGPQVEQKTKETETLMEKLRKDSQVVEKVQMLVKQDEEIVAEEVRIVEDYAQKTANELKSVLPAFDKAIVALNALDKADVAELRVYTRPPFLVLTVMNAVCILLQKKPNWATAKLLLSETGFLKKLINLDKDSIPDKVFVKLKKIVTLPDFNPHKISLVSVACCSLCQWVIALNNYHEVQKVVGPKQIQVAEAQNVLKIARQRLAEKQRGLQLVEEHLLFLQAAYKDTVAEKQLLANRKTMASRRFQCASVLLTVLEDEKTRWQETINQIDNKLEGILGDILLSAACIVYSGILTPEFRQLIVNKWETFCIENGISLSSKFSLIKVMAQKYEISRWHNQGLPHGQYSVENAILIKNGQQWPLLIDPHRQAHKWIRQMEGSRLQKLSIEDSNYTKKIENAMKTGGSVLLQNLLETLAPGLKAILKKDIYQKKGHYFIRVGDAEFEYNSNFRLYLSTEIDNPHFLPSVYNFVTMINFTVTFQGLQDQLLSTVVTHEVPHLEDQRSKLLESISLDAITLEELEEKTLNLLQKALGSILDDDKIVDTLRKSKMTSNEISKRIEATKKAESEIQAIRKNYLPIATRGALLYFLVADLTQINYMYQFSLDWFHQVFVSSVVSKSKEQEHSFKREKVSPKEVHEFISISKEPNLENEKNLLDKHIKSAIDMLTKSIFKVVSSALFNEDKLCFSFRLCTVIMQNNANGNLIQDDIGFLPEEEWNIFLYSGILINIKSALSQSRLTSTFEIGESQHLQWLSDSRWRQCQYVSTHLEPFSLLCKSLLSNVSQWDTFKNSKAVYSLISTPFSSENASLEENTKPPEETELLNENKETCNPINFPWEKLTSFQRLILVKVLRPESLNNSVRKFITEKMGNKYLQRTGVNLKDAYKGSNARTPLILIQTHGIDLTNILLRFAQELKGTTHHVTIISLGRDQAAKAEDLILKALTKTQQWVFLQNCHLATSFMPRLCTIVESFNSPNVTIDPEFRLWLSSKSYSSFPIPVLKKGLKIAVESPQGLKSNLLQTFGCTGSGEVTEEIFENPDCGQWWKKLLFSLCFFNAVINERKNYGILGWNIAYKFNSSDLGVAIKVLENSLRGQPSISWQALRYLIGEVIYGGRVIDNWDKRCLKTLLYKFCNPEVLKDDFSFSRSASIKDYIHIIQSLPDDDLPEVLGIHPEAIRSCWETQGEKFIENLIAMQPKTTTANLMIRPEQSKDELVMEILSDLLKRLPLTVEKEEIAVGTPSTLKSMMSSSIWESLSKNLKDHDPLIHCVLLTFLKQEIKRFDKLLFVIHKSLKDLQLAIKGEIILTQELEEIFNSFLNMRVPTLWQKHAYRSCKPLSSWIDDLIQRLNFFNTWAKVAYTAIQRRYMRFVTVWKQSIPSTSQKCKHPEDSENNFFEGFPSRYWLPAFFFPQAFLAAVLQDYGRSRGIAVDALTFTHHVISNTTDKDEKFSVFMPKKLNIVRRAFKGSASSHTGVYIFGLFIEGARWNREQKILEDSLPLEMCCDFPDIYFLPTKISTKTPNASNQTDSELYAFECPVYQTPERSRILATTGLPTNFLTSVYLSTKKPPSHWITMRVALLCEKNEK
"
     misc_feature    3174..4382
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="Dynein heavy chain, N-terminal region 2; Region:
                     DHC_N2; pfam08393"
                     /db_xref="CDD:203929"
     misc_feature    4743..5426
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="Hydrolytic ATP binding site of dynein motor region
                     D1; Region: AAA_6; pfam12774"
                     /db_xref="CDD:193250"
     misc_feature    7464..8114
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    8172..8909
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    8943..9947
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="Microtubule-binding stalk of dynein motor; Region:
                     MT; pfam12777"
                     /db_xref="CDD:193253"
     misc_feature    10014..10685
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="ATP-binding dynein motor region D5; Region: AAA_9;
                     pfam12781"
                     /db_xref="CDD:193257"
     misc_feature    11262..13748
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /note="Dynein heavy chain and region D6 of dynein motor;
                     Region: Dynein_heavy; pfam03028"
                     /db_xref="CDD:145919"
     variation       224
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192193099"
     variation       270
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61745064"
     variation       282
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201634729"
     exon            293..432
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       327
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372136045"
     variation       342
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:41267347"
     variation       380
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369460884"
     variation       413
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372589152"
     variation       417
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375259141"
     exon            433..582
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       459
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374296761"
     variation       505
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377514534"
     variation       510
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201089763"
     variation       512
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373709305"
     variation       551
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376453640"
     variation       556
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199833408"
     variation       571
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202149727"
     exon            583..713
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       585
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370168340"
     variation       624
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192345324"
     variation       648
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367728866"
     variation       655
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41267349"
     variation       656
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371936326"
     variation       675
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202121833"
     variation       691
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200184686"
     variation       700
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:79645812"
     variation       711
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376849940"
     exon            714..866
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       717
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375791690"
     variation       756
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370187831"
     variation       757
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201807754"
     variation       806
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732752"
     variation       825
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199814205"
     variation       843
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370749461"
     variation       858
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372706704"
     exon            867..982
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       954
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374672388"
     exon            983..1045
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       1024
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374048564"
     variation       1045
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192523416"
     exon            1046..1190
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       1046
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80297033"
     variation       1057
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201201605"
     variation       1132
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189576156"
     exon            1191..1322
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       1220
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149893393"
     variation       1270
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183952944"
     variation       1294
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74149431"
     exon            1323..1573
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       1366
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181331399"
     variation       1428
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75568712"
     variation       1486
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376817319"
     variation       1531
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185076105"
     exon            1574..1703
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            1704..1983
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       1763
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201098114"
     variation       1775
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2501107"
     variation       1796
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12059619"
     variation       1947
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376558673"
     variation       1953
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145346250"
     variation       1974
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371575718"
     exon            1984..2029
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            2030..2127
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       2036
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140788075"
     exon            2128..2294
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       2152
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191493695"
     variation       2166
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78320839"
     exon            2295..2639
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       2328
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140164319"
     exon            2640..2981
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       2697
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3105559"
     variation       2759
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182582660"
     variation       2763
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58506089"
     variation       2768
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185235980"
     variation       2797
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12081290"
     variation       2849
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375285772"
     exon            2982..3351
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       2986
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373262464"
     variation       3007
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115366080"
     variation       3015
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188000179"
     variation       3064
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369341655"
     variation       3125
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372916173"
     variation       3186
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113707090"
     variation       3195
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73133544"
     variation       3244
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3128651"
     variation       3247
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3128652"
     variation       3294..3295
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34842437"
     variation       3328
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:115240788"
     variation       3337
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370909788"
     exon            3352..3542
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       3420
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202046747"
     variation       3510
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3128655"
     variation       3525
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201015646"
     exon            3543..3788
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       3545
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3128658"
     variation       3620
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367566298"
     variation       3624
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201011780"
     exon            3789..3910
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       3862
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371522012"
     exon            3911..4082
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       4030
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3105571"
     exon            4083..4187
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            4188..4306
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       4232
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375097364"
     variation       4286
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74147113"
     variation       4296
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113651787"
     exon            4307..4381
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       4315
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372412698"
     variation       4345
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199634734"
     variation       4367
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150618371"
     exon            4382..4672
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       4387
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202118490"
     variation       4388..4389
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:138066581"
     variation       4389
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75827633"
     variation       4453
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201843941"
     variation       4493
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116052053"
     variation       4498
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200017807"
     exon            4673..4904
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       4701
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148730700"
     variation       4752
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372717757"
     variation       4786
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201873499"
     variation       4787
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73133596"
     variation       4857
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41307682"
     variation       4870
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142356826"
     exon            4905..4958
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            4959..5104
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5056
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370823006"
     variation       5072
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704151"
     variation       5077
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="ttaa"
                     /db_xref="dbSNP:80023327"
     variation       5092
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149056614"
     exon            5105..5173
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5130
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115743416"
     variation       5143
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78335375"
     exon            5174..5360
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5185
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17578819"
     variation       5195
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188496398"
     variation       5211
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375432909"
     variation       5220
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191860318"
     variation       5339
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139949596"
     variation       5340
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183567269"
     variation       5341
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143916022"
     exon            5361..5437
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5382
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190061594"
     variation       5416
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369373571"
     exon            5438..5594
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5480
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190863487"
     exon            5595..5684
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5670
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78614986"
     exon            5685..5819
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5723
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374309666"
     variation       5764
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61851487"
     variation       5765
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371171947"
     variation       5775
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150319745"
     variation       5793
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6679852"
     variation       5797
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370410795"
     exon            5820..6035
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       5820
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143317903"
     variation       5834..5835
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35786206"
     variation       5885
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200638575"
     variation       5960
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187487970"
     variation       5984..5987
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:144339803"
     variation       5986
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191528375"
     variation       5999
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184059928"
     variation       6025
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146658863"
     exon            6036..6126
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6063
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373487478"
     variation       6074
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192601701"
     variation       6102..6104
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="gtt"
                     /db_xref="dbSNP:148326046"
     exon            6127..6335
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6169
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367559558"
     variation       6215
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370179144"
     variation       6282
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143058170"
     exon            6336..6588
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6455
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368687409"
     variation       6478
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191968010"
     variation       6514
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375449724"
     variation       6557
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200519891"
     exon            6589..6667
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6608
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370991538"
     variation       6667
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370328139"
     exon            6668..6897
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6722
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201526391"
     variation       6723
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200064799"
     variation       6735
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184912210"
     variation       6788
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189747207"
     variation       6868
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371854981"
     variation       6872
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180868605"
     exon            6898..6945
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6930
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374859085"
     variation       6931
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190087833"
     variation       6941
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181105903"
     exon            6946..7062
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       6954
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376690622"
     exon            7063..7221
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7098
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149061712"
     variation       7145
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370676245"
     variation       7221
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373790753"
     exon            7222..7354
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7237
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303311"
     variation       7238
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79504221"
     variation       7285
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187694467"
     exon            7355..7419
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            7420..7607
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7503
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201372112"
     variation       7519
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76767146"
     variation       7575
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371011826"
     exon            7608..7736
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7640
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138408664"
     variation       7651
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4653415"
     exon            7737..7868
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7808
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200968726"
     variation       7831
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375530989"
     variation       7842
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143552249"
     exon            7869..8036
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       7897
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186548606"
     variation       7972
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368246646"
     variation       7987
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191923388"
     variation       8022
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201910052"
     exon            8037..8207
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8080
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191811978"
     variation       8140
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375254049"
     exon            8208..8405
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8214
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371563812"
     variation       8349
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374829542"
     variation       8370
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181126197"
     variation       8379
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369228896"
     exon            8406..8567
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8426
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369507297"
     variation       8493
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373274946"
     variation       8515
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375908462"
     variation       8537
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369335225"
     exon            8568..8759
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8625
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140066130"
     variation       8682
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371705535"
     exon            8760..8941
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8860
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116490173"
     variation       8865..8866
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:141365402"
     variation       8917
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189545024"
     exon            8942..9050
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       8947
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112172758"
     variation       8963
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377569460"
     variation       8967
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200518833"
     exon            9051..9176
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9067
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369223685"
     variation       9079
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183261121"
     exon            9177..9271
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9186
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10495237"
     variation       9187
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371972178"
     variation       9221
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374773665"
     variation       9226
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191667479"
     variation       9261
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140440496"
     exon            9272..9431
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9276
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375847465"
     variation       9289
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200333099"
     variation       9321
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369930943"
     variation       9324
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371882986"
     exon            9432..9563
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9491
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145601562"
     exon            9564..9659
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9594
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373139697"
     variation       9606
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200310916"
     variation       9619
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145100008"
     exon            9660..9800
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9699
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377611333"
     variation       9702
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78999515"
     variation       9724
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188862661"
     variation       9733
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303992"
     variation       9744
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185348183"
     exon            9801..10016
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       9874
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113335252"
     variation       9909
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41268715"
     exon            10017..10247
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       10024
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199848334"
     variation       10132
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370139767"
     variation       10137
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374469779"
     variation       10155
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187150031"
     variation       10163
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367756955"
     variation       10188
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200311669"
     exon            10248..10369
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       10349
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56918103"
     exon            10370..10614
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       10386
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184094753"
     variation       10394
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3856145"
     variation       10394
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:377250670"
     variation       10400
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115148958"
     variation       10507
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6686504"
     variation       10551
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12184324"
     exon            10615..11033
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       10635
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6667999"
     variation       10682
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12742757"
     variation       10690
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200532024"
     variation       10694
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374323375"
     variation       10720
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148023906"
     variation       10767
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369673460"
     variation       10786
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373712140"
     variation       10812
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74147200"
     variation       10830
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370632234"
     variation       10861
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201079664"
     variation       10882
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17522489"
     variation       11010
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200671919"
     exon            11034..11232
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       11070
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12565381"
     variation       11095
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7527925"
     variation       11096
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:55725527"
     variation       11145
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187598699"
     variation       11190
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116404408"
     variation       11200
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73136911"
     variation       11224
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7535953"
     exon            11233..11469
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       11247
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12408617"
     variation       11273
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142089541"
     variation       11360
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368419004"
     variation       11367..11368
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34473543"
     variation       11392
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144674097"
     exon            11470..11555
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       11498
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192354509"
     exon            11556..11712
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       11579
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368426392"
     variation       11649
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190452224"
     variation       11660
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79877014"
     variation       11690
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373469864"
     variation       11706
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182215041"
     exon            11713..11923
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       11747
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370191299"
     variation       11796
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146438399"
     variation       11820
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141105896"
     variation       11829
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111504201"
     variation       11835
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373470844"
     exon            11924..12026
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     exon            12027..12254
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12032
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11578981"
     variation       12033
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372806779"
     variation       12039
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141510580"
     variation       12051
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147045964"
     variation       12122
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12737248"
     variation       12199
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74149905"
     exon            12255..12444
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12265
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112206346"
     variation       12270
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115803833"
     variation       12309
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374597184"
     variation       12317
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368211863"
     variation       12340
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201754277"
     variation       12376
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375272804"
     variation       12394
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199565083"
     exon            12445..12625
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12495
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190428375"
     variation       12502
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3856154"
     variation       12535..12536
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:369640978"
     variation       12539
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369062643"
     variation       12552
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75794192"
     variation       12553
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:76375603"
     variation       12560
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3856155"
     variation       12593
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181625725"
     exon            12626..12789
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12635
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74517776"
     variation       12744
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114941345"
     exon            12790..12986
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12799
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141334390"
     variation       12846
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374542052"
     variation       12908
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254532"
     variation       12946
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:950210"
     exon            12987..13099
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       12993
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146075975"
     variation       13045
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370919219"
     variation       13064
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375801560"
     exon            13100..13239
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       13126
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190910110"
     exon            13240..13400
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       13252
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61739997"
     variation       13273
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371543296"
     variation       13334
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376675287"
     variation       13340
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61738690"
     variation       13356
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372266024"
     variation       13367
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372569939"
     variation       13385
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2275600"
     exon            13401..13547
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       13409
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375100667"
     variation       13453
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41304131"
     variation       13466
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147317659"
     variation       13481
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181716749"
     variation       13493
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372710071"
     variation       13546..13547
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34522483"
     exon            13548..13788
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /inference="alignment:Splign:1.39.8"
     variation       13576
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115162236"
     variation       13599
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115414058"
     variation       13637
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16844837"
     variation       13693
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114514795"
     variation       13763
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:41305733"
     variation       13770
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77901289"
     variation       13780
                     /gene="DNAH14"
                     /gene_synonym="C1orf67; Dnahc14; HL-18; HL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377610536"
ORIGIN      
agggcgcaggcgtggctcttggtcaggcggttacggccaggaggcgtcggagcctggcgtggtagggctgtgctgcgcggtccttcccattcaccctagtctggcgctcgccggcgtgggcgggccggaccttcgccgcttccaggaagggccacaacggccgtcggaccacggcgcggcggccagttcctttatagttttgttcagaaaaacatatggagacgtttatacccattgatttgacaactgaaaatcaagagatggacaaggaggaaaccaagacaaaaccaagacttttaagatatgaagagaaaaaatatgaagatgtgaaaccattagagactcaaccagctgaaatagcagaaaaggaaacattggaatataaaacagttagaacattctctgaatctttgaagtcagagaaaacagaagattaccttagagaaagtataattcaacaacatatggtttctccagagccagcttcccttaaggagaaagggaagtcaaggagaaaaaaggatcaaactcatgcttgtccaaatgttaggaaagccaggcctgtgtcctatgatagaacagaaccaaaagatgatgatgtgataagaaatattattaggctacgagaaaagcttggttggcaaactatattaccgcagcacagtttgaaatacggaagctccaaaattgcaattcagaagattactttaaagaaacctttggaagatgatggagaatttgtttattgccttcctcggaaaagtcctaaatccctttacaatccatatgatcttcaggtagtatcggctcatactgctaaacattgcaaagaattttgggttattactgcttcatttatctcaaaggttattaatatagttggtagtgtaaaggaagtagaactcatacctactttggaatggctatcagaaagaagacattactatttattacggcaattcaagatattttctgatttccgaatgaataaagcatttgttacctggaaattgaatgttaaaagaattaagacagagaagagcaggtcatttttgtaccaccatctttttttggctgatgacttgtttcaaacctgtttggtttatataagaggactttgtgaagatgcaattaatctcaaaaattataatgaccatgaaaataatctatctgccatatgccttgtaaagctggatagttctcgaacatattctctagatgaattttgtgaagagcagttacagcaagctacccaggcattgaaacaacttgaggacatcaggaataaagcaatttcagagatgaaaagtacttttctaaaggttgcagaaaagaatgaaatcaaagagtattttgagtcaaaactctctgaagatgacacaacacatttcaagctgcctaaatatagacgtttattagaaacatttttcaagtttgtaatgctggttgactacatatttcaggaactcattcgtcaacttatgaacactgcagtcacactacttttggaattatttaatggttctgctggaatgccattttcagtggaaaaaaagaatgaaaatcttatcagaacattcaaggacaactcttttcctactggaaagacaacaaatgattgtgaagaacttgttgataattcaaagttacatgctatttctgttcaaaagtcagaagtaaaaacagacactgatattaatgagattttgaatagtgttgaagtggggaaggatttgagaaaaacatatgcaccaatatttgaagtaaatctatgcttgagaattcctgctgagagtgattcttcagaaaattctaaagagaactttcatgagtctgaccagtgccctgaagagtgtgtgatgtttgaagatgaaatgtcagaaaataaagacaattgtgtcaaaaaacactcaagtgaagaattgctcccaaaagccaagaaatcaaaagaaattagttacaatcttgaagatattatttcagacacagaaattgagactgagtttgagaataaatacatgtattatgaatttccagaatttcctacaaatctctttatagatcccaacagattggagttttcagtaaaaattcaaaatatgttgactaatatggaaaaatgtataaccacaattactcctctttgccaagatccccagctgtctatcttcattgatttggtttcaataatggatttacctaataagacaggaagcataatacattataaagagcagaccagatggccagattgtcacatcctttttgaaacagatcctgcctaccaaaatataattgtgaatctcctgactattattggtaattcaatgggcctagttaatgcttacagccacaagtttataaagtattgtaccatgacagaaaaggccaaaatcatgagtatgaaaatatcatctatgggagaattaacttcaaaagaatttgaagctattctaaatagattcagaaactattttagacatattgtgaatatggccattgagaagcgtattggtattttcaacgttgtaagtcttgattatcaatcagaatgcttactgtatattgacaacgtcatacatatgagccacaccctcatacaatctgtaattgaaaaaaagaacaaaaatttattggaagttgtggaatcatcattgcagcagctggaatgtgatcccactgaaatagaagaatttctggagcattttatttttttgaatgcaatttcctcaaaaatatctaaattagaaaaagagttcttaacaatgtctcagctatattctgttgcaaagcatcaccagatccatatttcagaagagcaaattgccatattccaagttcttcttcttaagtttagtcaactaaaatcatctatgaagttaagtaaaataaataaagacactgctataactaaattcagagataacttggaagcatgtatcagtggtctacatgttgatgttggcaatttaaaagccaagataagaactcctcttctgttatgtgctggtactcaagtgtcaacagcaatggaaatgatccagactctctcaggggaagctgcaagtttaactaacaaagctaaagcatattcacattatcaggattgtttcagtgattctcaatctcatatgcattctgttaatgtggaagaaattacacagattgtgctttcagagatctctgacattgaaggtgacttgactttgaggaaaaaactatgggaagcacaagaggagtggaagcgagcctcttgggaatggaggaatagttctcttcaaagtattgatgtagaatcagtacagagaaatgtttcaaaactgatgcacataatctcggtactagaaaaaggtttacctaaaagcgatatggtaacacatcttaagcaagtggtaacagagtttaaacaagagctgcctatcattatagctctgggaaatccctgtctcaagccaaggcattgggaggctctccaggagattattgggaagtcagttccgcttgataaaaactgtaaagtagagaatcttctagctctcaagatgtttcagtatgaaaatgaaataaatgatatgtcaacctcagcaactaatgaagctgctcttgaaaaaatgctatttaagattattgatttttggaacactactcctttgcctttaattcttcaccacacagagatttactctatcttcataattccatctatagatgacatatcagctcagttagaagagtctcaagtcatacttgcaacaattaaaggatctccccacattgggcccattaaggatcttgtgaatgaatgggatcaaaacttgactctcttctcttacacccttgaggaatggatgaattgtcaaagaaattggctttatcttgaaccagtctttcattcttcagaaatacgaaggcaactcccagcagaaacagaacttttctctcaagtgatttccatgtggaaaaaaataatgtcaaaaatacaaaacaaacagaatgctttgcagataaccacttctgcaggagtccttgaaattctgcaaaattgtaatatacatcttgaacatataaagaaaagccttgaggattaccttgaagttaaaagattaattttcccaagattttactttcttagcaatgccgagcttcttgatattctagctgatagcagaaatcctgagtctgtacagcctcatcttgtgaaatgctttgaaaatataaaacaattattgatatggaaacaagacattggccctcctgctgtaaaaatgctaatatctgctgaaggggaaggtctcgtgctgccaaagaaaattcgtgtaagaagtgctgtagaacagtggctggtaaatgtagaaaaaagcatgttcgatgtgctaaaaaaagagagatatatatataacattatcttactttttcagagccagatcatgttttataatgattgtgttaaaagttttgtgagttcttattcaagagaaaaattggaaaaagtccacgctggtctgatgtgtcatctagaagaggttgcagacctggtagtgctggatactagtaactctcgaacaaaagctatactaggggcattgcttatcctttatgttcactgcagagatatagtgataaatttactacttaaaaatatcttcaatgcagaggattttgagtggacaagacatttgcaatataaatggaatgaaaaacaaaagttgtgctatgtgtctcaaggaaatgccagctttacttatggctatgagtacttgggctgtacctcaagattggttattacgcctctcacagaccgatgctggctgactctcatggaagcactacacttgaatctaggaggctgtcctgccggtccagctggtacaggaaaaactgagactgtcaaagatctagcaaaatccttaggcaaacattgtgtggtcttcaactgttttgaggatttggattataagatagtgagaaaatttttctttggactagttcagtcaggagcatggagttgttttgatgaattcaatctaattgatttggaagttctctctgtcattgcctcacagatcctaacaattaaggctgcaaaagacaactattctgccaggtttgtactggaaggaaaagaaattcgtatcaatatgtcttgtgcggtatttatcaccatgaatcccagatacggaggtggagtagagctcccagataacttaaaatctctgtttcgcccagtggcaatgatggtgccccattatcaaatgattgctgaaataatattgttttcatttggtttcaaatctgcaaattcactctctggaaagctaactaacctttatgaattagcgcgcaaacagctctcacaacaggatcattataattttggcttgagatctctgaagatagttttaataatggctggaacgaagaaacgggagtttaaatgtctttctgaagcagatgaaaccttgattgttatcgaggctataagagaagctagtttgccaaaatgtcctcctgaagatgtcccactttttgaaaatattataggagatatttttccagaagtgacagttttgaaagtaaatcaacttgccttggagaaagtaatatatactgcaactcagcaattgggtttacaaaactggtcatctcagaaagagaagattatacagttttataatcaacttcaggtttgtgttggtgtgatgttagtgggcccaacaggtggaggaaagacaacagtcagaagaattttggaaaaagcattaacgctattaccaattgcagacttcttatcagttgcagaaagaaaatctgcttcaaagatttcagaaagaaaaggaaaagtagatatttgtgttttaaatccaaagtgtgtcactctcagtgaactatatggacaactggatcctaatactatggaatggactgatggattattatcagcaacaattcgaagttatgtatattttaacacaccaaagaacacaaagaaagacattgatctcagactaaagtcaagaatctcagatttatccaatgttttcaaacttgattcctctgatacaacagagactgatgataatatttttgaggagatagagaaagttgttaaaattccagaaaatcacaattttgattggcagtggattatcctagatggcccagtggacaccttttgggtagaaaatctgaactctgtgctagatgatactagaacattgtgcctagcaaacagtgagagaatagctttaactaataaaataagagtgatttttgaagtggacaatctctctcaggccagtcctgctactgtcagccgatgtgccatggtctatatggatcctgttgatctgggatgggaaccttatgttaagtcatggcttctgaaaacttctaaaattataagtcaatcaggagtggattgtcttgaattcatgattaaaaatagtgtcacagacggactacaatttataaggaatcgtcagaaatttcagccatatcctatggaggacataacagtcgtcataaccctctgcagaattcttgatgctttctttgacttcatgggtaaaaatggaggatttgaacaaagtgatgatttgaatgacacgtcatctaaggaggcaaattcccaaagagagtctgtcacattcaaggatatagaaaagagggatgaaaatacatggtatccagagaaaaatcctgataaattaacaaaaattattcaaaagctttttgtgtttgcctttacttgggcatttggaggagctttaaaccgtgaagatgaacacagagaaaatataccattttgtcccagtcttgaacctgattctcttgcaaaagtaacatacgattttgacaaacttgttcatgaattatttggaaacagttcacaagtaggatggaagcactggggtcagtcacagggcagacggagaaaggggaactgcatcaacctaccaactggtgaatgttccatctttggatattttgtggatatagagcaatgtgaattcataccttggtcagatttagttcctaatgatcagacactaattcaaagaggaacttcattactaactaatcttcaaagatctggcggaaacttcttgaagataacagaatgtggagaatgcattaattataccgctaccagagacacaacatgcctttcttttctcatgagccttcttttaaagaattcctgccctgtacttctcacaggagaatctggtgttgggaaaactgctgccattaatcaaatgcttgaaaagctagagggtccaggagcatttgacataaaacatggttcaattttaggagacaccctattatatagtgaaataaaaaaatcaagtagcctaaaacagaatatcaccatcttgattcctgaaactcataagacagcaactggaagttcagataatcccactaaaaagccagaagttagaactaataaaaagttacttaaaaataatgatcataaaggagttgtagtctctacaataaattttagcaccaatgtaacagctgccaaaaccaaggagatgattcttaagaagttaataagaagaactaaagatactcttggagcaccaaaaaacaaccggattctaatatttattgatgatatgaatatgccagtatcagatatgtatggagcacagccacccctggaattgataagacaattgttagatttgggaggagtttatgatactgaaaaaaatacatggaagaatattcaagatctgtctatagttgcagcttgtgttccagttgtgaatgatatcagcccacgtcttctcaaacacttttccatgctggtattacctcatccttcacaagacatcttatgtactattttccaggctcatttgggaatttatttctccatcaataacttcacacctgaagttcagaaaagtaaggatcagataatatcttgttccctagctatataccatcaagtacgtcagaatatgttaccaactccaacaaaatgtcactacatgtttaatcttcgagatatgtttaagcttctcctaggattgctgcaagctgacaggactgttgttaactccaaagagatggctgctctgctctttgttcatgaagccacccgagtatttcacgatcgcttaattgatttcactgataaaagccttttctatcggttgctttcaagggaacttgagaactgttttcagattggaatagatggatgtgggaaaaaaacatgtgcaaccttggcctgttatttgacagataataaactataccgagtgcctatatctcacaaatgtgcctacatcgaattcaaagaagtctttaaaaaggtgtttattcacgcaggattaaaagggaaacccactgttctgatggttcccaatttaaacatagaacaagactcatttttagaagatttgaactacatcatcagttcaggaagaatacctgacctgtttgaaaatgttgagctggattctattgcaatgaaaatcagatatcttactgaacaatctggtcatatggataataggcaatctttactttcattctttcaaaagagaatatataaaaatcttcatatttttgtgatcatgagtcctgaaggacctagcttccgccaaaattgtagagtgtatccttctatgattagctcctgcacgatcgattggtatgagaggtggccagaagaagctctccttattgtagctaactcattcttaaaagaaaaggtcaattttgagaacagagagaacttgaaagaaaaacttgccccaacatgtgtccaaatccacaaaagcatgaaagacttgaacagaaaatactttgaagaaactggaagattttattataccactcccaatagctacttgcaatttatggaaacatttgcacacattttgagggcacgagaggaagagatgcaaacaaagagggatcgcttccatatgggtctatccacaatcctggaagcaaccactctagttacagaaatgcaagaagagctcttgattcttggccctcaagtagaacaaaaaacaaaggaaacagaaactctaatggaaaaactacggaaagattcacaagtagttgagaaagttcagatgcttgttaaacaggatgaagaaattgtggcagaagaagtaagaattgtggaagattatgctcagaaaactgccaatgaactaaaaagtgtgctgccagcctttgacaaggcaattgtggctctgaatgccctggataaagctgatgtcgctgaattaagagtatacacacggcctcccttccttgtactgactgtcatgaatgcagtgtgtattcttctgcaaaagaaacctaactgggcaacggcaaagttacttctttcagaaactggtttcctgaaaaaattgattaaccttgacaaggacagcatacctgataaggttttcgtgaagctaaaaaaaattgtaaccttacctgatttcaacccacacaagatttcgctggtttctgttgcttgttgctccctgtgccagtgggttatagctttgaataactaccatgaagtacagaaggttgtgggccctaaacaaatccaagtagctgaagctcaaaacgtccttaaaattgcgcgacaaagacttgctgagaaacaaagaggtttacagctggttgaagaacatttgctgtttttacaggcagcttacaaagataccgttgctgaaaaacaactattagcaaatcggaaaacaatggccagcaggcgctttcagtgtgcgtcagtcttactaactgtcctggaagatgagaagactcgatggcaagaaacaatcaatcaaatagataacaaattagaaggaattttgggtgacatacttctttcagcagcgtgcattgtctacagtggaattttaacaccagaatttcgccagttgattgtgaataaatgggagacattctgcattgaaaatggcatttctttgtcttccaaattctctttaattaaagttatggcacaaaaatatgagatcagccgatggcataatcagggactgcctcatggtcagtattcagtagagaatgccatcttgatcaagaatggccagcagtggccactgctgattgacccacataggcaagctcacaaatggatccgtcagatggaaggatccaggctgcagaagctctccattgaagacagcaattataccaaaaaaattgaaaatgctatgaagacaggagggagtgtcctcctgcagaatctccttgagacattagctccaggcttaaaggcaattctgaaaaaggatatctatcagaaaaaaggacactatttcataagggttggtgatgctgagttcgaatacaattcaaattttaggttatacttatctacagaaatagacaacccccattttcttccatcagtttataactttgttactatgatcaacttcactgtaacattccaaggtttgcaagatcaactcttgtctactgtggtaactcatgaagttcctcatttagaagatcaacgttccaagttactggagagtatttcccttgatgccataactcttgaagaactagaggaaaaaacattaaatttactgcagaaagcactaggatccatattagatgatgacaaaattgtagataccttaagaaaatccaaaatgacatcaaacgaaatttcaaagcgcatcgaagcaacaaaaaaagctgaaagtgaaatccaagcaatacgtaaaaactatctccccattgcgacccgaggcgccctgctctacttcctagtagctgatctcacacaaatcaactacatgtaccagttctccctagactggtttcatcaggtttttgtttcatcagtagtttccaaaagcaaagaacaagaacatagttttaaaagggagaaagtgtctccaaaagaagttcatgagtttataagtatttcaaaagaacccaacctggaaaatgagaaaaatctcttagataagcatattaaaagtgcaatagacatgttgacaaaaagtatttttaaggtggtttcttcagctctatttaatgaagataaactttgcttctcttttcggctttgcactgtaatcatgcaaaacaatgctaatggaaatctaatacaggatgacattggattcctaccagaagaagaatggaacatctttttatattctggcatattgataaatattaaaagtgcattatcccagtctagacttactagcacatttgaaataggtgaaagtcaacatcttcagtggctgtcagattccaggtggaggcagtgccaatatgtcagcactcacctggaaccattttcacttctgtgcaaatcccttttatcaaacgtatcacaatgggatacttttaagaacagtaaagcagtttattctctgatcagcacacctttctcttcagaaaatgcttcattggaggaaaatacaaaaccaccagaggaaactgaacttttgaatgaaaataaagaaacgtgtaatcctataaattttccctgggagaaactcacttcatttcaaagacttattttggtaaaagttcttagaccagaaagtttaaacaattcagtgagaaagtttataactgaaaaaatgggaaataagtatcttcaaagaactggagttaatttgaaagatgcatataaaggatccaatgccagaactccgctgatacttattcaaactcatgggatcgaccttaccaatatcctcctgagatttgcacaagagttaaaaggaacaacacatcatgtgaccataatttctctgggccgtgaccaagcagctaaagctgaagacctcattttaaaggcactaacaaaaacacaacaatgggtcttcctccagaactgccatcttgcaacatcatttatgccaaggctttgcacaattgtagaatcttttaatagtccaaacgtgacaatagaccctgagtttcggctatggttaagctcaaaatcatacagttcttttccaattcctgttcttaaaaagggtttaaagattgccgtggaatctccccagggattgaaaagtaacttacttcagacatttggatgtactgggagtggagaggtaacagaagagatatttgaaaatcctgactgtggacaatggtggaaaaaacttttatttagcctatgttttttcaatgctgtaatcaatgaaagaaaaaattacggaatattgggctggaatattgcttataaatttaattcttcagacttgggggttgccattaaggtgttggaaaattccctgagaggacagcccagcatttcgtggcaagcactgcgctacctgattggagaagtgatttacggtggccgggtgattgataattgggacaagcgatgcttgaagaccctactctacaaattttgtaatcctgaagtgctgaaagatgacttcagtttctccagatctgcaagcataaaggactacatacacattatccagtccttacctgatgatgaccttcccgaggtcttaggaatacacccagaggccatcaggagctgctgggagacccagggcgaaaagtttattgaaaatctgattgccatgcaaccaaaaactaccactgccaacctcatgatcagacctgagcagagtaaggatgaactggtgatggaaattctatccgacttgctaaagcggctgccactgacagtggagaaagaagaaattgctgttggaactccaagcacattgaagagcatgatgtcaagctccatttgggagtctctttctaaaaatctcaaagatcacgacccccttatccattgtgtcttgctaacctttttgaagcaagaaattaaacgatttgataagttattatttgtcatacataaatccttaaaagatcttcagcttgctataaaaggagagatcatcctcacccaagaattggaggaaatatttaactcttttcttaatatgagagtgcctacattgtggcagaaacacgcctacagatcttgtaagccactgagttcctggattgatgatctcatccagcgactgaatttcttcaatacttgggccaaagtggcttatactgcaatacagcgtcggtatatgagatttgtcacagtttggaagcagtctattccatcaactagccaaaaatgcaaacaccctgaggattcagagaacaatttctttgaagggtttccttcaagatactggctcccagctttcttctttccacaagcctttcttgctgctgtgcttcaagactatgggaggtcccgaggaatcgctgtggatgccctcaccttcacccaccatgtgatttccaacaccactgacaaggatgagaagttctccgtatttatgccaaagaaactcaacatagtcaggagagcgtttaagggctcagcttcctctcacactggagtttacatttttggtttattcatcgagggggcaagatggaatcgtgaacagaaaatactggaagactcgctgcctctggagatgtgctgtgattttcccgacatatactttttgccaacaaagatttctaccaaaacaccaaatgcttccaaccagacagattcagaactctatgcttttgaatgcccagtttaccagacacctgagaggtcaagaattttggcaactaccggtttaccaacaaactttttaacatcagtgtatttatcaacgaagaaacctcctagtcactggatcacaatgcgggttgcattgctttgtgagaagaatgaaaaataaatgtccatatcaaaccattttaatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:127602 -> Molecular function: GO:0003777 [microtubule motor activity] evidence: IEA
            GeneID:127602 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:127602 -> Biological process: GO:0007018 [microtubule-based movement] evidence: IEA
            GeneID:127602 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
            GeneID:127602 -> Cellular component: GO:0030286 [dynein complex] evidence: IEA
            GeneID:127602 -> Cellular component: GO:0035085 [cilium axoneme] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.