GGRNA Home | Help | Advanced search

2020-10-30 19:53:15, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001370              12795 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dynein, axonemal, heavy chain 6 (DNAH6), mRNA.
ACCESSION   NM_001370
VERSION     NM_001370.1  GI:194353965
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 12795)
  AUTHORS   Pazour,G.J., Agrin,N., Walker,B.L. and Witman,G.B.
  TITLE     Identification of predicted human outer dynein arm genes:
            candidates for primary ciliary dyskinesia genes
  JOURNAL   J. Med. Genet. 43 (1), 62-73 (2006)
   PUBMED   15937072
REFERENCE   2  (bases 1 to 12795)
  AUTHORS   Venter,J.C., Adams,M.D., Myers,E.W., Li,P.W., Mural,R.J.,
            Sutton,G.G., Smith,H.O., Yandell,M., Evans,C.A., Holt,R.A.,
            Gocayne,J.D., Amanatides,P., Ballew,R.M., Huson,D.H., Wortman,J.R.,
            Zhang,Q., Kodira,C.D., Zheng,X.H., Chen,L., Skupski,M.,
            Subramanian,G., Thomas,P.D., Zhang,J., Gabor Miklos,G.L.,
            Nelson,C., Broder,S., Clark,A.G., Nadeau,J., McKusick,V.A.,
            Zinder,N., Levine,A.J., Roberts,R.J., Simon,M., Slayman,C.,
            Hunkapiller,M., Bolanos,R., Delcher,A., Dew,I., Fasulo,D.,
            Flanigan,M., Florea,L., Halpern,A., Hannenhalli,S., Kravitz,S.,
            Levy,S., Mobarry,C., Reinert,K., Remington,K., Abu-Threideh,J.,
            Beasley,E., Biddick,K., Bonazzi,V., Brandon,R., Cargill,M.,
            Chandramouliswaran,I., Charlab,R., Chaturvedi,K., Deng,Z., Di
            Francesco,V., Dunn,P., Eilbeck,K., Evangelista,C., Gabrielian,A.E.,
            Gan,W., Ge,W., Gong,F., Gu,Z., Guan,P., Heiman,T.J., Higgins,M.E.,
            Ji,R.R., Ke,Z., Ketchum,K.A., Lai,Z., Lei,Y., Li,Z., Li,J.,
            Liang,Y., Lin,X., Lu,F., Merkulov,G.V., Milshina,N., Moore,H.M.,
            Naik,A.K., Narayan,V.A., Neelam,B., Nusskern,D., Rusch,D.B.,
            Salzberg,S., Shao,W., Shue,B., Sun,J., Wang,Z., Wang,A., Wang,X.,
            Wang,J., Wei,M., Wides,R., Xiao,C., Yan,C., Yao,A., Ye,J., Zhan,M.,
            Zhang,W., Zhang,H., Zhao,Q., Zheng,L., Zhong,F., Zhong,W., Zhu,S.,
            Zhao,S., Gilbert,D., Baumhueter,S., Spier,G., Carter,C.,
            Cravchik,A., Woodage,T., Ali,F., An,H., Awe,A., Baldwin,D.,
            Baden,H., Barnstead,M., Barrow,I., Beeson,K., Busam,D., Carver,A.,
            Center,A., Cheng,M.L., Curry,L., Danaher,S., Davenport,L.,
            Desilets,R., Dietz,S., Dodson,K., Doup,L., Ferriera,S., Garg,N.,
            Gluecksmann,A., Hart,B., Haynes,J., Haynes,C., Heiner,C.,
            Hladun,S., Hostin,D., Houck,J., Howland,T., Ibegwam,C., Johnson,J.,
            Kalush,F., Kline,L., Koduru,S., Love,A., Mann,F., May,D.,
            McCawley,S., McIntosh,T., McMullen,I., Moy,M., Moy,L., Murphy,B.,
            Nelson,K., Pfannkoch,C., Pratts,E., Puri,V., Qureshi,H.,
            Reardon,M., Rodriguez,R., Rogers,Y.H., Romblad,D., Ruhfel,B.,
            Scott,R., Sitter,C., Smallwood,M., Stewart,E., Strong,R., Suh,E.,
            Thomas,R., Tint,N.N., Tse,S., Vech,C., Wang,G., Wetter,J.,
            Williams,S., Williams,M., Windsor,S., Winn-Deen,E., Wolfe,K.,
            Zaveri,J., Zaveri,K., Abril,J.F., Guigo,R., Campbell,M.J.,
            Sjolander,K.V., Karlak,B., Kejariwal,A., Mi,H., Lazareva,B.,
            Hatton,T., Narechania,A., Diemer,K., Muruganujan,A., Guo,N.,
            Sato,S., Bafna,V., Istrail,S., Lippert,R., Schwartz,R., Walenz,B.,
            Yooseph,S., Allen,D., Basu,A., Baxendale,J., Blick,L., Caminha,M.,
            Carnes-Stine,J., Caulk,P., Chiang,Y.H., Coyne,M., Dahlke,C.,
            Mays,A., Dombroski,M., Donnelly,M., Ely,D., Esparham,S., Fosler,C.,
            Gire,H., Glanowski,S., Glasser,K., Glodek,A., Gorokhov,M.,
            Graham,K., Gropman,B., Harris,M., Heil,J., Henderson,S., Hoover,J.,
            Jennings,D., Jordan,C., Jordan,J., Kasha,J., Kagan,L., Kraft,C.,
            Levitsky,A., Lewis,M., Liu,X., Lopez,J., Ma,D., Majoros,W.,
            McDaniel,J., Murphy,S., Newman,M., Nguyen,T., Nguyen,N., Nodell,M.,
            Pan,S., Peck,J., Peterson,M., Rowe,W., Sanders,R., Scott,J.,
            Simpson,M., Smith,T., Sprague,A., Stockwell,T., Turner,R.,
            Venter,E., Wang,M., Wen,M., Wu,D., Wu,M., Xia,A., Zandieh,A. and
            Zhu,X.
  TITLE     The sequence of the human genome
  JOURNAL   Science 291 (5507), 1304-1351 (2001)
   PUBMED   11181995
  REMARK    Erratum:[Science 2001 Jun 5;292(5523):1838]
REFERENCE   3  (bases 1 to 12795)
  AUTHORS   Maiti,A.K., Mattei,M.G., Jorissen,M., Volz,A., Zeigler,A. and
            Bouvagnet,P.
  TITLE     Identification, tissue specific expression, and chromosomal
            localisation of several human dynein heavy chain genes
  JOURNAL   Eur. J. Hum. Genet. 8 (12), 923-932 (2000)
   PUBMED   11175280
REFERENCE   4  (bases 1 to 12795)
  AUTHORS   Vaughan,K.T., Mikami,A., Paschal,B.M., Holzbaur,E.L., Hughes,S.M.,
            Echeverri,C.J., Moore,K.J., Gilbert,D.J., Copeland,N.G.,
            Jenkins,N.A. and Vallee,R.B.
  TITLE     Multiple mouse chromosomal loci for dynein-based motility
  JOURNAL   Genomics 36 (1), 29-38 (1996)
   PUBMED   8812413
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC096770.3, AC109827.4, AC098975.3 and AC010087.3.
            
            Summary: Dyneins are microtubule-associated motor protein complexes
            composed of several heavy, light, and intermediate chains. Two
            major classes of dyneins, axonemal and cytoplasmic, have been
            identified. DNAH6 is an axonemal dynein heavy chain (DHC) (Vaughan
            et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025082, ERS025084
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-129               AC096770.3         101853-101981
            130-362             AC096770.3         103217-103449
            363-536             AC096770.3         110963-111136
            537-799             AC096770.3         114302-114564
            800-1067            AC096770.3         129631-129898
            1068-1202           AC096770.3         132666-132800
            1203-1323           AC096770.3         132890-133010
            1324-1453           AC096770.3         133686-133815
            1454-1622           AC096770.3         135287-135455
            1623-1739           AC096770.3         138316-138432
            1740-1940           AC096770.3         143133-143333
            1941-2061           AC096770.3         158865-158985
            2062-2213           AC096770.3         162655-162806
            2214-2366           AC096770.3         164925-165077
            2367-2618           AC096770.3         169397-169648
            2619-2747           AC096770.3         174224-174352
            2748-2861           AC096770.3         179370-179483
            2862-3005           AC096770.3         181044-181187
            3006-3218           AC096770.3         189737-189949
            3219-3311           AC096770.3         190898-190990
            3312-3431           AC096770.3         192374-192493
            3432-3612           AC109827.4         1395-1575
            3613-3709           AC109827.4         6607-6703
            3710-3929           AC109827.4         9406-9625
            3930-4094           AC109827.4         10912-11076
            4095-4208           AC109827.4         11159-11272
            4209-4334           AC109827.4         13986-14111
            4335-4490           AC109827.4         14186-14341
            4491-4652           AC109827.4         14623-14784
            4653-4790           AC109827.4         24225-24362
            4791-4958           AC109827.4         26931-27098
            4959-5107           AC109827.4         30151-30299
            5108-5215           AC109827.4         31668-31775
            5216-5771           AC109827.4         43040-43595
            5772-5894           AC109827.4         44381-44503
            5895-6077           AC098975.3         1874-2056
            6078-6221           AC098975.3         2608-2751
            6222-6443           AC098975.3         12871-13092
            6444-6591           AC098975.3         13910-14057
            6592-6749           AC098975.3         15909-16066
            6750-6881           AC098975.3         20587-20718
            6882-7053           AC098975.3         24939-25110
            7054-7200           AC010087.3         201312-201458       c
            7201-7274           AC010087.3         200227-200300       c
            7275-7429           AC010087.3         198191-198345       c
            7430-7661           AC010087.3         192304-192535       c
            7662-7814           AC010087.3         189057-189209       c
            7815-7955           AC010087.3         187050-187190       c
            7956-8198           AC010087.3         185445-185687       c
            8199-8366           AC010087.3         183222-183389       c
            8367-8602           AC010087.3         182482-182717       c
            8603-8864           AC010087.3         181037-181298       c
            8865-8988           AC010087.3         179765-179888       c
            8989-9185           AC010087.3         179068-179264       c
            9186-9389           AC010087.3         177238-177441       c
            9390-9515           AC010087.3         176372-176497       c
            9516-9680           AC010087.3         173525-173689       c
            9681-9748           AC010087.3         171157-171224       c
            9749-9929           AC010087.3         168400-168580       c
            9930-10109          AC010087.3         163980-164159       c
            10110-10343         AC010087.3         158882-159115       c
            10344-10479         AC010087.3         153205-153340       c
            10480-10649         AC010087.3         141535-141704       c
            10650-10840         AC010087.3         123839-124029       c
            10841-11001         AC010087.3         105131-105291       c
            11002-11090         AC010087.3         101974-102062       c
            11091-11237         AC010087.3         101028-101174       c
            11238-11376         AC010087.3         99482-99620         c
            11377-11496         AC010087.3         90359-90478         c
            11497-11618         AC010087.3         89126-89247         c
            11619-11748         AC010087.3         80990-81119         c
            11749-11876         AC010087.3         78242-78369         c
            11877-12062         AC010087.3         74258-74443         c
            12063-12135         AC010087.3         73654-73726         c
            12136-12287         AC010087.3         72662-72813         c
            12288-12510         AC010087.3         70701-70923         c
            12511-12795         AC010087.3         67195-67479         c
FEATURES             Location/Qualifiers
     source          1..12795
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2p11.2"
     gene            1..12795
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="dynein, axonemal, heavy chain 6"
                     /db_xref="GeneID:1768"
                     /db_xref="HGNC:2951"
                     /db_xref="MIM:603336"
     exon            1..129
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    <1..107
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="CpG_island (%GC=58.1, o/e=0.78, #CpGs=18)"
     variation       3
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148405625"
     misc_feature    123..125
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="upstream in-frame stop codon"
     exon            130..362
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     CDS             138..12614
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="dynein, axonemal, heavy polypeptide 6; dynein heavy
                     chain-like 1; ciliary dynein heavy chain 6; axonemal beta
                     dynein heavy chain 6"
                     /codon_start=1
                     /product="dynein heavy chain 6, axonemal"
                     /protein_id="NP_001361.1"
                     /db_xref="GI:194353966"
                     /db_xref="CCDS:CCDS46348.1"
                     /db_xref="GeneID:1768"
                     /db_xref="HGNC:2951"
                     /db_xref="MIM:603336"
                     /translation="
MTFRATDSEFDLTNIEEYAENSALSRLNNIKAKQRVSYVTSTENESDTQILTFRHITKAQEKTRKRQQPIKLEPLPVLKVYQDHKQPEYIHEQNRFQLMTAGIIKRPVSIAKKSFATSSTQFLEHQDAVKKMQIHRPYVEVFSPSPPKLPHTGIGKRGLFGTRSSAYPKYTFHDREEVVKANIRDPLQIIKIIRENEHLGFLYMIPAVPRSSIEYDTYNLKVVSYENINKNDYYTISQRAVTHIYNEDIEFIEIDRWEQEYLYHRELTKIPIFSLFRKWKAFSVWRKNVRSKKITGCQKSLQKNLFIVNPHLRPALLKINELCYHLSFMGLCYIEKCHTYTLQEFKAAQVIRLAEVTERLGEFRNEAKYVVRRACRFALRAAGFVPDDCAFGPFEDYHKVQSSGSFINTPHELPTYGDSEKMTYTEQASKRHYCMRLTCFIRLNDYLIENTMHILTVNAVNSLLNHLTDKLKRTPSADVIQKWITEEKPEVPDKKGTLMVEKQEEDESLIPMFLTELMLTVQSLLFEPSLEDFLDGILGAVNHCQNTVLSVPNLVPDSYFDAFTSPYINNKLEGKTCGTGPSLAAVFEDDKNFHTIISQIKETIQAAFESARIYAATFEKFQIFFKENESLDLQALKLQEPDINFFSEQLEKYHKQHKDAVALRPTRNVGLLLIDTRLLREKLIPSPLRCLEVLNFMLPRQSKKKVDAIIFEAQDAEYKLEFVPTTTTEYVHSLLFLDEIQERIESLEDEGNIVTQMYKLMEQYQVPTPPEDFAVFATMKPSIVAVRNAIDKSVGDRESSIKQFCVHLGSDLEELNNEVNEVKLQAQDPQILDISADQDKIRLILNNLQSVLADLQKRAFQYKSYQKNFKVEVSKFEALEEVSAELKLKQLLWDSFSEWDKLQQEWLKSKFDCLDPEVLNGQVSKYAKFVTQLEKGLPPNSVVPQLKYKVEKMKEKLPVIIDLRNPTLKARHWAAIEQTVDATLVDAEIPLTLERLSQLHVFDFGQEIQDISGQASGEAALEAILKKVEDSWKTTEFVILPHRDSKDVFILGGTDDIQVLLDDSTINVATLASSRYLGPLKTRVDEWQKQLALFNQTLEEWLTCQRNWLYLESIFNAPDIQRQLPAEAKMFLQVDKSWKEIMRKVNRLPNALRAATQPGLLETFQNNNALLDQIQKCLEAYLESKRVIFPRFYFLSNDELLEILAQTRNPQAVQPHLRKCFDSISKLEFALMPPAEGKIPGIDGEPEKVYTNDILAMLSPEGERVSLGKGLKARGNVEEWLGKVEEAMFTSLRRLCKAAIADYQGKLRTDWVVAGHPSQVILTVSQIMWCRDLTECLETEHSNHIQALKNFEKVNFERLNALAAIVQGSLPKLHRNILTALITIDVHARDIVTELVQSKVETVESFDWQRQLRYYWDIDLDNCVARMALSQYTYGYEYLGACPRLVITPLTDRCYLCLMGALQLDLGGAPAGPAGTGKTETTKDLAKALAIQCVVFNCSDGLDYKMMGRFFSGLAQSGAWCCFDEFNRIDIEVLSVIAQQLITIRNAKAAKLSRFMFEGREIKLVMTCAAFITMNPGYAGRTELPDNLKALFRPFAMMVPNYALIAEVILYSEGFESSKILARKMTQMYKLCSEQLSQQDHYDFGMRAVKSVLVMAGSLKRENPDLNEDVVLIRALQDSNLPKFLTDDALLFSGIISDLFPGVQIPEHDYGILQSTIVDVMNRQNLQPEMCMVRKVIQFYETMLVRHGVMLVGPTGGGKTTVYRILAETLGNLQKLGIENSFYQAVKTYVLNPKSITMGELYGEVNNLTLEWKDGLMALSVRAAVNDTSEDHKWIISDGPVDALWIENMNTVLDDNKMLCLANSERIKLTPQIHMLFEVQDLRVASPATVSRCGMVFVDPEELKWMPYVKTWMKGISKKLTEETQEYILNLFQRYVDEGLHFINKKCSQAIPQVDISKVTTLCCLLESLILGKDGVNLAMEQTKLNTILCQTFVFCYLWSLGGNLTENYYDSFDTFIRTQFDDNPDARLPNSGDLWSIHMDFDTKRLDPWERIIPTFKYNRDVPFFEMLVPTTDTVRYGYLMEKLLAVKHSVLFTGITGVGKSVIAKGLLNKIQESAGYVPVYLNFSAQTSSARTQEIIESKLERKRKNILGAPGNKRIVIFVDDLNMPRLDRYGSQPPIELLRQYQDFGGFYDRNKLFWKEIQDVTIISACAPPGGGRNPVTPRFIRHFSMLCLPMPSEHSLKQIFQAILNGFLSDFPPAVKQTASSIVEASVEIYNKMSVDLLPTPAKSHYVFNLRDLSKCVQGILQCDPGTIREEIQIFRLFCHECQRVFHDRLINNEDKHYFHVILTEMANKHFGIAIDLEYFLNKPIIFGDFIKFGADKADRIYDDMPDIEKTANVLQDYLDDYNLTNPKEVKLVFFQDAIEHVSRIARMIRQERGNALLVGVGGTGKQSLTRLAAHICGYKCLQIELSRGYNYDSFHEDLRKLYKMAGVEDKNMVFLFTDTQIVVEEFLEDINNILNSGEVPNLFEKDELEQVLAATRPRAKEVGISEGNRDEVFQYFISKVRQKLHIVLCMSPVGEAFRSRCRMFPSLVNCCTIDWFVQWPREALLSVSKTFFSQVDAGNEELKEKLPLMCVNVHLSVSSMAERYYNELRRRYYTTPTSYLELINLYLSMLSEKRKQIISARDRVKNGLTKLLETNILVDKMKLDLSALEPVLLAKSEDVEALMEKLAVDQESADQVRNTVQEDEATAKVKAEETQAIADDAQRDLDEALPALDAANKALDSLDKADISEIRVFTKPPDLVMTVMEAISILLNAKPDWPSAKQLLGDSNFLKRLLEYDKENIKPQILAKLQKYINNPDFVPEKVEKVSKACKSMCMWVRAMDLYSRVVKVVEPKRQKLRAAQAELDITMATLREKQALLRQVEDQIQALQDEYDKGVNEKESLAKTMALTKARLVRAGKLTAALEDEQVRWEESIQKFEEEISNITGNVFIAAACVAYYGAFTAQYRQSLIECWIQDCQSLEIPIDPSFSLINILGDPYEIRQWNTDGLPRDLISTENGILVTQGRRWPLMIDPQDQANRWIRNKESKSGLKIIKLTDSNFLRILENSIRLGLPVLLEELKETLDPALEPILLKQIFISGGRLLIRLGDSDIDYDKNFRFYMTTKMPNPHYLPEVCIKVTIINFTVTKSGLEDQLLSDVVRLEKPRLEEQRIKLIVRINTDKNQLKTIEEKILRMLFTSEGNILDNEELIDTLQDSKITSGAIKTRLEEAESTEQMINVAREKYRPVATQGSVMYFVIASLSEIDPMYQYSLKYFKQLFNTTIETSVKTENLQQRLDVLLEQTLLTAYVNVSRGLFEQHKLIYSFMLCVEMMRQQGTLSDAEWNFFLRGSAGLEKERPPKPEAPWLPTATWFACCDLEESFPVFHGLTQNILSHPISIRLGSFETYINPQKWEGYSKMKHEDKHMRQEKEAAHQDPWSAGLSSFHKLILIKCCKEEKVVFALTDFVIENLGKQFIETPPVDLPTLYQDMSCNTPLVFILSTGSDPMGAFQRFARESGYSERVQSISLGQGQGPIAEKMVKDAMKSGNWVFLQNCHLAVSWMLAMEELIKTFTDPDSAIKDTFRLFLSSMPSNTFPVTVLQNSVKVTNEPPKGLRANIRRAFTEMTPSFFEENILGKKWRQIIFGICFFHAIIQERKKFGPLGWNICYEFNDSDRECALLNLKLYCKEGKIPWDALIYITGEITYGGRVTDSWDQRCLRTILKRFFSPETLEEDYKYSESGIYFAPMADSLQEFKDYIENLPLIDDPEIFGMHENANLVFQYKETSTLINTILEVQPRSSTGGEGKSNDEIVQELVASVQTRVPEKLEMEGASESLFVKDLQGRLNSLTTVLGQEVDRFNNLLKLIHTSLETLNKAIAGFVVMSEEMEKVYNSFLNNQVPALWSNTAYPSLKPLGSWVKDLILRTSFVDLWLKRGQPKSYWISGFFFPQGFLTGTLQNHARKYNLPIDELSFKYSVIPTYRDQAAVIEAAKTVQFGQELPMDMELPSPEDGVLVHGMFMDASRWDDKEMVIEDALPGQMNPVLPVVHFEPQQNYKPSPTLYHCPLYKTGARAGTLSTTGHSTNFVVTVLLPSKRSKDYWIAKGSALLCQLSE
"
     misc_feature    138..4436
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: Stem (By similarity)"
     misc_feature    2766..4049
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Dynein heavy chain, N-terminal region 2; Region:
                     DHC_N2; pfam08393"
                     /db_xref="CDD:203929"
     misc_feature    4437..5129
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Hydrolytic ATP binding site of dynein motor region
                     D1; Region: AAA_6; pfam12774"
                     /db_xref="CDD:193250"
     misc_feature    4437..5102
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 1 (By similarity)"
     misc_feature    5280..5981
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 2 (By similarity)"
     misc_feature    5379..5816
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    6309..7055
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 3 (By similarity)"
     misc_feature    6393..6833
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="The AAA+ (ATPases Associated with a wide variety of
                     cellular Activities) superfamily represents an ancient
                     group of ATPases belonging to the ASCE (for additional
                     strand, catalytic E) division of the P-loop NTPase fold.
                     The ASCE division also includes ABC; Region: AAA; cd00009"
                     /db_xref="CDD:99707"
     misc_feature    6423..6446
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Walker A motif; other site"
                     /db_xref="CDD:99707"
     misc_feature    order(6426..6449,6627..6629,6774..6776)
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:99707"
     misc_feature    6615..6632
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Walker B motif; other site"
                     /db_xref="CDD:99707"
     misc_feature    6810..6812
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="arginine finger; other site"
                     /db_xref="CDD:99707"
     misc_feature    7359..8114
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 4 (By similarity)"
     misc_feature    7392..8171
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl09099"
                     /db_xref="CDD:213113"
     misc_feature    8163..9020
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: Stalk (By similarity)"
     misc_feature    8205..9203
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Microtubule-binding stalk of dynein motor; Region:
                     MT; pfam12777"
                     /db_xref="CDD:193253"
     misc_feature    9258..9950
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="ATP-binding dynein motor region D5; Region: AAA_9;
                     pfam12781"
                     /db_xref="CDD:193257"
     misc_feature    9261..9953
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 5 (By similarity)"
     misc_feature    10350..12602
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /note="Dynein heavy chain and region D6 of dynein motor;
                     Region: Dynein_heavy; pfam03028"
                     /db_xref="CDD:145919"
     misc_feature    10662..11327
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9C0G6.3);
                     Region: AAA 6 (By similarity)"
     variation       148
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372068392"
     variation       157
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372631706"
     variation       190
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78906097"
     variation       276
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373341060"
     variation       289
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191436678"
     variation       297
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147725081"
     variation       300
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112166113"
     variation       316
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373097900"
     variation       338
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74441077"
     exon            363..536
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       458
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73945104"
     variation       518
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138781200"
     exon            537..799
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       544
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76200524"
     variation       558
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4832089"
     variation       571
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186886112"
     variation       589
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191347930"
     variation       620
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112895082"
     variation       656
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376060265"
     variation       660
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371570938"
     variation       688
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374433871"
     variation       699
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377655156"
     variation       718
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371090965"
     exon            800..1067
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       838
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201050826"
     variation       898
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186642706"
     variation       923
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037863"
     variation       1010
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1542477"
     exon            1068..1202
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1073
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201462081"
     variation       1075
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373968372"
     exon            1203..1323
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1275
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141384152"
     variation       1276
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200299504"
     exon            1324..1453
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1408
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148515102"
     variation       1451
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372850589"
     variation       1453
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376004002"
     exon            1454..1622
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1462
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145235960"
     variation       1472
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140826351"
     variation       1491
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145502308"
     variation       1495
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369051691"
     variation       1505
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372969433"
     variation       1522
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116693971"
     variation       1523
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369526342"
     variation       1552
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191771194"
     variation       1553
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376201549"
     variation       1554
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143013494"
     variation       1555
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148362906"
     variation       1598
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373466088"
     exon            1623..1739
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1624
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202069726"
     variation       1625
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370761967"
     variation       1645..1647
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:143228855"
     variation       1646..1648
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:372232599"
     variation       1652
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:80065523"
     variation       1663
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150860106"
     variation       1713
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201365086"
     exon            1740..1940
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1752
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143854392"
     variation       1772
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368614268"
     variation       1784
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372742567"
     variation       1800
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139773637"
     variation       1811
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377138529"
     variation       1813
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377150769"
     variation       1868
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376234785"
     variation       1893
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145091842"
     variation       1910
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142159263"
     variation       1916
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368239086"
     variation       1924
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140274144"
     exon            1941..2061
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       1955
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11891970"
     variation       1956
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200763341"
     variation       1971
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138935163"
     variation       1978
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368300777"
     variation       2021
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143747599"
     variation       2023
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143890721"
     variation       2046
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372323736"
     variation       2056
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375321850"
     exon            2062..2213
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       2078
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374717865"
     variation       2107
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368818978"
     variation       2115
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373473966"
     variation       2122
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200384069"
     variation       2157
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140763000"
     variation       2167
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199597073"
     variation       2192
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139871925"
     variation       2196
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149725294"
     variation       2203
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149416280"
     variation       2207
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373773886"
     exon            2214..2366
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       2226
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200777363"
     variation       2287
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116398232"
     variation       2307
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142042706"
     variation       2309
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189028150"
     variation       2316
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140577999"
     variation       2353
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138502803"
     variation       2364
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147579173"
     exon            2367..2618
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       2392
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144590580"
     variation       2400
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368997613"
     variation       2404
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4365474"
     variation       2427
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200199170"
     variation       2433
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201732868"
     variation       2471
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148485387"
     variation       2484
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201519849"
     variation       2486
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148274182"
     variation       2489
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371239071"
     variation       2509
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146269930"
     variation       2513
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144088765"
     variation       2589
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111548143"
     variation       2618
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370047676"
     exon            2619..2747
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       2677
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187892187"
     variation       2684
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006244"
     exon            2748..2861
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            2862..3005
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            3006..3218
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3029
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188063631"
     variation       3061
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148924050"
     variation       3122
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372076428"
     variation       3168
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376933349"
     exon            3219..3311
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3240
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371746639"
     variation       3265
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375805606"
     variation       3272
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369939678"
     variation       3286
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112860062"
     exon            3312..3431
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3338
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375395506"
     variation       3417
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377717833"
     exon            3432..3612
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3470
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78195380"
     variation       3471
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77290709"
     variation       3594
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201711823"
     exon            3613..3709
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            3710..3929
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3720
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186487111"
     variation       3729
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373745652"
     variation       3784
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367551290"
     variation       3831
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61743118"
     variation       3843
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140817718"
     exon            3930..4094
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       3989
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372593504"
     variation       3998
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369285821"
     variation       4018
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185981876"
     variation       4038
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148175693"
     variation       4067
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:59416718"
     exon            4095..4208
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4129
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61733547"
     exon            4209..4334
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4217
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184975005"
     variation       4230
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189880586"
     variation       4244
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79995344"
     variation       4280
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147825378"
     exon            4335..4490
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4349
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201374146"
     variation       4382
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199886756"
     variation       4454
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200595645"
     variation       4458
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377624167"
     exon            4491..4652
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4495
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368034415"
     variation       4588
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371932584"
     variation       4608
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373671347"
     variation       4634
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186168135"
     exon            4653..4790
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4663
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185075586"
     variation       4748
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7570005"
     variation       4749
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375217652"
     variation       4751
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368207170"
     variation       4754
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61730451"
     exon            4791..4958
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       4925
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146868345"
     variation       4928
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185420002"
     variation       4947
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190713918"
     exon            4959..5107
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       5021
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376423303"
     variation       5063
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184617830"
     exon            5108..5215
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       5110
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200389898"
     variation       5139
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369999856"
     variation       5159
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374289611"
     variation       5185
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377654226"
     exon            5216..5771
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       5218
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:28375417"
     variation       5220
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190676628"
     variation       5272
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35974426"
     variation       5286
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374813787"
     variation       5303
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193035649"
     variation       5377
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370463710"
     variation       5397
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202136418"
     variation       5468
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12992282"
     variation       5503
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145592163"
     variation       5544
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62164301"
     variation       5602
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367621391"
     variation       5681
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184618019"
     exon            5772..5894
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       5843
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371043888"
     exon            5895..6077
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       5915
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184856337"
     variation       6072
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368634619"
     exon            6078..6221
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6116
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192155875"
     variation       6172
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199962095"
     variation       6182
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371429757"
     exon            6222..6443
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6227
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:17025400"
     variation       6411
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191274389"
     variation       6437
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17708884"
     exon            6444..6591
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6475
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189001242"
     variation       6493
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17025409"
     variation       6509
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1881095"
     exon            6592..6749
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6639
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147786546"
     variation       6658
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200462540"
     variation       6664
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201284092"
     exon            6750..6881
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6756
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34481428"
     variation       6785
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182098392"
     variation       6827
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376746872"
     variation       6831
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370582561"
     exon            6882..7053
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       6940
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17025464"
     exon            7054..7200
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            7201..7274
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       7201
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199849546"
     variation       7228
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200155419"
     exon            7275..7429
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            7430..7661
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       7458
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187451809"
     variation       7490
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192295"
     variation       7561
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372085815"
     variation       7585
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200809496"
     variation       7588
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375406101"
     variation       7593
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192985305"
     variation       7619
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367964205"
     variation       7620
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367980247"
     exon            7662..7814
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       7668
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192046214"
     variation       7682
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371762116"
     variation       7737
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374890236"
     variation       7746
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73943384"
     variation       7759
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183315670"
     variation       7786
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78190897"
     exon            7815..7955
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       7815
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:193184813"
     variation       7826
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184604697"
     variation       7843
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146306207"
     variation       7844
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113665519"
     variation       7853
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74514752"
     variation       7894
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369172853"
     exon            7956..8198
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       7980
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147111953"
     variation       8006
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186318126"
     variation       8007
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376075459"
     variation       8088
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371507847"
     variation       8112
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199554362"
     variation       8113
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377482915"
     variation       8123
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371105811"
     variation       8134
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200844717"
     exon            8199..8366
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       8361
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368104186"
     exon            8367..8602
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       8381
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367557876"
     variation       8457
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372830371"
     variation       8467
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375995981"
     variation       8468
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201102990"
     variation       8512
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369839712"
     variation       8559
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372020176"
     variation       8568
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375086278"
     exon            8603..8864
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       8646
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372727336"
     variation       8682
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141919655"
     variation       8713
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61750773"
     variation       8718
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369106994"
     variation       8757
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187596306"
     variation       8768
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373061751"
     variation       8769
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377025265"
     variation       8783
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371228644"
     variation       8829
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192269"
     variation       8854
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377609051"
     variation       8855
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145771341"
     variation       8859
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17025503"
     exon            8865..8988
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            8989..9185
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       8990
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148344852"
     variation       9016
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201375253"
     variation       9116..9117
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34474341"
     variation       9169
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367947746"
     exon            9186..9389
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9291
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78958502"
     variation       9345
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375106276"
     exon            9390..9515
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9394
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61752525"
     variation       9395
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77959060"
     variation       9438
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374317130"
     variation       9474
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368674123"
     exon            9516..9680
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9537
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368254114"
     variation       9563
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200543388"
     variation       9573
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72832548"
     variation       9582
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375347429"
     variation       9595
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145820890"
     variation       9605
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369442226"
     exon            9681..9748
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9713
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376401136"
     exon            9749..9929
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9770
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201371333"
     variation       9871
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371653866"
     variation       9890
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192344"
     exon            9930..10109
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       9944
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146647563"
     variation       9983
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373569654"
     variation       10070
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376618965"
     exon            10110..10343
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       10162
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188849403"
     variation       10172
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192574147"
     variation       10229
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368501478"
     exon            10344..10479
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       10370
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72832550"
     variation       10378
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184222126"
     variation       10388
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372138940"
     variation       10395
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114604025"
     variation       10410
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201811286"
     variation       10423
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140837015"
     variation       10434
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187550990"
     variation       10451
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200384774"
     exon            10480..10649
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       10525
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13424518"
     variation       10550
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61731722"
     variation       10617
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199861827"
     variation       10630
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373163834"
     exon            10650..10840
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       10665
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201195733"
     variation       10800
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370077349"
     variation       10802
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373251921"
     variation       10815
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377266356"
     variation       10821..10822
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:36026413"
     exon            10841..11001
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       10968
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375931090"
     exon            11002..11090
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     exon            11091..11237
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11093
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373722767"
     variation       11099
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199755417"
     variation       11119
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202209954"
     variation       11134
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200079931"
     exon            11238..11376
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11290
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61752522"
     exon            11377..11496
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11405
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371744669"
     variation       11463
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61752556"
     exon            11497..11618
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11567
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192395"
     variation       11600
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371824266"
     variation       11605
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376523937"
     exon            11619..11748
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11655
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375596176"
     variation       11679
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77179930"
     variation       11698
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192646174"
     variation       11699
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75617902"
     exon            11749..11876
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11779
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61729434"
     variation       11806
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200449901"
     variation       11847
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376921541"
     variation       11857
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61753860"
     exon            11877..12062
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       11877
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201250087"
     variation       11975
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2276610"
     variation       12018
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190621406"
     variation       12029
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375640782"
     exon            12063..12135
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       12084
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202017484"
     exon            12136..12287
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       12155
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369895436"
     variation       12157
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367739383"
     variation       12166
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372051999"
     variation       12210
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61753631"
     variation       12226
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375076755"
     variation       12256
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369242190"
     exon            12288..12510
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       12339
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377569326"
     variation       12343
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371222574"
     variation       12384
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374162124"
     variation       12413
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377627098"
     variation       12428
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146806296"
     variation       12489
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72836490"
     exon            12511..12795
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /inference="alignment:Splign:1.39.8"
     variation       12518
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201871260"
     variation       12537
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373670688"
     variation       12556
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78316943"
     variation       12557
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7584208"
     variation       12564
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375209901"
     variation       12608
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114850401"
     variation       12609
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371875383"
     variation       12667
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148570622"
     variation       12705
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189935639"
     variation       12753
                     /gene="DNAH6"
                     /gene_synonym="Dnahc6; DNHL1; HL-2; HL2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367983902"
ORIGIN      
gcttccgtagaggccagctggttgctacgcagcaacaggaaacattccgcgctaccgagtactttctactcccgaccaggcattgctctctctggagaccctcggcggtggttgctgtattttgacttggagtaaggatgacttttcgggccacagatagtgaatttgacctgacaaatattgaagagtatgccgaaaattctgcactttcaagactgaataatataaaagccaaacaaagagtgagttatgtgacatccacagaaaatgaatctgatacacaaatcctaacgtttaggcacattacaaaagctcaggagaagacaagaaaacgacagcagcctataaaactagagcctttgccagtgctaaaagtctaccaagatcataagcagccagaatacatacatgaacagaaccgatttcagttaatgactgcaggaatcattaaacgtccagtaagcatagcaaaaaaaagttttgccacatcatctactcagtttcttgagcatcaagatgctgtgaaaaaaatgcagattcatcggccctatgttgaggtgttctctccctctcctcctaaactgccacatactggtattggaaaaagaggtctctttgggactagatcttcagcttaccctaagtacacttttcacgaccgagaagaagttgttaaagccaacattcgtgatcccttgcaaatcattaaaataatacgtgaaaatgaacatcttggatttctttatatgatccctgcagtgccaagatcatccattgaatatgatacatataatctaaaagttgtaagttatgagaacatcaataaaaatgactactatactattagccaaagggcagtaacacacatttataatgaagacattgaatttatcgaaattgatcgatgggaacaggaatatctgtatcacagagaactcactaagattcccatattttcactgttccggaaatggaaggcttttagtgtatggaggaagaatgtccgctccaagaaaatcactggatgtcaaaaatctctacaaaaaaatttgttcattgttaatcctcatttgcgaccagctcttcttaaaataaatgaattgtgttatcatttgagttttatgggactttgttatattgaaaagtgtcacacctacaccctgcaggaatttaaggccgcacaagtcatacggctagcagaggtgacagaacgcctaggagaatttcgaaatgaggcaaaatatgtagtcaggagggcttgtcgatttgctttgcgtgctgcaggatttgttcctgatgactgtgcatttggaccttttgaggattatcataaagtgcagagcagtggaagtttcattaatacaccacatgagttgcccacttatggagactctgagaaaatgacatatacagaacaggccagcaaaaggcattattgcatgaggctgacgtgctttattcgtctaaacgactatctaattgagaacacaatgcacatcttaacggtaaatgctgttaattcgcttttgaaccatctcactgacaagctaaaacgaacaccttcagcagatgtcattcagaaatggattactgaagagaagcctgaagtccctgataaaaaggggacccttatggtggaaaagcaagaagaagatgaatctctcatccccatgtttctcacagaactaatgttgacagtccagtcactgctctttgagccttctctggaagactttctggatggtattttgggtgcagttaatcactgtcaaaacactgtgttatcagttcctaatctcgtgcctgattcgtattttgatgctttcaccagcccttatattaacaacaaacttgaaggaaaaacctgtggaactgggccaagtttagcagcagtatttgaggatgataagaattttcacacaattatttctcaaataaaggaaaccattcaggccgcatttgaatcagcccgcatctatgcagctacctttgaaaagttccagatattcttcaaggaaaatgaaagtcttgatttacaagctcttaaacttcaggaacctgatattaacttttttagtgaacaactggaaaaatatcacaaacagcacaaggacgcagtagcgctcagacccaccagaaatgtaggattgctgctcattgatactaggcttctaagagaaaaattaattccatcacctttgcgatgcttagaggtgctaaattttatgcttcctcgtcaaagcaagaaaaaagtggatgccattatctttgaggcacaagatgcagagtataaacttgagtttgttccaactactaccacagaatatgttcatagcttattatttcttgatgaaattcaggaacggattgaaagccttgaagatgaggggaatatagtgactcaaatgtacaagcttatggaacaatatcaggtgcccacacctcctgaagactttgctgtttttgcaactatgaagccatccattgttgctgttcggaatgccattgataaatcagtgggtgatagagaatcaagcattaagcaattttgtgtgcatttgggtagtgatcttgaagaattaaacaacgaagtgaatgaagtaaaactgcaagcacaggatccacagattttagatatctctgctgaccaagacaaaataaggctcatattgaataatctgcaatctgttctggctgatcttcagaaacgtgcatttcagtataagtcctatcagaagaattttaaggtagaagtgtccaagtttgaagctttggaagaagtcagtgctgaactgaagctcaaacaattgctctgggattctttctctgaatgggataaactccaacaagaatggttaaagtccaaatttgattgcctggatccagaagtcctaaacggtcaagtttctaaatatgctaaatttgtgactcaactggaaaaaggcttgccacccaacagtgtagtgccccagctcaaatacaaggtggaaaaaatgaaagaaaagcttccagttatcattgacttgaggaacccgactttgaaggcaagacattgggcagctattgaacaaacagttgatgccactctagtggatgctgaaattccattaaccttggagaggctctcccagttgcatgtttttgactttggtcaagaaatccaggacatatctggacaggcttctggagaagctgccttagaagcaattcttaaaaaggtggaggactcttggaaaacaactgaatttgtcattctgcctcaccgtgactccaaagatgtgtttatactgggcggcacagatgacatacaggtccttcttgatgatagcaccatcaatgttgcaactcttgcctcatcacgttaccttggtccactgaaaactcgagtggatgaatggcaaaaacaacttgctttatttaatcaaacactggaagagtggctgacctgccagagaaactggctctacctagaaagtattttcaatgctccagacattcagaggcaattgcctgcagaggccaagatgttccttcaggtggataagtcatggaaagaaatcatgagaaaggtgaatcggctgcctaatgctcttcgagccgctactcagccaggacttctggaaacttttcaaaacaataatgcattacttgaccaaattcagaagtgcctagaggcatacttagaatcaaaaagagttatctttccaaggttttacttcttgtcaaatgatgaacttctggagattttggcccagacacgaaatccacaggccgtgcagccacacttaaggaaatgcttcgactccatttcaaagctcgaatttgctctcatgcctcctgccgaaggaaagattcctggtattgatggagaaccagaaaaggtttatactaatgatattttagcaatgctgtcaccagagggagaaagggttagcttggggaaaggcctcaaggcccgaggcaatgtagaggaatggcttggtaaagtggaagaagccatgttcacatctctgcgtcgcctgtgcaaagctgccatcgctgactatcaggggaaactgaggacagactgggtggttgctggccacccttctcaagttatcctgactgtttctcaaattatgtggtgccgtgatttgactgaatgtctggaaacagaacacagtaatcatatacaggccctgaagaattttgaaaaagtaaattttgagagattaaatgccctagctgcaatagttcaaggcagtcttcctaaattacacagaaacatcctaactgcattgattactattgatgtgcatgcaagagatatagtcactgaacttgttcaatccaaggtggagacagttgaatcttttgactggcagagacaactgcgctattactgggatatagacctggataattgtgtggctagaatggcgctctctcagtacacttatggctatgaatatttgggtgcatgcccaagattggttattactccactcacagatcgctgctatctttgcctcatgggagctttgcagcttgaccttgggggtgcaccagctggtcctgctggcactgggaaaacagagactaccaaagatctggcaaaagctcttgccatccagtgtgtggtctttaactgttcagatggtttggactacaagatgatggggcgcttcttcagtggcttggcacagtcaggggcctggtgctgctttgatgaatttaatcgaattgacatagaagttctgtccgtcatcgcgcagcaactcattaccattaggaacgccaaagcggcaaagctctctagattcatgtttgaggggcgggaaataaagttggtgatgacttgtgcagccttcatcacaatgaatcctggctatgcagggagaactgaattgccagataatttgaaagccctgtttagaccatttgcgatgatggttccaaattatgccttgattgcagaggtaattctatattctgaaggatttgaatccagtaaaatattagcaagaaaaatgactcagatgtataagctttgcagtgagcagctgtctcagcaggatcactacgactttggcatgagagctgtgaagtctgtcctggtcatggctggatctttaaaaagagaaaacccagacctaaatgaagatgtggtgttgataagagctttacaagactccaatttgccaaaatttctaacagatgatgctcttctgttcagtggaatcatatctgacctttttcctggagtccaaattccagaacatgattatggtattttacaatcaacaattgtggatgtcatgaatagacaaaatcttcagcctgagatgtgtatggttagaaaggtgatacagttttatgaaactatgctagtaaggcatggtgttatgttagtcgggccaacaggaggcggcaagaccacagtttaccgaatactagcagaaactttagggaatttacaaaaacttgggatagaaaattccttttaccaagcagttaaaacatatgttctcaaccctaaatcaattaccatgggtgaattatatggagaggttaataacttaaccttggaatggaaagatggtttgatggcactaagtgtccgagcagctgtgaatgatacttcagaagaccataaatggatcatcagtgatgggccagtagatgctctttggattgaaaacatgaatacagtgctggatgataacaagatgctttgcctggctaacagtgagaggattaaactcacacctcaaattcacatgctttttgaggtgcaagatctgcgggttgcctcccctgcaacagtcagtcgatgtggaatggtgtttgtggatcctgaagaactgaaatggatgccttatgttaaaacttggatgaagggtatttctaaaaaactgactgaggaaacccaagaatatatattgaatcttttccaacgttatgttgatgaaggtttacattttatcaataaaaagtgcagccaagcaattccacaagtggacatcagcaaagttactacactctgttgcttattggagtccttgatacttgggaaagatggagttaacttggcaatggaacaaacaaaattgaacactatactatgtcagacttttgtattctgttatttgtggtctttgggtggaaacctaactgaaaactactatgattcttttgatacatttattagaacacaatttgatgataatcctgatgccaggcttcccaattctggtgatctgtggagcattcatatggactttgacaccaaacggctggatccctgggaacgaatcatacctactttcaaatacaaccgagatgttccattttttgaaatgcttgtccccacaactgacacagtgcgctatgggtatctaatggaaaaactactggcagtcaagcattccgtgttgtttactggaataactggagtgggcaagtctgtgattgcaaaaggattgctaaataaaattcaagaatcagctggctatgtccctgtttatctaaatttttctgctcaaacttcatctgcaaggacacaagagatcattgagtcaaaactggagagaaaaagaaaaaatattctaggagcaccgggaaacaaacgaattgtgatttttgttgatgatttaaacatgcccagactggatcgctatggctctcagcctccgattgaattacttcggcagtatcaagattttgggggattttatgacagaaacaaactgttttggaaagaaatacaggatgtaacaatcatatcggcatgtgcacctccaggcggtggccgcaaccctgtgactccccgcttcatcagacacttcagcatgctgtgcctcccaatgccctcagagcacagtctgaaacagatttttcaggccatcttaaatggtttcctgagtgactttccaccagctgtaaagcaaactgcatcaagcattgtagaagcctcagttgagatttataacaaaatgagtgttgacctcctgccaacacccgccaagtcccattatgtctttaacttgagggacttatccaaatgtgtgcaaggtatcctccaatgtgatccaggaacaataagagaagaaattcagatatttagactcttttgccatgagtgccaaagggtcttccatgatcgcttgattaataatgaagataagcactatttccatgttattctgacagaaatggccaacaaacattttggaattgcaattgacctggaatattttttgaataagcccatcatatttggagatttcattaagtttggagcagataaagctgatcggatttatgatgacatgcctgatatagagaaaactgcaaatgttctacaggactatcttgatgattataatctcacaaatcccaaagaagtaaagttggtgttcttccaggatgctatagaacatgtttcaaggattgctcggatgatacgtcaagaaagaggcaatgccctgcttgttggagtaggaggcacaggaaagcagtcactcacgagacttgcagctcatatatgcggttacaaatgtttgcagattgaactcagccggggatataattatgatagttttcatgaagacctgaggaagttgtacaaaatggctggtgtagaagacaagaatatggttttccttttcactgacacccagattgtagtggaggagttcctagaagatataaataacatcctgaactcaggtgaagtgcctaatttatttgaaaaggatgaactggagcaggttttagcggccaccagaccaagagcaaaagaagtaggaatttctgaggggaacagagacgaggtgtttcaatactttatcagcaaagtgcgtcagaagctgcacattgttctctgcatgagcccagttggggaggcctttcggtcccgatgcaggatgtttccatcccttgtgaattgctgcaccattgactggtttgtgcagtggcccagagaagcacttctttctgtgtcaaagacatttttctcacaagtcgatgctggaaatgaagaactgaaagaaaagcttcccttgatgtgcgtgaacgttcacttgagtgtctccagcatggcagagcgctattacaatgagctgcgcaggcggtactacacgacacccacctcctacctggagcttatcaatctttacctgtctatgctgtctgaaaaaaggaagcagattatttcagcacgagatcgggtgaagaatggtctcaccaagctactagaaacaaacatactagtagataaaatgaaactagatctttcagctttagagcctgtacttttagcaaaatcagaagatgttgaagccctgatggaaaaattggcagtggatcaagaaagtgccgatcaggtccgtaacactgtgcaggaggatgaagcaacagcaaaagtcaaagctgaagaaacccaagcaatagctgatgatgctcaaagagatcttgacgaggcactacctgcactagatgctgccaataaagcactggattccttagataaggcagatatatctgaaatcagagtttttacaaagcccccagatttggtcatgacagtaatggaagcaatctccattcttttgaatgccaagcctgattggccatcagcaaagcaacttcttggtgactctaactttctaaaaaggcttttagaatatgataaggagaacataaagcctcagatattggcaaagcttcaaaagtatattaataatcctgattttgtgcctgaaaaagtggagaaagtgtccaaagcatgtaaatctatgtgcatgtgggtaagagctatggatttgtactctcgagtggtcaaggtcgtcgaaccaaaaagacaaaagctccgcgccgcacaggctgaacttgacattaccatggctaccctgagagaaaagcaagcattactaagacaagtagaagatcaaatacaggccttacaagatgaatatgacaaaggtgtaaatgaaaaagaaagcctggcaaagaccatggccctgacaaaagcacgtctagtacgtgctggaaagctgacagcagcattagaagatgagcaggttcgatgggaagaaagcatacagaagtttgaggaagaaatatcaaatatcactgggaacgtgttcatagcagcagcttgtgtggcctactatggggctttcacagcccagtacaggcagtcacttatagagtgttggatccaggactgtcagtctctggagatcccaatcgatccttccttcagtctcattaacattcttggagatccctacgagatacggcagtggaacactgatgggctgccccgtgacttgatatcaacagaaaatggcattttggttactcaaggcagaagatggcctttgatgattgatccccaagatcaggcaaaccgttggataaggaacaaggaaagcaaaagtggtttaaagatcattaagcttacagatagtaatttcttacgaatactcgagaattcaatccgacttggtttacctgtcttactggaagagcttaaggaaaccttggatccagctctagaacccattcttttgaaacaaatttttatcagtggtggccgactactcatccgtcttggagactcagacattgattatgacaaaaactttaggttctatatgacaaccaaaatgccaaatccccactatctgcctgaggtatgcattaaagttaccattatcaatttcactgtaacaaaatcaggcctggaggatcagttgttaagtgatgtggtgcgacttgaaaaacccaggttggaagaacaaagaattaagctcatcgtgaggatcaacactgataaaaaccagttgaaaactatcgaagagaaaatcctgagaatgctctttacctctgaaggaaatattctggacaatgaagaacttattgacacactccaggattcaaagatcacttctggtgccattaaaaccaggctggaagaagcagagtccactgagcagatgatcaatgtggctcgtgagaagtatcgtccagtggccactcaaggctctgtaatgtactttgtcattgcaagcctctcagaaatagatcctatgtaccagtactcattaaaatactttaaacagttgttcaataccaccattgaaacttctgtaaagacagaaaatctacaacagcgcctggacgtactactagaacaaactctcctaactgcttatgtcaatgtttcaagaggactttttgagcaacataaactcatctacagctttatgctttgtgttgagatgatgcgtcagcaaggaaccctatctgatgctgaatggaatttctttctccgaggttctgcaggattggaaaaggaacgcccacctaagcctgaagctccctggctacctactgctacatggttcgcatgctgtgacttggaagaatcatttccagtttttcacggacttacccaaaatatattgtcacatcctatttccatacgcttaggatcttttgagacttatattaacccacagaaatgggaaggctattctaaaatgaaacacgaagataaacacatgagacaggaaaaggaggcagcacaccaagatccatggagtgcaggattgagttctttccataagctaattcttattaaatgttgtaaagaagaaaaggtggtttttgctcttacagactttgtgatagaaaatcttggaaaacagtttatagagacaccacctgtggacctgcctaccctgtatcaagacatgtcatgcaacactcccctggtattcatcctaagcacaggctcagatcccatgggtgcatttcagaggtttgccagggaaagtggatattcagaacgggtgcagtcaatttcactggggcaaggacaaggacctattgctgaaaaaatggtcaaggatgcaatgaaatcaggaaactgggtatttttgcaaaattgccatcttgctgtttcttggatgttggcaatggaagagctcattaaaaccttcacagatccagatagtgctatcaaggacacttttcgactttttttaagctccatgcctagtaatacatttcctgttacagttcttcaaaattctgtcaaggtgaccaatgagcctccaaaaggcttacgtgcaaatatcagacgagcatttactgaaatgacaccttcgttttttgaagaaaatatacttggaaaaaaatggagacaaataatatttggcatttgtttcttccatgcaattattcaggagagaaagaagtttggcccccttggttggaatatctgctatgaatttaatgacagtgacagggaatgtgctttactgaatctcaaactctattgtaaagaaggaaagattccctgggatgcactaatttacattactggtgaaattacttatggtggtagagtcacagacagctgggaccaaagatgccttcgtactatcttgaaaagatttttttctcctgaaacattagaagaagattataaatactctgaatcaggcatctattttgcacccatggctgacagcctacaagagtttaaggactacattgaaaatctgcctttgatcgatgacccagaaatttttggaatgcatgaaaatgctaatctagtcttccagtacaaagagaccagcactttaatcaacaccatacttgaggttcagccaaggtcatctactggtggagagggaaaaagcaatgacgaaattgttcaagaacttgttgcttctgtccagaccagagttccagaaaaactggaaatggagggtgcttctgagagcctttttgtcaaggatcttcaaggacgtctgaactccttgaccaccgttcttggacaggaagtggaccggtttaacaacctgctgaagttaattcatacttctctggaaacactcaacaaagccatcgctggatttgtggtgatgtctgaagaaatggaaaaagtgtataacagtttcctcaacaaccaggttcccgctctgtggtccaacacagcctacccatccctgaagccactaggatcatgggtcaaagaccttatcctgaggacctcatttgtggatctgtggctcaaaagaggacagcctaagtcctactggatctctggtttcttctttcctcaaggatttctaacaggaactcttcaaaatcatgctcgaaaatacaatttgcctatagatgagctgagtttcaaatacagcgtaattcccacctatcgggatcaagctgcagtgatagaagctgccaagacagtgcaatttggacaagaactgcccatggacatggagttgccctctcctgaggatggtgttcttgttcatgggatgttcatggatgcttctcgatgggatgataaggagatggtgatagaagatgcattgcccggacagatgaatccagtgctgcctgtggtgcattttgaaccacaacaaaactataagccaagcccaacactttaccactgcccactttataaaacaggagcccgggcaggaacactctcaaccacaggacattcaaccaattttgtggtaaccgtcctgttaccctccaagcggtccaaagactactggattgccaagggatcagctttgctctgccagctgagcgaatgaaaaggtgccacctcagccctgaaaaagaaccaggccagagatctttcctaatgggagcaaaaggtttgaataatttatatgtgagcaaaacggtgttaattctgatttgacttaaacgtattgtgacttttatttctcttatgaccttaaaataaagtgtttgagttctttctgttggcaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1768 -> Molecular function: GO:0003777 [microtubule motor activity] evidence: NAS
            GeneID:1768 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:1768 -> Molecular function: GO:0016887 [ATPase activity] evidence: IEA
            GeneID:1768 -> Biological process: GO:0001539 [ciliary or bacterial-type flagellar motility] evidence: IEA
            GeneID:1768 -> Biological process: GO:0007018 [microtubule-based movement] evidence: IEA
            GeneID:1768 -> Cellular component: GO:0005858 [axonemal dynein complex] evidence: IEA
            GeneID:1768 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
            GeneID:1768 -> Cellular component: GO:0035085 [cilium axoneme] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.