2024-03-29 15:21:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001359 1251 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens 2,4-dienoyl CoA reductase 1, mitochondrial (DECR1), mRNA. ACCESSION NM_001359 VERSION NM_001359.1 GI:4503300 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1251) AUTHORS Chen Z, Tang H, Qayyum R, Schick UM, Nalls MA, Handsaker R, Li J, Lu Y, Yanek LR, Keating B, Meng Y, van Rooij FJ, Okada Y, Kubo M, Rasmussen-Torvik L, Keller MF, Lange L, Evans M, Bottinger EP, Linderman MD, Ruderfer DM, Hakonarson H, Papanicolaou G, Zonderman AB, Gottesman O, Thomson C, Ziv E, Singleton AB, Loos RJ, Sleiman PM, Ganesh S, McCarroll S, Becker DM, Wilson JG, Lettre G and Reiner AP. CONSRTM BioBank Japan Project; CHARGE Consortium TITLE Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network JOURNAL Hum. Mol. Genet. 22 (12), 2529-2538 (2013) PUBMED 23446634 REFERENCE 2 (bases 1 to 1251) AUTHORS Martins-de-Souza,D., Guest,P.C., Mann,D.M., Roeber,S., Rahmoune,H., Bauder,C., Kretzschmar,H., Volk,B., Baborie,A. and Bahn,S. TITLE Proteomic analysis identifies dysfunction in cellular transport, energy, and protein metabolism in different brain regions of atypical frontotemporal lobar degeneration JOURNAL J. Proteome Res. 11 (4), 2533-2543 (2012) PUBMED 22360420 REMARK GeneRIF: A protein encoded by this locus was found to be differentially expressed in postmortem brains from patients with atypical frontotemporal lobar degeneration. REFERENCE 3 (bases 1 to 1251) AUTHORS Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M., Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D., Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J. TITLE Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression JOURNAL PLoS ONE 5 (9), E12862 (2010) PUBMED 20877624 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) Publication Status: Online-Only REFERENCE 4 (bases 1 to 1251) AUTHORS Hosgood,H.D. III, Zhang,L., Shen,M., Berndt,S.I., Vermeulen,R., Li,G., Yin,S., Yeager,M., Yuenger,J., Rothman,N., Chanock,S., Smith,M. and Lan,Q. TITLE Association between genetic variants in VEGF, ERCC3 and occupational benzene haematotoxicity JOURNAL Occup Environ Med 66 (12), 848-853 (2009) PUBMED 19773279 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 1251) AUTHORS Moe,K.T., Woon,F.P., De Silva,D.A., Wong,P., Koh,T.H., Kingwell,B., Chin-Dusting,J. and Wong,M.C. TITLE Association of acute ischemic stroke with the MTHFR C677T polymorphism but not with NOS3 gene polymorphisms in a Singapore population JOURNAL Eur. J. Neurol. 15 (12), 1309-1314 (2008) PUBMED 19049547 REMARK GeneRIF: The TT genotype of C677T polymorphism in the MTHFR gene contributes to genetic susceptibility of acute ischemic stroke in a Singapore population. REFERENCE 6 (bases 1 to 1251) AUTHORS Koivuranta,K.T., Hakkola,E.H. and Hiltunen,J.K. TITLE Isolation and characterization of cDNA for human 120 kDa mitochondrial 2,4-dienoyl-coenzyme A reductase JOURNAL Biochem. J. 304 (PT 3), 787-792 (1994) PUBMED 7818482 REFERENCE 7 (bases 1 to 1251) AUTHORS Luo,M.J., Smeland,T.E., Shoukry,K. and Schulz,H. TITLE Delta 3,5, delta 2,4-dienoyl-CoA isomerase from rat liver mitochondria. Purification and characterization of a new enzyme involved in the beta-oxidation of unsaturated fatty acids JOURNAL J. Biol. Chem. 269 (4), 2384-2388 (1994) PUBMED 8300563 REFERENCE 8 (bases 1 to 1251) AUTHORS Smeland,T.E., Nada,M., Cuebas,D. and Schulz,H. TITLE NADPH-dependent beta-oxidation of unsaturated fatty acids with double bonds extending from odd-numbered carbon atoms JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (15), 6673-6677 (1992) PUBMED 1495956 REFERENCE 9 (bases 1 to 1251) AUTHORS Nishimaki-Mogami,T., Tanaka,A., Minegishi,K. and Takahashi,A. TITLE Effect of sorbic acid feeding on peroxisomes and sorboyl-CoA metabolizing enzymes in mouse liver. Selective induction of 2,4-dienoyl-CoA hydratase JOURNAL Biochem. Pharmacol. 42 (2), 239-246 (1991) PUBMED 1859445 REFERENCE 10 (bases 1 to 1251) AUTHORS Dommes,V., Baumgart,C. and Kunau,W.H. TITLE Degradation of unsaturated fatty acids in peroxisomes. Existence of a 2,4-dienoyl-CoA reductase pathway JOURNAL J. Biol. Chem. 256 (16), 8259-8262 (1981) PUBMED 7263650 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF049895.3. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L26050.1, BC105080.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-50648 AF049895.3 72504-123151 FEATURES Location/Qualifiers source 1..1251 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q21.3" gene 1..1251 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="2,4-dienoyl CoA reductase 1, mitochondrial" /db_xref="GeneID:1666" /db_xref="HGNC:2753" /db_xref="HPRD:01959" /db_xref="MIM:222745" exon 1..210 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 3 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="g" /db_xref="dbSNP:67780505" variation 6 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:184703398" misc_feature 43..45 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="upstream in-frame stop codon" STS 54..1172 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /db_xref="UniSTS:486004" variation 66 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="c" /db_xref="dbSNP:375348015" variation 92..93 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="tg" /db_xref="dbSNP:147877313" variation 99..100 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="ca" /db_xref="dbSNP:72368577" variation 106 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:370976343" variation 126 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="g" /db_xref="dbSNP:201183578" variation 128 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="g" /replace="t" /db_xref="dbSNP:370712697" variation 140 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="t" /db_xref="dbSNP:145402130" CDS 142..1149 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /EC_number="1.3.1.34" /note="4-enoyl-CoA reductase; short chain dehydrogenase/reductase family 18C, member 1; 2,4-dienoyl-CoA reductase, mitochondrial" /codon_start=1 /product="2,4-dienoyl-CoA reductase, mitochondrial precursor" /protein_id="NP_001350.1" /db_xref="GI:4503301" /db_xref="CCDS:CCDS6250.1" /db_xref="GeneID:1666" /db_xref="HGNC:2753" /db_xref="HPRD:01959" /db_xref="MIM:222745" /translation="
MKLPARVFFTLGSRLPCGLAPRRFFSYGTKILYQNTEALQSKFFSPLQKAMLPPNSFQGKVAFITGGGTGLGKGMTTLLSSLGAQCVIASRKMDVLKATAEQISSQTGNKVHAIQCDVRDPDMVQNTVSELIKVAGHPNIVINNAAGNFISPTERLSPNAWKTITDIVLNGTAFVTLEIGKQLIKAQKGAAFLSITTIYAETGSGFVVPSASAKAGVEAMSKSLAAEWGKYGMRFNVIQPGPIKTKGAFSRLDPTGTFEKEMIGRIPCGRLGTVEELANLAAFLCSDYASWINGAVIKFDGGEEVLISGEFNDLRKVTKEQWDTIEELIRKTKGS
" transit_peptide 142..243 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" mat_peptide 244..1146 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /product="2,4-dienoyl-CoA reductase, mitochondrial" misc_feature 310..1050 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="Trans-2-enoyl-CoA reductase (TER) and 2,4-dienoyl-CoA reductase (DECR), atypical (a) SDR; Region: TER_DECR_SDR_a; cd05369" /db_xref="CDD:187627" misc_feature 310..1047 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="short chain dehydrogenase; Provisional; Region: PRK07576" /db_xref="CDD:181043" misc_feature order(337..339,346..354,409..417,487..498,571..579, 640..642,724..732,781..783,859..870,874..876) /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="NAD(P) binding site [chemical binding]; other site" /db_xref="CDD:187627" misc_feature order(412..414,496..498,577..588,610..612,616..621, 628..630,730..732,736..738,769..771,865..867) /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:187627" misc_feature order(502..504,595..603,607..615,622..627,634..636, 646..651,658..663,670..672,682..684,691..693,706..708, 736..738,748..759,763..765,772..777,784..789,796..801, 805..828,832..834,865..867,937..945,949..957,967..969, 976..981,988..990,1003..1005,1009..1026,1030..1050) /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="homotetramer interface [polypeptide binding]; other site" /db_xref="CDD:187627" misc_feature order(583..585,736..738,769..771,781..783) /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="active site" /db_xref="CDD:187627" misc_feature order(595..603,607..609,622..627,634..636,649..651, 658..663,748..759,763..765,772..777,784..789,796..801, 808..810,817..822) /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /note="homodimer interface [polypeptide binding]; other site" /db_xref="CDD:187627" misc_feature 829..831 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q16698.1); acetylation site" variation 153 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="g" /db_xref="dbSNP:147670454" variation 157 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:374823507" variation 196 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:68060600" variation 205 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:140706902" exon 211..413 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 218 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:145323335" variation 271..272 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="t" /db_xref="dbSNP:72124473" variation 277 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="c" /db_xref="dbSNP:376358991" variation 301..302 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:72095930" variation 310 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:11548761" variation 315 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:145066522" variation 318..319 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="a" /replace="gc" /db_xref="dbSNP:66849191" variation 330..331 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:71832266" variation 332..333 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="t" /db_xref="dbSNP:72423978" STS 350..502 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /standard_name="MARC_4379-4380:991938522:3" /db_xref="UniSTS:231085" variation 351..352 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:72384318" variation 380..381 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:72228477" variation 387 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:149094047" variation 391 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:143138588" variation 394..395 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="c" /db_xref="dbSNP:71891540" variation 399 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:149901486" variation 412 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:368779502" exon 414..471 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 418 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:374362672" exon 472..558 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 493 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:202215448" variation 500 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:151187801" variation 507 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:138725804" variation 509 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:192012718" variation 534 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:145305482" exon 559..706 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 573 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:137904244" variation 640 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:142348077" variation 662 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:190568496" variation 663 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:143170054" variation 664 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:372630127" exon 707..806 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 712 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:138952950" variation 732 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:368539700" variation 803..804 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="a" /db_xref="dbSNP:67418874" exon 807..879 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 842 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:137876000" variation 854 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:367738392" exon 880..1026 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 885 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="g" /db_xref="dbSNP:149423653" variation 893 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="g" /db_xref="dbSNP:144788496" variation 949 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:372913734" variation 952 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="c" /db_xref="dbSNP:10235" STS 954..1230 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /standard_name="RH18400" /db_xref="UniSTS:40291" variation 954 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:375878524" variation 992 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:370430849" variation 999..1000 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="aca" /db_xref="dbSNP:199693288" variation 1001 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:148549954" variation 1004 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:181636748" variation 1024 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:201405525" exon 1027..1089 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 1031 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:9495" variation 1061..1062 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="at" /db_xref="dbSNP:72163359" variation 1074..1075 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="" /replace="tc" /db_xref="dbSNP:72410629" variation 1077 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:377574337" exon 1090..1251 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /inference="alignment:Splign:1.39.8" variation 1139 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:111307450" variation 1140 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="t" /db_xref="dbSNP:15094" variation 1142 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="g" /db_xref="dbSNP:200122846" variation 1150 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="g" /db_xref="dbSNP:7162" variation 1169 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="c" /replace="t" /db_xref="dbSNP:112034915" variation 1170 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="t" /db_xref="dbSNP:149321434" variation 1212 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" /replace="a" /replace="c" /db_xref="dbSNP:375403201" polyA_signal 1234..1239 /gene="DECR1" /gene_synonym="DECR; NADPH; SDR18C1" ORIGIN
acgccgcctgggtcccagtccccgtcccatcccccggcggcctaggcagcgtttccagccccgagaactttgttctttttgtcccgccccctgcgcccaaccgcctgcgccgccttccggcccgagttctggagactcaacatgaagctaccggccagggttttctttactctggggtcccggctgccctgtggcctcgctcctcggaggtttttcagttatgggacaaaaatattatatcaaaacactgaagctttgcaatctaaattcttttcacctcttcaaaaagcgatgctaccacctaatagttttcaaggaaaagtggcattcattactgggggaggtactggccttggtaaaggaatgacaactcttctgtccagcctaggtgctcagtgcgtgatagccagccggaagatggatgttttgaaagctaccgcagaacaaatttcttctcaaactggaaataaggttcatgcaattcagtgtgatgtgagggatcctgatatggttcaaaacactgtgtcagaactgatcaaagttgcaggacatcctaatattgtgataaacaatgcagcagggaattttatttctcctactgaaagactttctcctaatgcttggaaaaccataactgacatagttctaaatggcacagccttcgtgacactagaaattggaaaacaactaattaaagcacagaaaggagcagcatttctttctattactactatctatgctgagactggttcaggttttgtagtaccaagtgcttctgccaaagcaggtgtggaagccatgagcaagtctcttgcagctgaatggggtaaatatggaatgcgattcaatgtgattcaaccagggcctataaaaaccaaaggtgcctttagccgtctggacccaactggaacatttgagaaagaaatgattggcagaattccctgtggtcgcctggggactgtagaagaactcgcaaatcttgctgctttcctttgtagtgattatgcttcttggattaatggagcagtcattaaatttgacggtggagaggaagtacttatttcaggggaattcaacgacctgagaaaggtcaccaaggagcagtgggacaccatagaagaactcatcaggaagacaaaaggttcctaagaccactttggccttcatcttggttacagaaaagggaatagaaatgaaacaaattatctctcatcttttgactatttcaagtctaataaattcttaattaac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1666 -> Molecular function: GO:0008670 [2,4-dienoyl-CoA reductase (NADPH) activity] evidence: IDA GeneID:1666 -> Molecular function: GO:0016651 [oxidoreductase activity, acting on NAD(P)H] evidence: TAS GeneID:1666 -> Molecular function: GO:0070402 [NADPH binding] evidence: IDA GeneID:1666 -> Biological process: GO:0006635 [fatty acid beta-oxidation] evidence: IDA GeneID:1666 -> Biological process: GO:0006635 [fatty acid beta-oxidation] evidence: TAS GeneID:1666 -> Biological process: GO:0044255 [cellular lipid metabolic process] evidence: TAS GeneID:1666 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:1666 -> Biological process: GO:0051289 [protein homotetramerization] evidence: IDA GeneID:1666 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1666 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:1666 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:1666 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA GeneID:1666 -> Cellular component: GO:0005739 [mitochondrion] evidence: NAS GeneID:1666 -> Cellular component: GO:0005759 [mitochondrial matrix] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001350 -> EC 1.3.1.34
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.