Home |
Help |
Advanced search
2024-04-19 18:01:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001348 2105 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens death-associated protein kinase 3 (DAPK3), mRNA.
ACCESSION NM_001348
VERSION NM_001348.1 GI:4557510
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2105)
AUTHORS Nehru,V., Almeida,F.N. and Aspenstrom,P.
TITLE Interaction of RhoD and ZIP kinase modulates actin filament
assembly and focal adhesion dynamics
JOURNAL Biochem. Biophys. Res. Commun. 433 (2), 163-169 (2013)
PUBMED 23454120
REMARK GeneRIF: Interaction of RhoD and ZIP kinase modulates actin
filament assembly and focal adhesion dynamics.
REFERENCE 2 (bases 1 to 2105)
AUTHORS Holliday EG, Smith AV, Cornes BK, Buitendijk GH, Jensen RA, Sim X,
Aspelund T, Aung T, Baird PN, Boerwinkle E, Cheng CY, van Duijn CM,
Eiriksdottir G, Gudnason V, Harris T, Hewitt AW, Inouye M, Jonasson
F, Klein BE, Launer L, Li X, Liew G, Lumley T, McElduff P, McKnight
B, Mitchell P, Psaty BM, Rochtchina E, Rotter JI, Scott RJ, Tay W,
Taylor K, Teo YY, Uitterlinden AG, Viswanathan A, Xie S, Vingerling
JR, Klaver CC, Tai ES, Siscovick D, Klein R, Cotch MF, Wong TY,
Attia J and Wang JJ.
CONSRTM Wellcome Trust Case Control Consortium 2
TITLE Insights into the genetic architecture of early stage age-related
macular degeneration: a genome-wide association study meta-analysis
JOURNAL PLoS ONE 8 (1), E53830 (2013)
PUBMED 23326517
REFERENCE 3 (bases 1 to 2105)
AUTHORS Togi,S., Ikeda,O., Kamitani,S., Nakasuji,M., Sekine,Y.,
Muromoto,R., Nanbo,A., Oritani,K., Kawai,T., Akira,S. and
Matsuda,T.
TITLE Zipper-interacting protein kinase (ZIPK) modulates canonical
Wnt/beta-catenin signaling through interaction with Nemo-like
kinase and T-cell factor 4 (NLK/TCF4)
JOURNAL J. Biol. Chem. 286 (21), 19170-19177 (2011)
PUBMED 21454679
REMARK GeneRIF: ZIPK may serve as a transcriptional regulator of canonical
Wnt/beta-catenin signaling through interaction with NLK/TCF4.
REFERENCE 4 (bases 1 to 2105)
AUTHORS Brognard,J., Zhang,Y.W., Puto,L.A. and Hunter,T.
TITLE Cancer-associated loss-of-function mutations implicate DAPK3 as a
tumor-suppressing kinase
JOURNAL Cancer Res. 71 (8), 3152-3161 (2011)
PUBMED 21487036
REMARK GeneRIF: Results suggest that DAPK3 is a tumor suppressor in which
loss-of-function mutations promote increased cell survival,
proliferation, cellular aggregation.
REFERENCE 5 (bases 1 to 2105)
AUTHORS Weitzel,D.H., Chambers,J. and Haystead,T.A.
TITLE Phosphorylation-dependent control of ZIPK nuclear import is species
specific
JOURNAL Cell. Signal. 23 (1), 297-303 (2011)
PUBMED 20854903
REMARK GeneRIF: The NLS2 of human ZIPK functions the nucleus-directing
motif, but only upon dephosphorylation of the adjacent T299
residue.
REFERENCE 6 (bases 1 to 2105)
AUTHORS Page,G., Kogel,D., Rangnekar,V. and Scheidtmann,K.H.
TITLE Interaction partners of Dlk/ZIP kinase: co-expression of Dlk/ZIP
kinase and Par-4 results in cytoplasmic retention and apoptosis
JOURNAL Oncogene 18 (51), 7265-7273 (1999)
PUBMED 10602480
REFERENCE 7 (bases 1 to 2105)
AUTHORS Page,G., Lodige,I., Kogel,D. and Scheidtmann,K.H.
TITLE AATF, a novel transcription factor that interacts with Dlk/ZIP
kinase and interferes with apoptosis
JOURNAL FEBS Lett. 462 (1-2), 187-191 (1999)
PUBMED 10580117
REFERENCE 8 (bases 1 to 2105)
AUTHORS Murata-Hori,M., Suizu,F., Iwasaki,T., Kikuchi,A. and Hosoya,H.
TITLE ZIP kinase identified as a novel myosin regulatory light chain
kinase in HeLa cells
JOURNAL FEBS Lett. 451 (1), 81-84 (1999)
PUBMED 10356987
REFERENCE 9 (bases 1 to 2105)
AUTHORS Kawai,T., Matsumoto,M., Takeda,K., Sanjo,H. and Akira,S.
TITLE ZIP kinase, a novel serine/threonine kinase which mediates
apoptosis
JOURNAL Mol. Cell. Biol. 18 (3), 1642-1651 (1998)
PUBMED 9488481
REFERENCE 10 (bases 1 to 2105)
AUTHORS Saito,T., Seki,N., Ohira,M., Hayashi,A., Kozuma,S., Hattori,A. and
Hori,T.
TITLE Assignment of the ZIP kinase gene to human chromosome 19p13.3 by
somatic hybrid analysis and fluorescence in-situ hybridization
JOURNAL J. Hum. Genet. 43 (3), 209-211 (1998)
PUBMED 9747039
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AB007144.1.
Summary: Death-associated protein kinase 3 (DAPK3) induces
morphological changes in apoptosis when overexpressed in mammalian
cells. These results suggest that DAPK3 may play a role in the
induction of apoptosis. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AB007144.1, AK074799.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..2105
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19p13.3"
gene 1..2105
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="death-associated protein kinase 3"
/db_xref="GeneID:1613"
/db_xref="HGNC:2676"
/db_xref="HPRD:04478"
/db_xref="MIM:603289"
STS 1..1687
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/db_xref="UniSTS:486510"
exon 1..155
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(90)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:367713352"
CDS 94..1458
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/EC_number="2.7.11.1"
/note="ZIP kinase isoform; dlk; ZIP-kinase; DAP kinase 3;
DAP-like kinase; zipper-interacting protein kinase; MYPT1
kinase"
/codon_start=1
/product="death-associated protein kinase 3"
/protein_id="NP_001339.1"
/db_xref="GI:4557511"
/db_xref="CCDS:CCDS12116.1"
/db_xref="GeneID:1613"
/db_xref="HGNC:2676"
/db_xref="HPRD:04478"
/db_xref="MIM:603289"
/translation="
MSTFRQEDVEDHYEMGEELGSGQFAIVRKCRQKGTGKEYAAKFIKKRRLSSSRRGVSREEIEREVNILREIRHPNIITLHDIFENKTDVVLILELVSGGELFDFLAEKESLTEDEATQFLKQILDGVHYLHSKRIAHFDLKPENIMLLDKNVPNPRIKLIDFGIAHKIEAGNEFKNIFGTPEFVAPEIVNYEPLGLEADMWSIGVITYILLSGASPFLGETKQETLTNISAVNYDFDEEYFSNTSELAKDFIRRLLVKDPKRRMTIAQSLEHSWIKAIRRRNVRGEDSGRKPERRRLKTTRLKEYTIKSHSSLPPNNSYADFERFSKVLEEAAAAEEGLRELQRSRRLCHEDVEALAAIYEEKEAWYREESDSLGQDLRRLRQELLKTEALKRQAQEEAKGALLGTSGLKRRFSRLENRYEALAKQVASEMRFVQDLVRALEQEKLQGVECGLR
"
misc_feature 124..906
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="Protein Kinases, catalytic domain; Region:
PKc_like; cl09925"
/db_xref="CDD:214163"
misc_feature 130..918
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(148..162,172..174,211..213,217..219,322..324,
370..381,391..393,397..399,508..510,514..516,520..525,
532..534,574..576,583..585,628..639)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(148..162,172..174,211..213,217..219,322..324,
370..381,391..393,508..510,514..516,520..525,532..534,
574..576)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(160..162,391..393,397..399,508..510,514..516,
520..522,583..585,628..639)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature 241..243
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature order(571..588,628..639)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 574..705
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43293.1);
Region: Activation segment (By similarity)"
misc_feature 631..633
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 766..768
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 886..888
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis and ROCK1;
propagated from UniProtKB/Swiss-Prot (O43293.1);
phosphorylation site"
misc_feature 919..1092
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43293.1);
Region: Interaction with AR"
misc_feature 925..1026
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43293.1);
Region: Interaction with MYPT1"
misc_feature 988..990
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis, DAPK1 and
ROCK1; propagated from UniProtKB/Swiss-Prot (O43293.1);
phosphorylation site"
misc_feature 1009..1011
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 1018..1020
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by DAPK1; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 1024..1026
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis and DAPK1;
propagated from UniProtKB/Swiss-Prot (O43293.1);
phosphorylation site"
misc_feature 1027..1029
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by DAPK1; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 1045..1047
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by DAPK1; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 1069..1071
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by DAPK1; propagated from
UniProtKB/Swiss-Prot (O43293.1); phosphorylation site"
misc_feature 1276..1455
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43293.1);
Region: Interaction with CDC5L (By similarity)"
misc_feature 1372..1416
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43293.1);
Region: Leucine-zipper"
variation complement(102)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:111730532"
variation complement(126)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370300123"
exon 156..516
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(175)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:139511601"
variation complement(184)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199986718"
variation complement(204)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200255409"
variation complement(241)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:374470911"
variation complement(243)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201491700"
variation complement(248)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:199653811"
variation complement(277)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:150676155"
variation complement(307)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371231370"
variation complement(310)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:141934386"
variation complement(333)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:148551045"
variation complement(358)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371046687"
variation complement(369)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201255725"
variation complement(370)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:146324810"
variation complement(379)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:142199588"
variation complement(383)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:200475430"
variation complement(384)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:372693888"
variation complement(410)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:369395432"
variation complement(435)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:202008826"
variation complement(471)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375001964"
variation complement(481)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:138837322"
variation complement(493)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:369564445"
variation complement(498)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:144975421"
variation complement(511)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375816170"
exon 517..646
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(528)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:112082802"
variation complement(547)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:368786626"
variation complement(560)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375789466"
variation complement(587)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:200205146"
variation complement(593)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371469059"
variation complement(602)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:149596948"
variation complement(621)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:202200405"
variation complement(633)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:113807746"
exon 647..695
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(670)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201511494"
variation complement(671)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370820532"
variation complement(687)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:138197908"
exon 696..722
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(702)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373539990"
exon 723..875
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(729)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370261717"
variation complement(786)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375852405"
variation complement(795)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:150422449"
variation complement(804)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:201391109"
variation complement(810)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:372851768"
variation complement(828)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199570126"
variation complement(829)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200465016"
variation complement(861)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199944563"
exon 876..921
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(900)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:140839544"
variation complement(921)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368735457"
exon 922..2105
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/inference="alignment:Splign:1.39.8"
variation complement(931)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:200817833"
variation complement(945)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="t"
/db_xref="dbSNP:368187481"
variation complement(947)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201738241"
variation complement(957)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:199804056"
variation complement(1035)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200263027"
variation complement(1072)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201446546"
variation complement(1082)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:111719490"
variation complement(1088)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:372041714"
variation complement(1098)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:368652868"
variation complement(1113)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:56251209"
variation complement(1137)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:370168020"
variation complement(1144)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377026101"
variation complement(1165)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:181345641"
variation complement(1194)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375140792"
variation complement(1206)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:138075090"
variation complement(1211)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:147011394"
variation complement(1229)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:199762113"
variation complement(1237)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201287470"
variation complement(1258)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200352688"
variation complement(1313)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:141435903"
variation complement(1325)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:369672101"
variation complement(1371)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:77999895"
variation complement(1402)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:149066820"
variation complement(1405)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:376921546"
variation complement(1441)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:373965880"
variation complement(1480)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:368908111"
variation complement(1533)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:188537565"
variation complement(1535)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:186130199"
variation complement(1620)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:142340400"
variation complement(1662)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:3745982"
variation complement(1667)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:3745981"
variation complement(1764)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:181444669"
STS 1820..1961
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/standard_name="RH47447"
/db_xref="UniSTS:16492"
variation complement(1823)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:151023938"
variation complement(1847)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:111331135"
variation complement(1849)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:10419272"
variation complement(1910..1911)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="ac"
/replace="ca"
/db_xref="dbSNP:71339086"
variation complement(1936)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373334583"
variation complement(2031)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:190825932"
variation complement(2039)
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:372577420"
polyA_site 2105
/gene="DAPK3"
/gene_synonym="ZIP; ZIPK"
ORIGIN
gttgccattaggggactcctgaggtcctatctccaggctgcggtgactgcactttccctggagtggaagctgctggaaggcggaccggccgccatgtccacgttcaggcaggaggacgtggaggaccattatgagatgggggaggagctgggcagcggccagtttgcgatcgtgcggaagtgccggcagaagggcacgggcaaggagtacgcagccaagttcatcaagaagcgccgcctgtcatccagccggcgtggggtgagccgggaggagatcgagcgggaggtgaacatcctgcgggagatccggcaccccaacatcatcaccctgcacgacatcttcgagaacaagacggacgtggtcctcatcctggagctggtctctggcggggagctctttgacttcctggcggagaaagagtcgctgacggaggacgaggccacccagttcctcaagcagatcctggacggcgttcactacctgcactctaagcgcatcgcacactttgacctgaagccggaaaacatcatgctgctggacaagaacgtgcccaacccacgaatcaagctcatcgacttcggcatcgcgcacaagatcgaggcggggaacgagttcaagaacatcttcggcaccccggagtttgtggccccagagattgtgaactatgagccgctgggcctggaggcggacatgtggagcatcggtgtcatcacctatatcctcctgagcggtgcatccccgttcctgggcgagaccaagcaggagacgctcaccaacatctcagccgtgaactacgacttcgacgaggagtacttcagcaacaccagcgagctggccaaggacttcattcgccggctgctcgtcaaagatcccaagcggagaatgaccattgcccagagcctggaacattcctggattaaggcgatccggcggcggaacgtgcgtggtgaggacagcggccgcaagcccgagcggcggcgcctgaagaccacgcgtctgaaggagtacaccatcaagtcgcactccagcttgccgcccaacaacagctacgccgacttcgagcgcttctccaaggtgctggaggaggcggcggccgccgaggagggcctgcgcgagctgcagcgcagccggcggctctgccacgaggacgtggaggcgctggccgccatctacgaggagaaggaggcctggtaccgcgaggagagcgacagcctgggccaggacctgcggaggctacggcaggagctgctcaagaccgaggcgctcaagcggcaggcgcaggaggaggccaagggcgcgctgctggggaccagcggcctcaagcgccgcttcagccgcctggagaaccgctacgaggcgctggccaagcaagtagcctccgagatgcgcttcgtgcaggacctcgtgcgcgccctggagcaggagaagctgcagggcgtggagtgcgggctgcgctaggcgcagtggggtgggccaggccccaggacagccggagctcggcctgcggtgggggcgcttcctgtggacgctgcgcctcccatcgcccgggtgcctgtccttgcccagcgccaccaggctggaggcggagtgggaggagctggagccaggcccgtaagttcgcaggcaggggtgggtgtgggacggggctgcttctctacacagcctctacgctggccttcaccttcacccctgcatcgtcggtgaccctgggaccctccaggcagcgtggcctgtggcaccgtgagggttgggacccaccgaggcgcagaggcggcccgaatgcagccctggttcaggcccggaggagggtttgcgggtagttgcacggacaattcggcggggtgctgcctgttgctgccattagcccaggaggaggtcgtgggacggggagggtgggatggacggcggacaggcagtccccacgctgctgggtggcgccgggcttggtggggtcttccactgtgtgcccttctcgccgaggccggtcccccgggtgtggggtgccctgctgcggactcctccgcgagccccatcgtcgcgcctgtggacgcctaggcaagagcggccctctgcagccaagagaaataaaatactggcttccagat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1613 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:1613 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:1613 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:1613 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA
GeneID:1613 -> Molecular function: GO:0043522 [leucine zipper domain binding] evidence: IPI
GeneID:1613 -> Biological process: GO:0000910 [cytokinesis] evidence: TAS
GeneID:1613 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:1613 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS
GeneID:1613 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:1613 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:1613 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IDA
GeneID:1613 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IMP
GeneID:1613 -> Biological process: GO:0006940 [regulation of smooth muscle contraction] evidence: TAS
GeneID:1613 -> Biological process: GO:0007088 [regulation of mitosis] evidence: TAS
GeneID:1613 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IDA
GeneID:1613 -> Biological process: GO:0010506 [regulation of autophagy] evidence: TAS
GeneID:1613 -> Biological process: GO:0016568 [chromatin modification] evidence: IEA
GeneID:1613 -> Biological process: GO:0017148 [negative regulation of translation] evidence: IDA
GeneID:1613 -> Biological process: GO:0030182 [neuron differentiation] evidence: IEA
GeneID:1613 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:1613 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:1613 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: TAS
GeneID:1613 -> Biological process: GO:0071346 [cellular response to interferon-gamma] evidence: IDA
GeneID:1613 -> Biological process: GO:0090263 [positive regulation of canonical Wnt receptor signaling pathway] evidence: IMP
GeneID:1613 -> Biological process: GO:2000145 [regulation of cell motility] evidence: TAS
GeneID:1613 -> Biological process: GO:2000249 [regulation of actin cytoskeleton reorganization] evidence: TAS
GeneID:1613 -> Biological process: GO:2001241 [positive regulation of extrinsic apoptotic signaling pathway in absence of ligand] evidence: IEA
GeneID:1613 -> Cellular component: GO:0000775 [chromosome, centromeric region] evidence: IEA
GeneID:1613 -> Cellular component: GO:0005634 [nucleus] evidence: ISS
GeneID:1613 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:1613 -> Cellular component: GO:0005815 [microtubule organizing center] evidence: IEA
GeneID:1613 -> Cellular component: GO:0016605 [PML body] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001339 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.