Home |
Help |
Advanced search
2024-04-20 20:03:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001316 3627 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens CSE1 chromosome segregation 1-like (yeast) (CSE1L),
transcript variant 1, mRNA.
ACCESSION NM_001316
VERSION NM_001316.3 GI:371502110
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3627)
AUTHORS Soldini,D., Montagna,C., Schuffler,P., Martin,V., Georgis,A.,
Thiesler,T., Curioni-Fontecedro,A., Went,P., Bosshard,G.,
Dehler,S., Mazzuchelli,L. and Tinguely,M.
TITLE A new diagnostic algorithm for Burkitt and diffuse large B-cell
lymphomas based on the expression of CSE1L and STAT3 and on MYC
rearrangement predicts outcome
JOURNAL Ann. Oncol. 24 (1), 193-201 (2013)
PUBMED 22967991
REMARK GeneRIF: CSE1L- and inhibitor of DNA binding-3 (ID3)-overexpression
was associated with the diagnosis of BL and signal transduction and
transcription-3 (STAT3) with DLBCL (P<0.001 for all markers). All
three markers were associated with patient outcome in DLBCL
REFERENCE 2 (bases 1 to 3627)
AUTHORS Chang,C.C., Tai,C.J., Su,T.C., Shen,K.H., Lin,S.H., Yeh,C.M.,
Yeh,K.T., Lin,Y.M. and Jiang,M.C.
TITLE The prognostic significance of nuclear CSE1L in urinary bladder
urothelial carcinomas
JOURNAL Ann Diagn Pathol 16 (5), 362-368 (2012)
PUBMED 22476051
REMARK GeneRIF: Nuclear CSE1L may play an oncogenic role in bladder tumor
progression and that immunohistochemical staining of nuclear CSE1L
may be useful for the prognosis of bladder urothelial carcinomas.
REFERENCE 3 (bases 1 to 3627)
AUTHORS Zang,H., Zhao,J.M., Ji,D., Sun,Y.L., Zhou,G.D., Zhao,Y.L. and
Chen,G.F.
TITLE [Expression of CAS in hepatocellular carcinoma tissues and its
relationship with HBV infection]
JOURNAL Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 26 (4), 285-287
(2012)
PUBMED 23189846
REMARK GeneRIF: CAS protein expression is related closely to tumor
differentiation in hepatocellular carcinoma tissues.
REFERENCE 4 (bases 1 to 3627)
AUTHORS Sillars-Hardebol,A.H., Carvalho,B., Belien,J.A., de Wit,M.,
Delis-van Diemen,P.M., Tijssen,M., van de Wiel,M.A., Ponten,F.,
Meijer,G.A. and Fijneman,R.J.
TITLE CSE1L, DIDO1 and RBM39 in colorectal adenoma to carcinoma
progression
JOURNAL Cell Oncol (Dordr) 35 (4), 293-300 (2012)
PUBMED 22711543
REMARK GeneRIF: Data show that CSE1L, DIDO1 and RBM39 mRNA expression
levels correlated with chromosome 20q DNA copy number status.
REFERENCE 5 (bases 1 to 3627)
AUTHORS Liao,C.F., Lin,S.H., Chen,H.C., Tai,C.J., Chang,C.C., Li,L.T.,
Yeh,C.M., Yeh,K.T., Chen,Y.C., Hsu,T.H., Shen,S.C., Lee,W.R.,
Chiou,J.F., Luo,S.F. and Jiang,M.C.
TITLE CSE1L, a novel microvesicle membrane protein, mediates
Ras-triggered microvesicle generation and metastasis of tumor cells
JOURNAL Mol. Med. 18, 1269-1280 (2012)
PUBMED 22952058
REMARK GeneRIF: CSE1L may be involved in the 'early' and 'late' metastasis
of tumor cells in tumorigenesis.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 3627)
AUTHORS Herold,A., Truant,R., Wiegand,H. and Cullen,B.R.
TITLE Determination of the functional domain organization of the importin
alpha nuclear import factor
JOURNAL J. Cell Biol. 143 (2), 309-318 (1998)
PUBMED 9786944
REFERENCE 7 (bases 1 to 3627)
AUTHORS Kutay,U., Bischoff,F.R., Kostka,S., Kraft,R. and Gorlich,D.
TITLE Export of importin alpha from the nucleus is mediated by a specific
nuclear transport factor
JOURNAL Cell 90 (6), 1061-1071 (1997)
PUBMED 9323134
REFERENCE 8 (bases 1 to 3627)
AUTHORS Brinkmann,U., Brinkmann,E., Gallo,M., Scherf,U. and Pastan,I.
TITLE Role of CAS, a human homologue to the yeast chromosome segregation
gene CSE1, in toxin and tumor necrosis factor mediated apoptosis
JOURNAL Biochemistry 35 (21), 6891-6899 (1996)
PUBMED 8639641
REFERENCE 9 (bases 1 to 3627)
AUTHORS Brinkmann,U., Gallo,M., Polymeropoulos,M.H. and Pastan,I.
TITLE The human CAS (cellular apoptosis susceptibility) gene mapping on
chromosome 20q13 is amplified in BT474 breast cancer cells and part
of aberrant chromosomes in breast and colon cancer cell lines
JOURNAL Genome Res. 6 (3), 187-194 (1996)
PUBMED 8963895
REFERENCE 10 (bases 1 to 3627)
AUTHORS Brinkmann,U., Brinkmann,E., Gallo,M. and Pastan,I.
TITLE Cloning and characterization of a cellular apoptosis susceptibility
gene, the human homologue to the yeast chromosome segregation gene
CSE1
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (22), 10427-10431 (1995)
PUBMED 7479798
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DC402014.1, BC109314.2,
AI973168.1 and AI018123.1.
On Jan 7, 2012 this sequence version replaced gi:29029558.
Summary: Proteins that carry a nuclear localization signal (NLS)
are transported into the nucleus by the importin-alpha/beta
heterodimer. Importin-alpha binds the NLS, while importin-beta
mediates translocation through the nuclear pore complex. After
translocation, RanGTP binds importin-beta and displaces
importin-alpha. Importin-alpha must then be returned to the
cytoplasm, leaving the NLS protein behind. The protein encoded by
this gene binds strongly to NLS-free importin-alpha, and this
binding is released in the cytoplasm by the combined action of
RANBP1 and RANGAP1. In addition, the encoded protein may play a
role both in apoptosis and in cell proliferation. Alternatively
spliced transcript variants have been found for this gene.
[provided by RefSeq, Jan 2012].
Transcript Variant: This variant (1) represents the predominant
transcript, and encodes the longer isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF053641.1, BC109313.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-87 DC402014.1 1-87
88-3387 BC109314.2 1-3300
3388-3610 AI973168.1 1-223 c
3611-3627 AI018123.1 2-18 c
FEATURES Location/Qualifiers
source 1..3627
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="20"
/map="20q13"
gene 1..3627
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="CSE1 chromosome segregation 1-like (yeast)"
/db_xref="GeneID:1434"
/db_xref="HGNC:2431"
/db_xref="HPRD:03217"
/db_xref="MIM:601342"
exon 1..178
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 32
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2273533"
variation 41
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2252259"
variation 99
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:117725610"
misc_feature 121..123
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="upstream in-frame stop codon"
exon 179..274
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
CDS 190..3105
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="isoform 1 is encoded by transcript variant 1;
importin-alpha re-exporter; cellular apoptosis
susceptibility protein; exportin-2; exp2; chromosome
segregation 1-like protein"
/codon_start=1
/product="exportin-2 isoform 1"
/protein_id="NP_001307.2"
/db_xref="GI:29029559"
/db_xref="CCDS:CCDS13412.1"
/db_xref="GeneID:1434"
/db_xref="HGNC:2431"
/db_xref="HPRD:03217"
/db_xref="MIM:601342"
/translation="
MELSDANLQTLTEYLKKTLDPDPAIRRPAEKFLESVEGNQNYPLLLLTLLEKSQDNVIKVCASVTFKNYIKRNWRIVEDEPNKICEADRVAIKANIVHLMLSSPEQIQKQLSDAISIIGREDFPQKWPDLLTEMVNRFQSGDFHVINGVLRTAHSLFKRYRHEFKSNELWTEIKLVLDAFALPLTNLFKATIELCSTHANDASALRILFSSLILISKLFYSLNFQDLPEFFEDNMETWMNNFHTLLTLDNKLLQTDDEEEAGLLELLKSQICDNAALYAQKYDEEFQRYLPRFVTAIWNLLVTTGQEVKYDLLVSNAIQFLASVCERPHYKNLFEDQNTLTSICEKVIVPNMEFRAADEEAFEDNSEEYIRRDLEGSDIDTRRRAACDLVRGLCKFFEGPVTGIFSGYVNSMLQEYAKNPSVNWKHKDAAIYLVTSLASKAQTQKHGITQANELVNLTEFFVNHILPDLKSANVNEFPVLKADGIKYIMIFRNQVPKEHLLVSIPLLINHLQAESIVVHTYAAHALERLFTMRGPNNATLFTAAEIAPFVEILLTNLFKALTLPGSSENEYIMKAIMRSFSLLQEAIIPYIPTLITQLTQKLLAVSKNPSKPHFNHYMFEAICLSIRITCKANPAAVVNFEEALFLVFTEILQNDVQEFIPYVFQVMSLLLETHKNDIPSSYMALFPHLLQPVLWERTGNIPALVRLLQAFLERGSNTIASAAADKIPGLLGVFQKLIASKANDHQGFYLLNSIIEHMPPESVDQYRKQIFILLFQRLQNSKTTKFIKSFLVFINLYCIKYGALALQEIFDGIQPKMFGMVLEKIIIPEIQKVSGNVEKKICAVGITKLLTECPPMMDTEYTKLWTPLLQSLIGLFELPEDDTIPDEEHFIDIEDTPGYQTAFSQLAFAGKKEHDPVGQMVNNPKIHLAQSLHKLSTACPGRVPSMVSTSLNAEALQYLQGYLQAASVTLL
"
misc_feature 190..192
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P55060.3); acetylation site"
misc_feature 274..495
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="Importin-beta N-terminal domain; Region: IBN_N;
smart00913"
/db_xref="CDD:197981"
misc_feature 655..1767
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="Region: Cse1; pfam08506"
/db_xref="CDD:117083"
misc_feature 1768..3075
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/note="CAS/CSE protein, C-terminus; Region: CAS_CSE1;
pfam03378"
/db_xref="CDD:190619"
misc_feature 1909..1911
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P55060.3); acetylation site"
misc_feature 2659..2661
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (P55060.3); acetylation site"
variation 202
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372551577"
variation 222
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145758236"
exon 275..417
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 291
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369371888"
variation 292
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2664535"
variation 315
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372846963"
variation 388
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2664556"
variation 398
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:112333627"
variation 416
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:145805814"
exon 418..519
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 419
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200581090"
variation 429
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141564653"
variation 433
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201843660"
variation 470
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377396767"
exon 520..665
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 555
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370077115"
variation 630
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370271126"
exon 666..756
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 690
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368316233"
variation 714
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372336608"
variation 741
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201000044"
exon 757..864
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 763
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370821480"
variation 764
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374191395"
variation 775
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150139793"
variation 825
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2227946"
variation 828
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:368656942"
exon 865..957
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 881..882
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:3191924"
variation 881
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1131754"
variation 882
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1131755"
variation 887
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1131756"
variation 893
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:184951470"
variation 915
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051528"
exon 958..1125
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 961
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374801773"
variation 973
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368900825"
variation 1015
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149344844"
variation 1039
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201284324"
variation 1050
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:11697054"
variation 1063
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372508022"
variation 1092
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:61748374"
variation 1101
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139732036"
variation 1108
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377213495"
variation 1111
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145309067"
exon 1126..1255
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1143
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:374381262"
variation 1201
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377449760"
variation 1203
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140513534"
exon 1256..1321
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
exon 1322..1524
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1364
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:142187945"
STS 1420..1521
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="YWHAB"
/db_xref="UniSTS:265998"
variation 1444
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:151168384"
variation 1455
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373272778"
variation 1466
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140221738"
variation 1494
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371810198"
variation 1503
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:113209936"
variation 1504
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:113526104"
exon 1525..1609
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1556
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:377071060"
variation 1594
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:201792954"
exon 1610..1671
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1628
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375038710"
variation 1671
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:192906243"
exon 1672..1808
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1726
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149873330"
variation 1730
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:3209624"
variation 1736
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374403159"
variation 1746
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:146427669"
variation 1752
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140701703"
variation 1774
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145901767"
variation 1782
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371585267"
exon 1809..1912
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1827
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368726403"
variation 1833
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:112036311"
variation 1855
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200292430"
variation 1862
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace=""
/replace="t"
/db_xref="dbSNP:35437801"
variation 1878..1879
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace=""
/replace="t"
/db_xref="dbSNP:35542902"
variation 1885
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:200007210"
variation 1912
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:6095427"
exon 1913..2010
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 1962
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143358483"
variation 1969
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:148320954"
variation 1974
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:34221013"
variation 2002
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372016863"
exon 2011..2161
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2019
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:141477153"
variation 2041
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:202019379"
variation 2065
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147450179"
variation 2092
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:138299846"
variation 2094
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:111650807"
variation 2112
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372337206"
variation 2130
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375924098"
variation 2151
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369958107"
exon 2162..2370
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2302
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143688296"
variation 2322
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:151233979"
variation 2329
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375067125"
variation 2330
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376962564"
variation 2331
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369869448"
variation 2339
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:147216191"
variation 2341
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371134165"
variation 2365
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:375000731"
exon 2371..2468
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2400
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374989344"
variation 2449
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229042"
exon 2469..2554
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2470
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201854045"
variation 2478
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199707942"
variation 2533
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372218279"
variation 2534
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139664090"
exon 2555..2636
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2575
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201285684"
variation 2598
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377319144"
variation 2622
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:7343500"
exon 2637..2783
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2641
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:112338228"
variation 2684
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:28659989"
variation 2718
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149713430"
variation 2739
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:3180705"
variation 2775
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200756398"
exon 2784..3015
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 2800
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:113498434"
variation 2860
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:144565007"
variation 2945
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377701705"
variation 2946
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370382903"
STS 3012..3137
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="D20S575E"
/db_xref="UniSTS:27990"
exon 3016..3627
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/inference="alignment:Splign:1.39.8"
variation 3021
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:201892069"
variation 3038
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:148419512"
STS 3044..3193
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="D20S1125"
/db_xref="UniSTS:1160"
STS 3059..3208
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="A003P30"
/db_xref="UniSTS:7211"
variation 3060
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:35367415"
variation 3067
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:11965"
variation 3091
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:3505"
variation 3117
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051705"
STS 3120..3224
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="G61992"
/db_xref="UniSTS:139211"
variation 3161
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051726"
variation 3193
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17632"
polyA_signal 3233..3238
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
polyA_site 3255
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
variation 3287
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145257031"
variation 3318
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147474671"
STS 3325..3436
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/standard_name="RH18314"
/db_xref="UniSTS:14814"
variation 3354
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:185873544"
variation 3379
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:189799183"
variation 3467
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:182415250"
variation 3521
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139989717"
polyA_signal 3590..3595
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
polyA_site 3616
/gene="CSE1L"
/gene_synonym="CAS; CSE1; XPO2"
ORIGIN
agagcattcctggccccgccccctgcagcgggccgctcgctcatgcgctctggcctcaggctcgctgtcgcgccattttgccggggtttgaatgtgaggcggagcggcggcaggagcgggtagtgccagctacggtccgcggctggggttccctcctccgtttctgtatccccacgagatcctatagcaatggaactcagcgatgcaaatctgcaaacactaacagaatatttaaagaaaacacttgatcctgatcctgccatccgacgtccagctgagaaatttcttgaatctgttgaaggaaatcagaattatccactgttgcttttgacattactggagaagtcccaggataatgttatcaaagtatgtgcttcagtaacattcaaaaactatattaaaaggaactggagaattgttgaagatgaaccaaacaaaatttgtgaagccgatcgagtggccattaaagccaacatagtgcacttgatgcttagcagcccagagcaaattcagaagcagttaagtgatgcaattagcattattggcagagaagattttccacagaaatggcctgacttgctgacagaaatggtgaatcgctttcagagtggagatttccatgttattaatggagtcctccgtacagcacattcattatttaaaagataccgtcatgaatttaagtcaaacgagttatggactgaaattaagcttgttctggatgcctttgctttgcctttgactaatctttttaaggccactattgaactctgcagtacccatgcaaatgatgcctctgccctgaggattctgttttcttccctgatcctgatctcaaaattgttctatagtttaaactttcaggatctccctgaattttttgaagataatatggaaacttggatgaataattttcatactctcttaacattggataataagcttttacaaactgatgatgaagaggaagccggcttattggagctcttaaaatcccagatttgtgataatgccgcactctatgcacaaaagtacgatgaagaattccagcgatacctgcctcgttttgttacagccatctggaatttactagttacaacgggtcaagaggttaaatatgatttgttggtaagtaatgcaattcaatttctggcttcagtttgtgagagacctcattataagaatctatttgaggaccagaacacgctgacaagtatctgtgaaaaggttattgtgcctaacatggaatttagagctgctgatgaagaagcatttgaagataattctgaggagtacataaggagagatttggaaggatctgatattgatactagacgcagggctgcttgtgatctggtacgaggattatgcaagttttttgagggacctgtgacaggaatcttctctggttatgttaattccatgctgcaggaatacgcaaaaaatccatctgtcaactggaaacacaaagatgcagccatctacctagtgacatctttggcatcaaaagcccaaacacagaagcatggaattacacaagcaaatgaacttgtaaacctaactgagttctttgtgaatcacatcctccctgatttaaaatcagctaatgtgaatgaatttcctgtccttaaagctgacggtatcaaatatattatgatttttagaaatcaagtgccaaaagaacatcttttagtctcgattcctctcttgattaatcatcttcaagctgaaagtattgttgttcatacttacgcagctcatgctcttgaacggctctttactatgcgagggcctaacaatgccactctctttacagctgcagaaatcgcaccgtttgttgagattctgctaacaaaccttttcaaagctctcacacttcctggctcttcagaaaatgaatatattatgaaagctatcatgagaagtttttctctcctacaagaagccataatcccctacatccctactctcatcactcagcttacacagaagctattagctgttagtaagaacccaagcaaacctcactttaatcactacatgtttgaagcaatatgtttatccataagaataacttgcaaagctaaccctgctgctgttgtaaattttgaggaggctttgtttttggtgtttactgaaatcttacaaaatgatgtgcaagaatttattccatacgtctttcaagtgatgtctttgcttctggaaacacacaaaaatgacatcccgtcttcctatatggccttatttcctcatctccttcagccagtgctttgggaaagaacaggaaatattcctgctctagtgaggcttcttcaagcattcttagaacgcggttcaaacacaatagcaagtgctgcagctgacaaaattcctgggttactaggtgtctttcagaagctgattgcatccaaagcaaatgaccaccaaggtttttatcttctaaacagtataatagagcacatgcctcctgaatcagttgaccaatataggaaacaaatcttcattctgctattccagagacttcagaattccaaaacaaccaagtttatcaagagttttttagtctttattaatttgtattgcataaaatatggggcactagcactacaagaaatatttgatggtatacaaccaaaaatgtttggaatggttttggaaaaaattattattcctgaaattcagaaggtatctggaaatgtagagaaaaagatctgtgcggttggcataaccaaattactaacagaatgtcccccaatgatggacactgagtataccaaactgtggactccattattacagtctttgattggtctttttgagttacccgaagatgataccattcctgatgaggaacattttattgacatagaagatacaccaggatatcagactgccttctcacagttggcatttgctgggaaaaaagagcatgatcctgtaggtcaaatggtgaataaccccaaaattcacctggcacagtcacttcacaagttgtctaccgcctgtccaggaagggttccatcaatggtgagcaccagcctgaatgcagaagcgctccagtatctccaagggtaccttcaggcagccagtgtgacactgctttaaactgcatttttctaatgggctaaacccagatggtttcctaggaaatcacaggcttctgagcacagctgcattaaaacaaaggaagttctccttttgaacttgtcacgaattccatcttgtaaaggatattaaatgttgctttaacctgaaccttgagcaaattagttggtttgtgtgatcatacagttatgtgggtggcttctagtttgcaacttcaagggacaagtattaatagttcagtgtatggcgttggtttgtgttgagcgtttgcacggtttggataatcttaaattttgacggacactgtggagactttctgttactaaatccttttgttttgaagctgttgctatttgtatttctcttgtcctttatattttttgtctgtttatttacgcttttattggaaatgtgaataagtaaagaattacttgtgttacttgccaagcagtgcacatttcatagtttcaaatctgtaatcagcaataaaaatcctaaaatatgtacctaagaacatcttaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1434 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1434 -> Molecular function: GO:0008262 [importin-alpha export receptor activity] evidence: TAS
GeneID:1434 -> Molecular function: GO:0008536 [Ran GTPase binding] evidence: IEA
GeneID:1434 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:1434 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:1434 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:1434 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.