GGRNA Home | Help | Advanced search

2020-10-24 07:00:27, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001278312            4408 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens nucleoporin 155kDa (NUP155), transcript variant 3,
            mRNA.
ACCESSION   NM_001278312
VERSION     NM_001278312.1  GI:509155836
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4408)
  AUTHORS   Tarazon,E., Rivera,M., Rosello-Lleti,E., Molina-Navarro,M.M.,
            Sanchez-Lazaro,I.J., Espana,F., Montero,J.A., Lago,F.,
            Gonzalez-Juanatey,J.R. and Portoles,M.
  TITLE     Heart failure induces significant changes in nuclear pore complex
            of human cardiomyocytes
  JOURNAL   PLoS ONE 7 (11), E48957 (2012)
   PUBMED   23152829
REFERENCE   2  (bases 1 to 4408)
  AUTHORS   Parvez,B. and Darbar,D.
  TITLE     The 'missing' link in atrial fibrillation heritability
  JOURNAL   J Electrocardiol 44 (6), 641-644 (2011)
   PUBMED   21924735
REFERENCE   3  (bases 1 to 4408)
  AUTHORS   Kehat,I., Accornero,F., Aronow,B.J. and Molkentin,J.D.
  TITLE     Modulation of chromatin position and gene expression by HDAC4
            interaction with nucleoporins
  JOURNAL   J. Cell Biol. 193 (1), 21-29 (2011)
   PUBMED   21464227
  REMARK    GeneRIF: The Nup155-mediated localization was required for HDAC4's
            effect on gene expression.
REFERENCE   4  (bases 1 to 4408)
  AUTHORS   Mitchell,J.M., Mansfeld,J., Capitanio,J., Kutay,U. and Wozniak,R.W.
  TITLE     Pom121 links two essential subcomplexes of the nuclear pore complex
            core to the membrane
  JOURNAL   J. Cell Biol. 191 (3), 505-521 (2010)
   PUBMED   20974814
  REMARK    GeneRIF: The Nup155 depletion massively alters nuclear envelope
            structure, causing a dramatic decrease in Nuclear pore complexes
            numbers and the improper targeting of membrane proteins to the
            inner nuclear membrane.
REFERENCE   5  (bases 1 to 4408)
  AUTHORS   Rayala,H.J., Kendirgi,F., Barry,D.M., Majerus,P.W. and Wente,S.R.
  TITLE     The mRNA export factor human Gle1 interacts with the nuclear pore
            complex protein Nup155
  JOURNAL   Mol. Cell Proteomics 3 (2), 145-155 (2004)
   PUBMED   14645504
REFERENCE   6  (bases 1 to 4408)
  AUTHORS   Le Rouzic,E., Mousnier,A., Rustum,C., Stutz,F., Hallberg,E.,
            Dargemont,C. and Benichou,S.
  TITLE     Docking of HIV-1 Vpr to the nuclear envelope is mediated by the
            interaction with the nucleoporin hCG1
  JOURNAL   J. Biol. Chem. 277 (47), 45091-45098 (2002)
   PUBMED   12228227
REFERENCE   7  (bases 1 to 4408)
  AUTHORS   Zhang,X., Yang,H., Yu,J., Chen,C., Zhang,G., Bao,J., Du,Y.,
            Kibukawa,M., Li,Z., Wang,J., Hu,S., Dong,W., Wang,J., Gregersen,N.,
            Niebuhr,E. and Bolund,L.
  TITLE     Genomic organization, transcript variants and comparative analysis
            of the human nucleoporin 155 (NUP155) gene
  JOURNAL   Gene 288 (1-2), 9-18 (2002)
   PUBMED   12034489
REFERENCE   8  (bases 1 to 4408)
  AUTHORS   Shiota,C., Coffey,J., Grimsby,J., Grippo,J.F. and Magnuson,M.A.
  TITLE     Nuclear import of hepatic glucokinase depends upon glucokinase
            regulatory protein, whereas export is due to a nuclear export
            signal sequence in glucokinase
  JOURNAL   J. Biol. Chem. 274 (52), 37125-37130 (1999)
   PUBMED   10601273
REFERENCE   9  (bases 1 to 4408)
  AUTHORS   Zhang,X., Yang,H., Corydon,M.J., Zhang,X., Pedersen,S.,
            Korenberg,J.R., Chen,X.N., Laporte,J., Gregersen,N., Niebuhr,E.,
            Liu,G. and Bolund,L.
  TITLE     Localization of a human nucleoporin 155 gene (NUP155) to the 5p13
            region and cloning of its cDNA
  JOURNAL   Genomics 57 (1), 144-151 (1999)
   PUBMED   10191094
REFERENCE   10 (bases 1 to 4408)
  AUTHORS   Gorlich,D. and Mattaj,I.W.
  TITLE     Nucleocytoplasmic transport
  JOURNAL   Science 271 (5255), 1513-1518 (1996)
   PUBMED   8599106
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC401967.1, AK315028.1,
            BM478072.1, AK297143.1, AI037962.1 and BQ435836.1.
            
            Summary: Nucleoporins are proteins that play an important role in
            the assembly and functioning of the nuclear pore complex (NPC)
            which regulates the movement of macromolecules across the nuclear
            envelope (NE). The protein encoded by this gene plays a role in the
            fusion of NE vesicles and formation of the double membrane NE. The
            protein may also be involved in cardiac physiology and may be
            associated with the pathogenesis of atrial fibrillation.
            Alternative splicing results in multiple transcript variants of
            this gene. A pseudogene associated with this gene is located on
            chromosome 6. [provided by RefSeq, May 2013].
            
            Transcript Variant: This variant (3) lacks an alternate in-frame
            exon in the 3' coding region compared to variant 1. It encodes
            isoform 3 which lacks an internal segment and is shorter, compared
            to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK315028.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-102               DC401967.1         1-102
            103-349             AK315028.1         58-304
            350-350             BM478072.1         254-254
            351-1467            AK315028.1         306-1422
            1468-2455           AK297143.1         1306-2293
            2456-2781           AK315028.1         2411-2736
            2782-4194           AK297143.1         2812-4224
            4195-4379           AI037962.1         30-214              c
            4380-4384           BQ435836.1         683-687
            4385-4408           AI037962.1         1-24                c
FEATURES             Location/Qualifiers
     source          1..4408
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5p13.1"
     gene            1..4408
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="nucleoporin 155kDa"
                     /db_xref="GeneID:9631"
                     /db_xref="HGNC:8063"
                     /db_xref="MIM:606694"
     exon            1..306
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     CDS             150..4133
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="isoform 3 is encoded by transcript variant 3;
                     nuclear pore complex protein Nup155; 155 kDa nucleoporin"
                     /codon_start=1
                     /product="nuclear pore complex protein Nup155 isoform 3"
                     /protein_id="NP_001265241.1"
                     /db_xref="GI:509155837"
                     /db_xref="GeneID:9631"
                     /db_xref="HGNC:8063"
                     /db_xref="MIM:606694"
                     /translation="
MPSSLLGAAMPASTSAAALQEALENAGRLIDRQLQEDRMYPDLSELLMVSAPNNPTVSGMSDMDYPLQGPGLLSVPNLPEISSIRRVPLPPELVEQFGHMQCNCMMGVFPPISRAWLTIDSDIFMWNYEDGGDLAYFDGLSETILAVGLVKPKAGIFQPHVRHLLVLATPVDIVILGLSYANLQTGSGVLNDSLSGGMQLLPDPLYSLPTDNTYLLTITSTDNGRIFLAGKDGCLYEVAYQAEAGWFSQRCRKINHSKSSLSFLVPSLLQFTFSEDDPILQIAIDNSRNILYTRSEKGVIQVYDLGQDGQGMSRVASVSQNAIVSAAGNIARTIDRSVFKPIVQIAVIENSESLDCQLLAVTHAGVRLYFSTCPFRQPLARPNTLTLVHVRLPPGFSASSTVEKPSKVHRALYSKGILLMAASENEDNDILWCVNHDTFPFQKPMMETQMTAGVDGHSWALSAIDELKVDKIITPLNKDHIPITDSPVVVQQHMLPPKKFVLLSAQGSLMFHKLRPVDQLRHLLVSNVGGDGEEIERFFKLHQEDQACATCLILACSTAACDREVSAWATRAFFRYGGEAQMRFPTTLPPPSNVGPILGSPVYSSSPVPSGSPYPNPSFLGTPSHGIQPPAMSTPVCALGNPATQATNMSCVTGPEIVYSGKHNGICIYFSRIMGNIWDASLVVERIFKSGNREITAIESSVPCQLLESVLQELKGLQEFLDRNSQFAGGPLGNPNTTAKVQQRLIGFMRPENGNPQQMQQELQRKFHEAQLSEKISLQAIQQLVRKSYQALALWKLLCEHQFTIIVAELQKANELLQRSRQVQNKTEKERMLRESLKEYQKISNQVDLSNVCAQYRQVRFYEGVVELSLTAAEKKDPQGLGLHFYKHGEPEEDIVGLQAFQERLNSYKCITDTLQELVNQSKAAPQSPSVPKKPGPPVLSSDPNMLSNEEAGHHFEQMLKLSQRSKDELFSIALYNWLIQVDLADKLLQVASPFLEPHLVRMAKVDQNRVRYMDLLWRYYEKNRSFSNAARVLSRLADMHSTEISLQQRLEYIARAILSAKSSTAISSIAADGEFLHELEEKMEVARIQLQIQETLQRQYSHHSSVQDAVSQLDSELMDITKLYGEFADPFKLAECKLAIIHCAGYSDPILVQTLWQDIIEKELSDSVTLSSSDRMHALSLKIVLLGKIYAGTPRFFPLDFIVQFLEQQVCTLNWDVGFVIQTMNEIGVPLPRLLEVYDQLFKSRDPFWNRMKKPLHLLDCIHVLLIRYVENPSQVLNCERRRFTNLCLDAVCGYLVELQSMSSSVAVQAITGNFKSLQAKLERLH
"
     misc_feature    378..1676
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="Nup133 N terminal like; Region: Nucleoporin_N;
                     pfam08801"
                     /db_xref="CDD:220023"
     misc_feature    2247..>2603
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="Non-repetitive/WGA-negative nucleoporin C-terminal;
                     Region: Nucleoporin_C; pfam03177"
                     /db_xref="CDD:217408"
     misc_feature    <2586..3722
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="Non-repetitive/WGA-negative nucleoporin C-terminal;
                     Region: Nucleoporin_C; pfam03177"
                     /db_xref="CDD:217408"
     exon            307..444
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            445..541
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            542..612
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            613..705
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            706..872
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            873..978
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            979..1052
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1053..1144
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1145..1242
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1243..1395
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1396..1496
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1497..1667
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1668..1778
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1779..1873
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1874..1962
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1963..2025
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2173
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2174..2240
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2241..2356
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2357..2454
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2455..2585
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2586..2724
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2725..2860
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2861..3014
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3015..3119
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3120..3274
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3275..3404
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     STS             3331..3492
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /standard_name="MARC_21512-21513:1032982746:3"
                     /db_xref="UniSTS:268564"
     exon            3405..3518
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3519..3639
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3640..3750
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3751..3887
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3888..3994
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3995..4400
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    4172..4177
                     /gene="NUP155"
                     /gene_synonym="N155"
     polyA_site      4195
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="This is an internal site."
     polyA_signal    4377..4382
                     /gene="NUP155"
                     /gene_synonym="N155"
     polyA_site      4400
                     /gene="NUP155"
                     /gene_synonym="N155"
ORIGIN      
atgaagcggaagtgcgtcatgtcgaggcgccaaggcgctcgtttggcgcgcgcgccctaggcggcggatctaagctaacttcttggatcttttcttgtttctccttggtttttgactttttctggaccctggtgtctacgatttccgagatgccgtcttctttgttgggcgcggcgatgccggcctctacatctgccgcagccctgcaggaagctctggaaaatgctggacggctcatcgaccgtcagttgcaagaggaccgcatgtacccggacctttccgagctgcttatggtgtctgccccaaataatcccaccgtttctggcatgtcagatatggattatcctttgcaaggacctggtttgctgtccgtacccaaccttccagagatcagttccatccgaagagttcctctcccacctgaacttgttgagcagtttggacatatgcagtgtaattgcatgatgggtgtgttccctcctatcagcagagcttggctcacaattgacagtgatatattcatgtggaactatgaggatggaggagaccttgcctattttgatggacttagtgagactattcttgctgtggggcttgtgaagccaaaagcaggcatctttcaacctcatgtgcgacacctcctggttttggcgacccctgtagacatagtaattcttggactcagctatgctaatttgcaaacaggttctggagttcttaatgatagtttgtctggtggaatgcagttgcttccagatcctttatattctcttcctactgataatacttaccttttaacaataacttccactgataatggcagaattttcttggctggaaaggatggctgtttatatgaagtagcctaccaggctgaagcagggtggtttagccaaagatgtaggaaaataaaccactcaaagagctcactttctttccttgttccttccttgctacaattcacgttctcagaagatgatcctattcttcaaattgcaattgataattctagaaatattttatatacacgatctgagaaaggagtaatacaggtgtatgatttgggacaagatggacaaggaatgagcagagttgcctctgtgtcacagaatgccattgtctctgctgctggtaacattgctaggaccatcgatcgttctgtttttaaaccaattgtccaaatagcagtgattgaaaattctgaatcactggactgtcagttattggctgtcacacatgcaggtgttaggttatattttagcacttgtccattcagacagccattagcacggcctaatacactgacgctggttcatgtccgcttacctcctggattctcagcatcttcaaccgtggaaaagccttcaaaagtacatagagctctttatagtaaaggtattctattgatggcagcctcagaaaatgaggataatgatattttatggtgtgtcaaccatgatacttttcctttccaaaagccaatgatggaaacccagatgacagctggtgttgatggtcattcctgggctctttctgcgatagatgaattgaaagtagataaaataattacacctttaaacaaggatcatattccaataactgattcaccagttgttgtacagcagcacatgttacctccgaagaaatttgttctcctctcagcacaggggagccttatgtttcataaacttagacctgtagatcaactgaggcatctacttgtgagtaatgtgggaggagatggagaagagattgaaagattctttaaattacatcaggaagaccaggcttgtgcaacttgccttattcttgcttgctccactgctgcctgtgatagagaagtatctgcctgggctactcgggctttctttaggtatggtggtgaagcacagatgagatttccaaccactcttccgcctccaagtaatgttggtcccatcttggggtctcctgtctattctagttctcctgttcctagtggtagtccctatccaaatccatcctttttgggaacaccgtctcatggtatacagcctcctgccatgtcaactccagtgtgtgctctgggaaacccagcaactcaggccacaaatatgagttgtgtgactggaccagagattgtgtactctggaaaacacaatggtatttgcatttacttttctcggatcatgggaaacatttgggatgcaagcttagttgtggagagaatattcaagagtggcaacagagagatcactgcaattgaaagtagtgttccctgccaactgctagagtcagtgctacaagaactaaagggtttgcaggaatttctagacagaaactcccagtttgcaggaggaccattaggaaatccaaatactactgctaaagtgcagcagaggctgataggattcatgcgtcctgaaaacggaaatccccagcaaatgcaacaggaactgcagaggaagtttcatgaggctcaactaagtgaaaagatttcacttcaggcaattcagcagttggttcgaaaatcatatcaggctctggctttatggaaacttctttgtgaacatcaattcactatcattgtggcagaacttcagaaggcaaatgagcttctccagcgttcccgacaagttcaaaataagactgaaaaagaaagaatgttaagggaatcattaaaggaatatcaaaaaattagcaatcaagtggacctttccaatgtttgtgctcagtatagacaagtgagattttatgagggtgtggtggaactttctcttacggctgcagagaaaaaagatcctcaaggtcttgggcttcatttctataaacatggagaaccagaagaagacatagttggacttcaggccttccaagaaagattaaacagttacaaatgcattacagacacacttcaagaactggtaaatcaaagtaaggccgctcctcagtctcccagtgtacccaaaaaacctggtcctccagtgttgtcatctgatccaaatatgctgagtaatgaagaagcaggacatcattttgaacaaatgcttaaattgtcacagcgatccaaggatgagctctttagtattgccctttataattggctaatacaagtcgaccttgcagataagctgctacaggttgcttctccatttctggagccacatctagtccgaatggccaaagttgatcaaaacagagttcgttatatggatttactctggcggtattacgagaagaacagaagtttcagtaatgctgctcgtgtactgtccagactggctgacatgcatagcacagaaatttcacttcagcagcgactagagtacattgctcgagccattcttagtgccaaaagttccactgccatttcatcaatagctgccgatggtgaatttcttcatgaattagaagaaaaaatggaggttgctaggatccaacttcagatacaggagacactacaaaggcagtattcccatcattcttctgtacaggatgcagtttctcagctggattctgagctgatggacataactaagctttatggggaatttgctgacccatttaaacttgcagagtgcaaacttgcaataattcattgtgccggttattcagaccctatattggtgcagacactttggcaagatatcatagagaaagaattgagtgacagtgtgacattgagctcctcggatagaatgcatgctcttagtctcaagattgttctccttggcaaaatttatgctggcacaccacgcttctttcctttagattttattgtacagtttttagaacagcaggtttgtactttgaactgggatgtgggcttcgtaatacagacaatgaatgaaattggagtaccattacctagactactagaagtttatgatcagttgttcaaatcacgggatccattctggaacagaatgaagaagccactgcaccttttggattgtatacatgtattattgataagatatgttgagaatcccagccaagttttaaattgtgaaaggagaagatttacaaatctctgcctggatgctgtttgtggttaccttgttgagctccagtctatgagctcgtcagtagcagtacaagccatcactgggaattttaaatctcttcaagctaaattagaacggcttcattaattactgtgatatactttcatccgttttatgatctgtaaaataaaaactcagctgggtccagatatcaggtgttctaaatctaagaatgtaagaacaatcttaatagaaatatgtttttaataagtggctaatatctacaaatagtacctttgctaaatgaattcttttttatgactattttgttttttagtaattgggtgaaaaaacaactgaaatgagattatttattattttaacataaggattaaaaaaatttagaaactcttaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9631 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
            GeneID:9631 -> Molecular function: GO:0017056 [structural constituent of nuclear pore] evidence: IEA
            GeneID:9631 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:9631 -> Biological process: GO:0005975 [carbohydrate metabolic process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0006406 [mRNA export from nucleus] evidence: IEA
            GeneID:9631 -> Biological process: GO:0006606 [protein import into nucleus] evidence: IEA
            GeneID:9631 -> Biological process: GO:0006998 [nuclear envelope organization] evidence: IDA
            GeneID:9631 -> Biological process: GO:0007077 [mitotic nuclear envelope disassembly] evidence: TAS
            GeneID:9631 -> Biological process: GO:0008645 [hexose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0010827 [regulation of glucose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0015758 [glucose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0016032 [viral process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: TAS
            GeneID:9631 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0086014 [regulation of atrial cardiac muscle cell action potential] evidence: IEA
            GeneID:9631 -> Cellular component: GO:0005635 [nuclear envelope] evidence: IDA
            GeneID:9631 -> Cellular component: GO:0005635 [nuclear envelope] evidence: TAS
            GeneID:9631 -> Cellular component: GO:0005643 [nuclear pore] evidence: IEA
            GeneID:9631 -> Cellular component: GO:0031965 [nuclear membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.