Home |
Help |
Advanced search
2024-04-20 07:34:26, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001278063 3048 bp mRNA linear PRI 08-JUL-2013
DEFINITION Homo sapiens SKI family transcriptional corepressor 2 (SKOR2),
transcript variant 1, mRNA.
ACCESSION NM_001278063 XM_001715219 XM_003403698 XM_003960751
VERSION NM_001278063.1 GI:491228691
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3048)
AUTHORS Elks CE, Perry JR, Sulem P, Chasman DI, Franceschini N, He C,
Lunetta KL, Visser JA, Byrne EM, Cousminer DL, Gudbjartsson DF,
Esko T, Feenstra B, Hottenga JJ, Koller DL, Kutalik Z, Lin P,
Mangino M, Marongiu M, McArdle PF, Smith AV, Stolk L, van Wingerden
SH, Zhao JH, Albrecht E, Corre T, Ingelsson E, Hayward C, Magnusson
PK, Smith EN, Ulivi S, Warrington NM, Zgaga L, Alavere H, Amin N,
Aspelund T, Bandinelli S, Barroso I, Berenson GS, Bergmann S,
Blackburn H, Boerwinkle E, Buring JE, Busonero F, Campbell H,
Chanock SJ, Chen W, Cornelis MC, Couper D, Coviello AD, d'Adamo P,
de Faire U, de Geus EJ, Deloukas P, Doring A, Smith GD, Easton DF,
Eiriksdottir G, Emilsson V, Eriksson J, Ferrucci L, Folsom AR,
Foroud T, Garcia M, Gasparini P, Geller F, Gieger C, Gudnason V,
Hall P, Hankinson SE, Ferreli L, Heath AC, Hernandez DG, Hofman A,
Hu FB, Illig T, Jarvelin MR, Johnson AD, Karasik D, Khaw KT, Kiel
DP, Kilpelainen TO, Kolcic I, Kraft P, Launer LJ, Laven JS, Li S,
Liu J, Levy D, Martin NG, McArdle WL, Melbye M, Mooser V, Murray
JC, Murray SS, Nalls MA, Navarro P, Nelis M, Ness AR, Northstone K,
Oostra BA, Peacock M, Palmer LJ, Palotie A, Pare G, Parker AN,
Pedersen NL, Peltonen L, Pennell CE, Pharoah P, Polasek O, Plump
AS, Pouta A, Porcu E, Rafnar T, Rice JP, Ring SM, Rivadeneira F,
Rudan I, Sala C, Salomaa V, Sanna S, Schlessinger D, Schork NJ,
Scuteri A, Segre AV, Shuldiner AR, Soranzo N, Sovio U, Srinivasan
SR, Strachan DP, Tammesoo ML, Tikkanen E, Toniolo D, Tsui K,
Tryggvadottir L, Tyrer J, Uda M, van Dam RM, van Meurs JB,
Vollenweider P, Waeber G, Wareham NJ, Waterworth DM, Weedon MN,
Wichmann HE, Willemsen G, Wilson JF, Wright AF, Young L, Zhai G,
Zhuang WV, Bierut LJ, Boomsma DI, Boyd HA, Crisponi L, Demerath EW,
van Duijn CM, Econs MJ, Harris TB, Hunter DJ, Loos RJ, Metspalu A,
Montgomery GW, Ridker PM, Spector TD, Streeten EA, Stefansson K,
Thorsteinsdottir U, Uitterlinden AG, Widen E, Murabito JM, Ong KK
and Murray A.
CONSRTM GIANT Consortium
TITLE Thirty new loci for age at menarche identified by a meta-analysis
of genome-wide association studies
JOURNAL Nat. Genet. 42 (12), 1077-1085 (2010)
PUBMED 21102462
REFERENCE 2 (bases 1 to 3048)
AUTHORS Bennett,K.L., Lee,W., Lamarre,E., Zhang,X., Seth,R., Scharpf,J.,
Hunt,J. and Eng,C.
TITLE HPV status-independent association of alcohol and tobacco exposure
or prior radiation therapy with promoter methylation of FUSSEL18,
EBF3, IRX1, and SEPT9, but not SLC5A8, in head and neck squamous
cell carcinomas
JOURNAL Genes Chromosomes Cancer 49 (4), 319-326 (2010)
PUBMED 20029986
REMARK GeneRIF: Results verify IRX1, EBF3, SLC5A8, SEPT9, and FUSSEL18 as
valid methylation markers in two separate sets of HNSCC specimens;
also preliminarily show a trend between HPV16 positivity and target
gene hypermethylation of IRX1, EBF3, SLC5A8, and SEPT9.
REFERENCE 3 (bases 1 to 3048)
AUTHORS Minaki,Y., Nakatani,T., Mizuhara,E., Inoue,T. and Ono,Y.
TITLE Identification of a novel transcriptional corepressor, Corl2, as a
cerebellar Purkinje cell-selective marker
JOURNAL Gene Expr. Patterns 8 (6), 418-423 (2008)
PUBMED 18522874
REMARK GeneRIF: Experiments performed using mice, but the observations
maybe relevant to other organisms as well.
REFERENCE 4 (bases 1 to 3048)
AUTHORS Arndt,S., Poser,I., Schubert,T., Moser,M. and Bosserhoff,A.K.
TITLE Cloning and functional characterization of a new Ski homolog,
Fussel-18, specifically expressed in neuronal tissues
JOURNAL Lab. Invest. 85 (11), 1330-1341 (2005)
PUBMED 16200078
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC051635.7 and DW009659.1.
On or before May 9, 2013 this sequence version replaced
gi:397139678, gi:410173522, gi:397137840.
Transcript Variant: This variant (1) represents the longer
transcript, and encodes the longer isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for this
transcript record were based on alignment of human and orthologous
mouse transcripts.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2613 AC051635.7 31536-34148
2614-2818 DW009659.1 98-302
2819-2917 AC051635.7 50162-50260
2918-2985 AC051635.7 60709-60776
2986-3048 AC051635.7 68568-68630
FEATURES Location/Qualifiers
source 1..3048
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="18"
/map="18q21.1"
gene 1..3048
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/note="SKI family transcriptional corepressor 2"
/db_xref="GeneID:652991"
/db_xref="HGNC:32695"
CDS 1..3048
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/note="isoform 1 is encoded by transcript variant 1;
functional smad suppressing element 18; ladybird homeobox
corepressor 1-like protein; fussel-18; LBX1 corepressor
1-like protein; functional Smad-suppressing element on
chromosome 18"
/codon_start=1
/product="SKI family transcriptional corepressor 2 isoform
1"
/protein_id="NP_001264992.1"
/db_xref="GI:491228692"
/db_xref="GeneID:652991"
/db_xref="HGNC:32695"
/translation="
MASSPLPGPNDILLASPSSAFQPDTLSQPRPGHANLKPNQVGQVILYGIPIVSLVIDGQERLCLAQISNTLLKNFSYNEIHNRRVALGITCVQCTPVQLEILRRAGAMPISSRRCGMITKREAERLCKSFLGENRPPKLPDNFAFDVSHECAWGCRGSFIPARYNSSRAKCIKCSYCNMYFSPNKFIFHSHRTPDAKYTQPDAANFNSWRRHLKLTDKSPQDELVFAWEDVKAMFNGGSRKRALPQPGAHPACHPLSSVKAAAVAAAAAVAGGGGLLGPHLLGAPPPPPPPPPPLAELAGAPHAHHKRPRFDDDDDSLQEAAVVAAASLSAAAASLSVAAASGGAGTGGGGAGGGCVAGVGVGAGAGAGAGAGAKGPRSYPVIPVPSKGSFGGVLQKFPGCGGLFPHPYTFPAAAAAFSLCHKKEDAGAAAEALGGAGAGGAGAAPKAGLSGLFWPAGRKDAFYPPFCMFWPPRTPGGLPVPTYLQPPPQPPSALGCALGESPALLRQAFLDLAEPGGAAGSAEAAPPPGQPPQVVANGPGSGPPPPAGGAGSRDALFESPPGGSGGDCSAGSTPPADSVAAAGAGAAAAGSGPAGSRVPAPHHPHLLEGRKAGGGSYHHSSAFRPVGGKDDAESLAKLHGASAGAPHSAQTHPHHHHHPHHHHHHHHPPQPPSPLLLLPPQPDEPGSERHHPAPPPPPPPPPPPPLAQHPHHRGLLSPGGTSCCYPSEDSSEDEDDEEEEQEVDVEGHKPPEGEEEEEGRDPDDDEEEDEETEVLLGDPLVGGGRFLQGRGPSEKGSSRDRAPAVAGAFPLGLNSSRLLQEDGKLGDPGSDLPPPPPPPLAPQKASGGGSSSPGSPVHHPSLEEQPSYKDSQKTKENNQVIVSTKDDNSFSDKNKEHSFFITDSDASGGDFWRERSGEHTQETNSPHSLKKDVENMGKEELQKVLFEQIDLRRRLEQEFQVLKGNTSFPVFNNFQDQMKRELAYREEMVQQLQIIPYAASLIRKEKLGAHLSKS
"
misc_feature 100..399
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/note="SKI/SNO/DAC family; Region: Ski_Sno; pfam02437"
/db_xref="CDD:145533"
misc_feature 430..708
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/note="c-SKI Smad4 binding domain; Region:
c-SKI_SMAD_bind; smart01046"
/db_xref="CDD:198114"
exon 1..2613
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
variation complement(57)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="t"
/db_xref="dbSNP:376817644"
STS 101..623
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/standard_name="Fussel18"
/db_xref="UniSTS:497289"
variation complement(345)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="t"
/db_xref="dbSNP:371202595"
variation complement(431)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="t"
/db_xref="dbSNP:376365161"
variation complement(527)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="t"
/db_xref="dbSNP:202063106"
variation complement(702)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="g"
/db_xref="dbSNP:373929593"
variation complement(713)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="g"
/db_xref="dbSNP:188936589"
variation complement(881)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="g"
/db_xref="dbSNP:111300606"
variation complement(1000)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="g"
/db_xref="dbSNP:184619951"
variation complement(1040)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="c"
/db_xref="dbSNP:57216407"
variation complement(1312)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="g"
/db_xref="dbSNP:112028746"
variation complement(1479)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="g"
/db_xref="dbSNP:141162442"
variation complement(1749)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="c"
/db_xref="dbSNP:370190668"
variation complement(1855)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace=""
/replace="c"
/db_xref="dbSNP:200380139"
variation complement(2173)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="t"
/db_xref="dbSNP:9956387"
variation complement(2346)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="g"
/db_xref="dbSNP:192360549"
variation complement(2487)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="t"
/db_xref="dbSNP:35717325"
variation complement(2488)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="g"
/db_xref="dbSNP:111245748"
exon 2614..2677
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
exon 2678..2752
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
variation complement(2731)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="g"
/db_xref="dbSNP:189508010"
variation complement(2736)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="g"
/replace="t"
/db_xref="dbSNP:185081406"
exon 2753..2818
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
variation complement(2773)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="c"
/db_xref="dbSNP:186934427"
variation complement(2780)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="t"
/db_xref="dbSNP:77291182"
exon 2819..2917
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
variation complement(2840)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="g"
/replace="t"
/db_xref="dbSNP:7235231"
variation complement(2857)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="c"
/replace="g"
/db_xref="dbSNP:75475550"
exon 2918..2985
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
exon 2986..3048
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/inference="alignment:Splign:1.39.8"
variation complement(2986)
/gene="SKOR2"
/gene_synonym="CORL2; FUSSEL18"
/replace="a"
/replace="t"
/db_xref="dbSNP:191994953"
ORIGIN
atggcttccagtccgctgccagggcccaacgacatcctgctggcgtcgccgtcgagcgccttccagcccgacacgctgagccagccgcggccagggcacgccaacctcaaacccaaccaggtgggccaggtgatcctctacggcattcccatcgtgtcgttggtgatcgacgggcaagagcgcctgtgcctggcgcagatctccaacactctgctcaagaacttcagctacaacgagatccacaaccgtcgcgtggcactgggcatcacgtgtgtgcagtgcacgccggtgcaactggagatcctgcggcgtgccggggccatgcccatctcatcgcgccgctgcggcatgatcaccaaacgcgaggccgagcgtctgtgcaagtcgttcctgggcgaaaacaggccgcccaagctgccagacaatttcgccttcgacgtgtcacacgagtgcgcctggggctgccgcggcagcttcattcccgcgcgctacaacagctcgcgcgccaagtgcatcaaatgcagctactgcaacatgtacttctcgcccaacaagttcattttccactcccaccgcacgcccgacgccaagtacactcagccagacgcagccaacttcaactcgtggcgccgtcatctcaagctcaccgacaagagtccccaggacgagctggtcttcgcctgggaggacgtcaaggccatgttcaacggcggcagccgcaagcgcgcactgccccagccgggcgcgcaccccgcctgccacccgctcagctctgtgaaggcggccgccgtggccgccgcggccgcggtggccggaggcgggggtctgctgggcccccacctgctgggtgcgcccccgccgccgccgccgccaccgccgcccttggcagagctggctggtgccccgcacgcccatcacaagcggccgcgcttcgacgacgacgacgactccttgcaggaggccgccgtagtggccgccgccagcctctcggccgcagccgccagcctctctgtggctgctgcttcgggcggcgcggggactggtgggggcggcgctgggggtggctgtgtggccggcgtgggcgtgggcgcgggcgcgggggcgggtgccggggcaggggccaaaggcccgcgcagctacccagtcatcccggtgcccagcaagggctcgttcgggggcgtcctgcagaagttcccgggctgcggcgggctcttcccgcacccctacaccttccctgccgcggccgccgccttcagcttgtgccataagaaagaggatgcgggtgccgccgctgaggccctggggggcgcgggcgcaggcggcgcgggcgcggcgcccaaggccggcttgtccggcctcttctggcccgcgggccgcaaggacgccttctatccgcccttctgcatgttctggccgccgcggacccctggcgggctcccggtgcccacctacctgcagcccccgcctcagccgccctcggcgctaggctgcgcgctaggcgaaagcccggccctgctgcgccaggccttcctggacctggctgagccaggcggtgctgctgggagcgccgaggccgcgcccccgccggggcagcccccgcaggtagtggccaacggcccgggctccggcccacctcctcctgccgggggcgccggctctcgcgacgcgctcttcgagtcgcccccgggcggcagcggcggggactgcagcgcgggctccacgccgcccgcggactctgtggcagctgccggggcaggggccgcggccgccgggtctggccccgcgggctcccgggttccggcgccccaccatccgcaccttctggaggggcgcaaagcgggcggtggcagctaccaccattccagcgccttccggccagtgggcggcaaggacgacgcggagagcctggccaagctgcacggggcgtcggcgggcgcgccccactcggcccagacgcatccccaccaccatcaccaccctcaccaccaccaccaccaccaccaccccccgcagccgccgtcgccgcttctgctgctgcccccgcagcccgacgagccgggttccgagcgccaccacccggccccgccgccgccgccgccgccgcccccgccgccccctctggcccagcacccgcaccaccgaggccttctgtctcccgggggaaccagctgctgctaccccagcgaggacagctccgaggacgaggacgacgaggaagaagagcaggaggtggacgtggagggccacaagccccccgagggcgaggaagaggaggaaggtcgagaccctgacgacgacgaggaagaggacgaggagacggaggtcctactcggcgaccccttagtcgggggcggccggttcctccagggccgagggccgtcggagaaggggagcagccgggaccgcgcgccggccgtcgcgggcgcgttcccgctcggcctgaactcctccaggctgctgcaggaagacgggaaactcggggaccccggctcggacctgcccccgcccccgccgccgcccctggccccccagaaggcgagtggcggcggcagcagcagcccgggcagcccagttcaccatccatcactggaggagcagccctcctacaaagatagtcagaaaactaaggaaaataaccaagtaattgtatctacaaaggatgacaacagcttttcagataagaacaaggagcatagctttttcatcacagactctgatgcttctggaggagatttttggagagaaagatcaggtgaacatacacaagaaaccaactcacctcattcactgaaaaaggatgtagaaaatatggggaaagaagaacttcagaaggttttatttgaacaaatagatttacggagacgactggaacaagaattccaggtgttaaaaggaaacacatctttcccagtattcaataattttcaggatcagatgaaaagggagctagcctaccgagaagaaatggtgcaacagttacaaattatcccctatgcagcaagtttgatcaggaaagaaaagcttggcgcccatctcagcaaaagctaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:652991 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA
GeneID:652991 -> Molecular function: GO:0003714 [transcription corepressor activity] evidence: ISS
GeneID:652991 -> Molecular function: GO:0042826 [histone deacetylase binding] evidence: IEA
GeneID:652991 -> Molecular function: GO:0046332 [SMAD binding] evidence: IPI
GeneID:652991 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IBA
GeneID:652991 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:652991 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
GeneID:652991 -> Biological process: GO:0021702 [cerebellar Purkinje cell differentiation] evidence: IEA
GeneID:652991 -> Biological process: GO:0021936 [regulation of cerebellar granule cell precursor proliferation] evidence: IEA
GeneID:652991 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA
GeneID:652991 -> Biological process: GO:0030514 [negative regulation of BMP signaling pathway] evidence: IEA
GeneID:652991 -> Biological process: GO:0045880 [positive regulation of smoothened signaling pathway] evidence: IEA
GeneID:652991 -> Biological process: GO:0048814 [regulation of dendrite morphogenesis] evidence: IEA
GeneID:652991 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:652991 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.